def test_fixed_path_kmers_1() :
random.seed(17)
K = 25
D = 3
N = 100
e = 0.01
alts = {'A':['C','G','T'], 'C':['A','G','T'], 'G':['A','C','T'], 'T':['A','C','G']}
seq = 'TACTTGCACTGGGAGGCACAGCGGCTTTTCAGTGTCACAGGTATTACGAG'
L = len(seq)
xs = kmersList(K, seq)
X = {}
for i in range(N):
r = []
for j in range(L):
b = seq[j]
if random.random() < e:
b = random.choice(alts[b])
r.append(b)
s = ''.join(r)
ys = kmersList(K, s)
for y in ys:
if y not in X:
X[y] = 0
X[y] += 1
Y = fixed_path_kmers(K, D, X, xs)
assert Y is not None
assert len(Y) == len(xs)
for i in range(len(Y)):
assert xs[i] in Y[i]
V = [(render(K, y), X[y]) for y in Y[i] if y != xs[i] and X[y] > X[xs[i]]]
assert len(V) == 0
def test_junction_kmers() :
K = 25
seq = 'TACTTGCACTGGGAGGCACAGCGGCTTTTCAGTGTCACAGGTATTACGAG'
xs = kmersList(K, seq)
assert len(xs) == K+1
ys = junction_kmers(K, xs[0], xs[-1])
assert xs == ys
def addReadAndKmers(self, rd):
xs = kmersList(self.K, rd[1], True)
ns = []
for x in xs:
if x not in self.baits:
continue
ns += self.baits[x]
if len(ns) == 0:
return
ns = set(ns)
for n in ns:
self.capReadCounts[n] += 1
if self.reads:
for n in ns:
self.capReads[n][0] += rd
if self.kmers:
for n in ns:
ys = self.capKmers[n]
for x in xs:
if x not in ys:
ys[x] = 0
ys[x] += 1
def findFairlySimpleAllele(K, D, lhs, mid, rhs, mx):
allele = consAllele(lhs, mid, rhs, K - 1, K - 1)
xs = kmersList(K, allele)
Y = fixed_path_kmers(K, D, mx, xs)
if Y is None:
return
ancPath = []
cov = []
for i in range(len(xs)):
ys = Y[i]
(y, c) = consensus_kmer(K, ys, mx)
ancPath.append(y)
cov.append(c)
seq = renderPath(K, ancPath)
res = {}
res['ancPath'] = ancPath
res['allele'] = seq
res['covMin'] = min(cov)
res['path'] = ancPath
res['lhsPos'] = 0
res['rhsPos'] = 0
yield res
def score(self, res, lhs, seq, rhs):
Km1 = self.K - 1
Kp1 = self.K + 1
xs = res['path']
r = [0 for i in range(Kp1)]
if seq is None:
n = len(res['allele'])
allele = consAllele(lhs, n * 'N', rhs, Km1 + res['lhsPos'],
Km1 + res['rhsPos'])
r[0] += len(xs)
else:
allele = consAllele(lhs, seq, rhs, Km1 + res['lhsPos'],
Km1 + res['rhsPos'])
ys = kmersList(self.K, allele)
for d in [ham(x, y) for (x, y) in zip(xs, ys)]:
r[d] += 1
res['hammingProfile'] = r
res['hammingCdf'] = counts2cdf(r)
res['ksDist'] = ksDistance2(res['hammingCdf'], self.nullCdf)[0]
res['hamming'] = hamming(allele, renderPath(self.K, xs))
p = 1.0
for d in xrange(Kp1):
p *= math.pow(self.binModel[d], r[d])
res['binom'] = 1.0 - p
def test_fixed_path_kmers_2() :
random.seed(17)
K = 25
D = 3
N = 100
e = 0.01
seq0 = 'TACTTGCACTGGGAGGCACAGCGGCTTTTCAGTGTCACAGGTATTACGAG'
seq1 = 'TACTTGCACTGGGAGGCCCAGCGGCTTTTCAGTGTCACAGGTATTAGGAG'
xs = kmersList(K, seq0)
ys = kmersList(K, seq1)
X = dict([(y, 1) for y in ys])
Y = fixed_path_kmers(K, D, X, xs)
assert Y is not None
assert len(Y) == len(xs)
for i in range(len(Y)):
assert len(Y[i]) == 1
assert ys[i] in Y[i]
def test_interpolate0Exacxt() :
K = 25
seq = "GGAGTTTCCAAGAGAAAATTTAGAGTTTGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAAC"
ks = kmersList(K, seq, False)
x = ks[0]
xs = dict([(x, 1)])
p = interpolate(K, xs, x, x, 1)
assert p is not None
assert len(p) == 1
assert p[0] == x
def main(argv):
opts = docopt.docopt(__doc__, argv)
K = int(opts['-k'])
B = int(opts['-b'])
paired = opts['-p']
verbose = opts['-v']
Z = opts['-z']
names = []
seqs = []
baits = {}
with openFile(opts['<sequences>']) as f:
for (nm, seq) in readFasta(f):
n = len(names)
names.append(nm)
seqs.append(seq)
for x in kmersList(K, seq, True):
if x not in baits:
baits[x] = set([])
baits[x].add(n)
N = len(names)
caches = [ReadCache(opts['-P'], names[n], paired, B, Z) for n in range(N)]
nr = 0
nh = 0
for itm in reads(opts['<input>'],
reads=True,
kmers=True,
fwdOnly=True,
paired=paired,
verbose=verbose):
nr += 1
E = len(itm.kmers)
hits = set([])
for i in xrange(E):
fwd = itm.kmers[i]
for x in fwd:
if x in baits:
hits |= baits[x]
for n in hits:
caches[n].add(itm.reads)
if len(hits) > 0:
nh += 1
for n in xrange(N):
caches[n].end()
def findSimpleAllele(K, lhs, mid, rhs, mx):
allele = consAllele(lhs, mid, rhs, K - 1, K - 1)
xs = kmersList(K, allele)
m = min([mx.get(x, 0) for x in xs])
res = {}
res['allele'] = mid
res['covMin'] = m
res['path'] = xs
res['lhsPos'] = 0
res['rhsPos'] = 0
return res
def test_interpolate3Exacxt() :
K = 25
seq = "GGAGTTTCCAAGAGAAAATTTAGAGTTTGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAAC"
ks = kmersList(K, seq, False)
x = ks[0]
y = ks[-1]
xs = dict([(z, 1) for z in ks])
p = interpolate(K, xs, x, y, slice(len(ks)+1))
assert p is not None
assert len(p) == len(ks)
for i in range(len(ks)):
assert ks[i] == p[i]
def test_interpolate1Exacxt() :
K = 25
seq = "GGAGTTTCCAAGAGAAAATTTAGAGTTTGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAAC"
ks = kmersList(K, seq, False)[:2]
x = ks[0]
y = ks[1]
xs = dict([(z, 1) for z in ks])
p = interpolate(K, xs, x, y, 2)
assert p is not None
assert len(p) == 2
assert p[0] == x
assert p[1] == y
def test_fixed_path_kmers_0() :
K = 25
D = 3
seq = 'TACTTGCACTGGGAGGCACAGCGGCTTTTCAGTGTCACAGGTATTACGAG'
xs = kmersList(K, seq)
X = dict([(x,1) for x in xs])
Y = fixed_path_kmers(K, D, X, xs)
assert Y is not None
assert len(Y) == len(xs)
for i in range(len(Y)):
assert len(Y[i]) == 1
assert Y[i][0] == xs[i]
def parseFiles(K, paired, fns, verbose):
M = (1 << 18) - 1
rn = 0
if not paired:
for fn in fns:
with openFile(fn) as f:
rn += 1
if verbose and (rn & M) == 0:
print >> sys.stderr, 'reads processed: %d' % (rn,)
xs = kmersList(K, fq1[1], False)
yield xs
return
for (fn1, fn2) in pairs(fns):
with openFile(fn1) as f1, openFile(fn2) as f2:
for fq1, fq2 in both(readFastq(f1), readFastq(f2)):
rn += 1
if verbose and (rn & M) == 0:
print >> sys.stderr, 'read pairs processed: %d' % (rn,)
xs = kmersList(K, fq1[1], False) + [rc(K, x) for x in kmersList(K, fq2[1], False)]
yield xs
def addBait(self, nm, seq, bothStrands=True):
n = len(self.names)
self.names.append(nm)
self.nameIdx[nm] = n
for x in kmersList(self.K, seq, bothStrands):
if x not in self.baits:
self.baits[x] = [n]
elif self.baits[x][-1] != n:
self.baits[x].append(n)
self.capReadCounts.append(0)
self.capReads.append([[], []])
self.capKmers.append({})
return n
def addReadPairAndKmers(self, lhs, rhs):
xs = kmersList(self.K, lhs[1], True)
ys = kmersList(self.K, rhs[1], True)
ns = []
for x in xs:
if x not in self.baits:
continue
ns += self.baits[x]
for y in ys:
if y not in self.baits:
continue
ns += self.baits[y]
if len(ns) == 0:
return
ns = set(ns)
for n in ns:
self.capReadCounts[n] += 1
if self.reads:
for n in ns:
self.capReads[n][0] += lhs
self.capReads[n][1] += rhs
if self.kmers:
for n in ns:
zs = self.capKmers[n]
for x in xs:
if x not in zs:
zs[x] = 0
zs[x] += 1
for y in ys:
if y not in zs:
zs[y] = 0
zs[y] += 1
def addRead(self, rd):
assert self.reads
xs = kmersList(self.K, rd[1], True)
ns = []
for x in xs:
if x not in self.baits:
continue
ns += self.baits[x]
if len(ns) == 0:
return
ns = set(ns)
for n in ns:
self.capReadCounts[n] += 1
self.capReads[n][0] += rd
def __init__(self, K, refList):
self.K = K
self.exonLengths = [0 for i in range(len(refList))]
idx = {}
for i in range(len(refList)):
itm = refList[i]
for x in kmersList(self.K, itm['seq'], False):
if x not in idx:
idx[x] = set([])
idx[x].add(i)
self.exonLengths[i] += 1
self.idxUpper = {}
self.idxLower = {}
for x in idx.iterkeys():
k = tuple(sorted(idx[x]))
h = sig(k)
if h not in self.idxLower:
self.idxLower[h] = k
self.idxUpper[x] = h
def main(argv):
opts = docopt.docopt(__doc__, argv)
K = int(opts['-k'])
C = int(opts['-c'])
Q = int(opts['-q'])
S = int(opts['-S'])
P = float(opts['-p'])
verbose = opts['-v']
both = True
if opts['-s']:
both = False
res = []
for fn in opts['<input>']:
fres = {}
fres['file'] = fn
fres['contigs'] = []
glob = {}
ncontig = 0
with openFile(fn) as f:
for (nm, seq) in readFasta(f):
ncontig += 1
scaff = {}
for x in kmersList(K, seq, both):
if sub(S, P, x):
scaff[x] = 1 + scaff.get(x, 0)
summary = summarize(scaff, C, Q)
summary['name'] = nm
fres['contigs'].append(summary)
for (x, c) in scaff.items():
glob[x] = c + glob.get(x, 0)
fres['global'] = summarize(glob, C, Q)
res.append(fres)
yaml.safe_dump(res, sys.stdout)
def main(argv):
opts = docopt.docopt(__doc__, argv)
K = int(opts['-k'])
M = (1 << (2*K)) - 1
paired = True
if opts['-s']:
paired = False
p = float(opts['-p'])
T = int(M * p)
if opts['-r']:
refs = []
with openFile(opts['-r']) as f:
for (nm, seq) in readFasta(f):
refs += kmersList(K, seq, False)
refs = set(refs)
kill = set([])
for x in refs:
y = rc(K, x)
if y in refs:
kill.add(x)
kill.add(y)
print >> sys.stderr, 'removing %d/%d' % (len(kill), len(refs))
refs -= set(kill)
fwd = {}
rev = {}
for xs in parseFiles(K, paired, opts['<fastq>'], opts['-v']):
fn = 0
for x in xs:
if x in refs:
fn += 1
ys = [rc(K, x) for x in xs]
rn = 0
for y in ys:
if y in refs:
rn += 1
if fn + rn == 0:
continue
q = float(fn) / float(fn + rn)
if random.random() < q:
for x in xs:
fwd[x] = 1 + fwd.get(x, 0)
else:
for y in ys:
rev[y] = 1 + rev.get(y, 0)
for (x,xc) in fwd.iteritems():
y = rc(K, x)
yc = 0
if y in rev:
yc = rev[y]
del rev[y]
print '%d\t%d' % (xc, yc)
for (y,yc) in rev.iteritems():
print '%d\t%d' % (0, yc)
return
kx = {}
for xs in parseFiles(K, paired, opts['<fastq>'], opts['-v']):
for x in xs:
if x in kx:
kx[x] += 1
continue
y = rc(K, x)
z = murmer(min(x, y), 17)
if (z & M) > T:
continue
kx[x] = 1
for x in kx.keys():
y = rc(K, x)
if x > y:
continue
xc = kx[x]
yc = kx.get(y, 0)
if murmer(x, 17) >= murmer(y, 17):
(a, b) = (x, y)
(ac, bc) = (xc, yc)
else:
(a, b) = (y, x)
(ac, bc) = (yc, xc)
#print '%s\t%d\t%s\t%d' % (render(K, a), ac, render(K, b), bc)
print '%d\t%d' % (ac, bc)
def main(argv):
opts = docopt.docopt(__doc__, argv)
verbose = opts['-v']
K = int(opts['<k>'])
out = opts['<output>']
Z = 1024 * 1024 * 32
if opts['-m'] is not None:
Z = 1024 * 1024 * int(opts['-m'])
buf = KmerAccumulator2(K)
n = 0
tmps = []
acgt = [0, 0, 0, 0]
m = 0
d = None
if opts['-D'] is not None:
d = float(opts['-D'])
S = 0
if opts['-S'] is not None:
S = int(opts['-S'])
cacheYes = set([])
cacheNo = set([])
B = opts['-C']
if B is not None:
xs = set([])
for (nm, seq) in readFasta(openFile(B)):
xs |= set(kmersList(K, seq, True))
B = xs
tmpnm = tmpfile('.pmc')
with casket(tmpnm, 'w') as z:
nr = 0
for itm in reads(opts['<input>'],
K=K,
pairs=False,
reads=False,
kmers=True,
both=True,
verbose=verbose):
xs = itm.kmers[0]
for x in xs:
acgt[x & 3] += 1
if d is not None:
for x in xs:
if x in cacheNo:
continue
if x not in cacheYes:
if not sub(S, d, x):
cacheNo.add(x)
continue
cacheYes.add(x)
buf.add(x)
m += 1
n += 1
if len(cacheYes) > 1000000:
cacheYes = set([])
if len(cacheNo) > 1000000:
cacheNo = set([])
elif B is not None:
found = False
for x in xs:
if x in B:
found = True
break
if found:
buf.addList(xs)
for x in xs:
m += 1
n += 1
else:
buf.addList(xs)
for x in xs:
m += 1
n += 1
nr += 1
if (nr & 1023) == 0 and buf.mem() >= Z // 2:
fn = 'tmps-%d' % (len(tmps), )
tmps.append(fn)
writeKmersAndCounts2(z, buf.kmersOnly(), buf.countsOnly(), fn)
buf.clear()
n = 0
if len(tmps) and len(buf):
fn = 'tmps-%d' % (len(tmps), )
tmps.append(fn)
writeKmersAndCounts2(z, buf.kmersOnly(), buf.countsOnly(), fn)
buf = []
with zotk.kmers(out, 'w') as z:
h = {}
if len(tmps) == 0:
for c in buf.countsOnly():
h[c] = 1 + h.get(c, 0)
writeKmersAndCounts2(z, buf.kmersOnly(), buf.countsOnly())
elif len(tmps) == 1:
with casket(tmpnm, 'r') as z0:
writeKmersAndCounts(z, readKmersAndCounts(z0, tmps[0]))
else:
with casket(tmpnm, 'r') as z0:
xss = [readKmersAndCounts(z0, t) for t in tmps]
mergeNinto(K, xss, h, z)
n = float(sum(acgt))
acgt = [c / n for c in acgt]
z.meta['K'] = K
z.meta['kmers'] = 'kmers'
z.meta['counts'] = 'counts'
z.meta['hist'] = h
z.meta['acgt'] = acgt
z.meta['reads'] = nr
os.remove(tmpnm)
def next(self):
self.readNum += 1
if (self.readNum & self.M) == 0 and self.progress is not None:
self.progress.update(self.M)
while True:
if self.currParsers is None:
if self.currFilesInd is None:
self.currFilesInd = 0
else:
self.currFilesInd += self.N
if self.progress is not None:
self.progress.update(self.readNum & self.M)
if self.currFilesInd + (self.N - 1) >= len(self.files):
raise StopIteration
if self.verbose:
pfx = ' & '.join([
basename(self.files[i])
for i in range(self.currFilesInd, self.currFilesInd +
self.N)
])
self.progress = tqdm(unit=' reads', unit_scale=True)
self.progress.set_postfix(reading=pfx, refresh=True)
self.currParsers = []
for i in range(self.currFilesInd, self.currFilesInd + self.N):
fn = self.files[i]
f = openFile(fn)
if isFasta(fn):
self.currParsers.append(readFasta(f))
else:
self.currParsers.append(readFastq(f))
self.currReads = []
try:
for p in self.currParsers:
self.currReads.append(p.next())
except StopIteration:
if len(self.currReads) != 0:
print >> sys.stderr, 'warning: files had unequal length'
self.currParsers = None
if self.progress is not None:
self.progress.close()
self.progress = None
continue
if self.kmers:
self.currKmers = []
for rd in self.currReads:
if self.fwdOnly:
self.currKmers.append(kmersList(self.K, rd[1], False))
elif self.both:
self.currKmers.append(kmersList(self.K, rd[1], True))
else:
assert self.separate
self.currKmers.append(kmersLists(self.K, rd[1]))
res = Reads()
if self.reads:
res.reads = self.currReads
if self.kmers:
res.kmers = self.currKmers
return res
def main(argv):
opts = docopt.docopt(__doc__, argv)
verbose = opts['-v']
K = int(opts['-k'])
D = int(opts['-D'])
Q = int(opts['-C'])
V = float(opts['-V'])
d = "."
if opts['-g']:
d = opts['-g']
sf = SequenceFactory(d)
if opts['-X']:
Wcap = int(opts['-w'])
Wval = int(opts['-W'])
variants = opts['<variant>']
if opts['-f']:
with openFile(opts['-f']) as f:
variants += f.read().split()
vx = {}
for v in variants:
x = makeHGVS(v)
if x is None:
print >> sys.stderr, "unable to parse %s" % (v, )
continue
x.setSequenceFactory(sf)
acc = x.accession()
if acc not in vx:
vx[acc] = []
vx[acc].append(x)
chk = None
if opts['-T']:
chk = {}
rs = []
for (acc, vs) in vx.iteritems():
for v in vs:
r = makeIndexedVariant(v, K, Wcap, Wval)
if r is not None:
rs.append(r)
if chk is not None:
xs = kmersList(
K, ''.join([
r['lhsFlank'][-(K - 1):], r['wtSeq'],
r['rhsFlank'][:K - 1]
]), True)
for x in xs:
if x not in chk:
chk[x] = set([])
chk[x].add(('wt', str(v)))
if r['mutSeq'] is None:
continue
xs = kmersList(
K, ''.join([
r['lhsFlank'][-(K - 1):], r['mutSeq'],
r['rhsFlank'][:K - 1]
]), True)
for x in xs:
if x not in chk:
chk[x] = set([])
chk[x].add(('mut', str(v)))
if chk is not None:
counts = dict([(x, 0) for x in chk.keys()])
for acc in refSeq2Hg19.keys():
if verbose:
print >> sys.stderr, 'scanning', acc
seq = sf[acc]
for x in kmers(K, seq):
if x in counts:
counts[x] += 1
res = {}
seen = set([])
for x in counts.keys():
y = rc(K, x)
z = min(x, y)
if z in seen:
continue
seen.add(z)
c = counts[x] + counts[y]
for (a, v) in chk[x]:
if v not in res:
res[v] = {}
if a not in res[v]:
res[v][a] = {}
if c not in res[v][a]:
res[v][a][c] = 0
res[v][a][c] += 1
yaml.safe_dump(res, sys.stdout, default_flow_style=False)
return
with open(opts['<index>'], 'w') as f:
yaml.safe_dump(rs, f, default_flow_style=False)
return
capt = False
zipname = None
if opts['-c']:
capt = True
zipname = opts['-c']
fmt = set([])
if opts['-F']:
fmt = set(opts['-F'].split(','))
if verbose:
print >> sys.stderr, "loading index."
with open(opts['<index>']) as f:
hgvsVars = yaml.load(f, Loader=yaml.FullLoader)
NV = len(hgvsVars)
combineStrands = True
if opts['-s']:
combineStrands = False
cap = capture(K, reads=capt, kmers=True, verbose=verbose)
for n in range(NV):
itm = hgvsVars[n]
h = itm['hgvs']
v = makeHGVS(h)
itm['var'] = v
lhs = itm['lhsFlank']
rhs = itm['rhsFlank']
wt = itm['wtSeq']
mut = itm['mutSeq']
bait = [lhs, wt, rhs]
if mut is not None:
bait += ['N']
bait += [lhs, mut, rhs]
bait = ''.join(bait)
n0 = cap.addBait(h, bait)
assert n0 == n
if verbose:
print >> sys.stderr, "done."
rn = 0
for itm in reads(opts['<input>'],
K=K,
paired=True,
reads=True,
kmers=False,
both=True,
verbose=verbose):
rn += 1
cap.addReadPairAndKmers(itm.reads[0], itm.reads[1])
if capt:
cap.saveReads(zipname)
scorer = Scorer(K)
globHist = {}
for n in range(NV):
mx = cap.capKmers[n]
for c in mx.itervalues():
if c < Q:
continue
if c not in globHist:
globHist[c] = 0
globHist[c] += 1
with outputFile(opts['-o']) as out:
hdrShown = False
for n in range(NV):
itm = hgvsVars[n]
v = itm['var']
h = itm['hgvs']
mx = cap.capKmers[n]
nr = cap.capReadCounts[n]
if 'kmers' in fmt:
for (x, c) in mx.iteritems():
print '%d\t%s\t%d' % (n, render(K, x), c)
lhsFlank = itm['lhsFlank']
rhsFlank = itm['rhsFlank']
alleles = {}
alleles['wt'] = []
alleles['mut'] = []
wtSeq = itm['wtSeq']
wtZ = len(wtSeq)
mutSeq = itm['mutSeq']
mutZ = v.size()
cs = [c for (x, c) in mx.iteritems() if c >= Q]
cs.sort()
nk = len(cs)
if nk == 0:
cs = [0]
q10 = cs[1 * len(cs) // 10]
q50 = cs[5 * len(cs) // 10]
q90 = cs[9 * len(cs) // 10]
af = AlleleFinder(K, D, v, mx, lhsFlank, rhsFlank, wtSeq, mutSeq,
wtZ, mutZ)
finders = []
if not v.anonymous():
finders.append(af.definiteAlleles())
else:
finders.append(af.bridgingAlleles())
j = 0
for (t, a) in cat(finders):
assert t == 'wt' or t == 'mut'
alleles[t].append(a)
j += 1
wtRes = {}
wtRes['covMin'] = 0
wtRes['binom'] = 1.0
wtRes['ksDist'] = 0.0
wtRes['hamming'] = 0
wtRes['path'] = []
for pthRes in alleles['wt']:
scorer.score(pthRes, lhsFlank, wtSeq, rhsFlank)
if isBetter(pthRes, wtRes):
wtRes = pthRes
mutRes = {}
mutRes['covMin'] = 0
mutRes['binom'] = 1.0
mutRes['ksDist'] = 0.0
mutRes['hamming'] = 0
mutRes['path'] = []
for pthRes in alleles['mut']:
scorer.score(pthRes, lhsFlank, mutSeq, rhsFlank)
if isBetter(pthRes, mutRes):
mutRes = pthRes
if True:
wtXs = [mx.get(x, 0) for x in wtRes['path']]
if len(wtXs) == 0:
wtXs = [0]
wtXs.sort()
wtCount = sum(wtXs)
wtLen = len(wtXs)
wtMean = float(wtCount) / float(wtLen)
wtMedian = wtXs[wtLen // 2]
mutXs = [mx.get(x, 0) for x in mutRes['path']]
if len(mutXs) == 0:
mutXs = [0]
mutXs.sort()
mutCount = sum(mutXs)
mutLen = len(mutXs)
mutMean = float(mutCount) / float(mutLen)
mutMedian = mutXs[mutLen // 2]
totX = max([1.0, float(wtMedian + mutMedian), float(q90)])
wtVaf = wtMedian / totX
mutVaf = mutMedian / totX
hdrs = ['n']
fmts = ['%d']
outs = [n]
wtAllele = ((wtRes['covMin'] > Q) and
(wtRes['hamming'] < 4)) and (wtVaf > V)
mutAllele = ((mutRes['covMin'] > Q) and
(mutRes['hamming'] < 4)) and (mutVaf > V)
resV = 1 * wtAllele + 2 * mutAllele
res = ['null', 'wt', 'mut', 'wt/mut'][resV]
hdrs += ['res']
fmts += ['%s']
outs += [res]
if 'rds' in fmt:
hdrs += ['numReads']
fmts += ['%d']
outs += [nr]
hdrs += ['numKmers', 'covQ10', 'covQ50', 'covQ90']
fmts += ['%d', '%d', '%d', '%d']
outs += [nk, q10, q50, q90]
hdrs += ['wtMin', 'mutMin']
fmts += ['%d', '%d']
outs += [wtRes['covMin'], mutRes['covMin']]
hdrs += ['wtHam', 'mutHam']
fmts += ['%d', '%d']
outs += [wtRes['hamming'], mutRes['hamming']]
if 'ks' in fmt:
hdrs += ['wtD', 'mutD']
fmts += ['%g', '%g']
outs += [wtRes['ksDist'], mutRes['ksDist']]
if 'binom' in fmt:
hdrs += ['wtQ', 'mutQ']
fmts += ['%g', '%g']
outs += [wtRes['binom'], mutRes['binom']]
if 'vaf' in fmt:
hdrs += ['wtVaf', 'mutVaf']
fmts += ['%g', '%g']
outs += [wtVaf, mutVaf]
hdrs += ['hgvs']
fmts += ['%s']
outs += [h]
if not hdrShown:
hdrShown = True
print >> out, '\t'.join(hdrs)
print >> out, '\t'.join(fmts) % tuple(outs)
out.flush()
def main(argv):
opts = docopt.docopt(__doc__, argv)
K = 25
nms = []
idx = {}
for (nm, seq) in readFasta(openFile(opts['<baits>'])):
n = len(nms)
nms.append(nm)
for x in kmersList(K, seq, True):
if x not in idx:
idx[x] = set([])
idx[x].add(n)
for x in idx.keys():
idx[x] = list(idx[x])
idx[x].sort()
anti = set([])
if opts['-U']:
with openFile(opts['-U']) as f:
for (nm, seq) in readFasta(f):
for x in kmersList(K, seq, True):
anti.add(x)
rn = 0
if opts['-p']:
hist = {}
for (fn1, fn2) in pairs(opts['<input>']):
tmps = [(tmpfile('_1.fastq'), tmpfile('_2.fastq'))
for i in xrange(len(nms))]
cache = [[[], []] for i in xrange(len(nms))]
counts = [0 for i in xrange(len(nms))]
with openFile(fn1) as f1, openFile(fn2) as f2:
for fq1, fq2 in both(readFastq(f1), readFastq(f2)):
hits = set([])
pushup = False
for x in kmersList(K, fq1[1]):
if x in anti:
pushup = True
break
for i in idx.get(x, []):
hits.add(i)
for x in kmersList(K, fq2[1]):
if x in anti:
pushup = True
break
for i in idx.get(x, []):
hits.add(i)
if pushup:
continue
n = len(hits)
hist[n] = 1 + hist.get(n, 0)
for i in hits:
counts[i] += 1
cache[i][0].append(fq1)
cache[i][1].append(fq2)
if len(cache[i][0]) >= 1024:
with open(tmps[i][0], 'a') as f:
for rd in cache[i][0]:
print >> f, rd[0]
print >> f, rd[1]
print >> f, rd[2]
print >> f, rd[3]
with open(tmps[i][1], 'a') as f:
for rd in cache[i][1]:
print >> f, rd[0]
print >> f, rd[1]
print >> f, rd[2]
print >> f, rd[3]
cache[i][0] = []
cache[i][1] = []
for i in xrange(len(cache)):
if len(cache[i][0]) > 0:
with open(tmps[i][0], 'a') as f:
for rd in cache[i][0]:
print >> f, rd[0]
print >> f, rd[1]
print >> f, rd[2]
print >> f, rd[3]
with open(tmps[i][1], 'a') as f:
for rd in cache[i][1]:
print >> f, rd[0]
print >> f, rd[1]
print >> f, rd[2]
print >> f, rd[3]
cache[i][0] = []
cache[i][1] = []
with zipfile.ZipFile(opts['<output>'], 'w',
zipfile.ZIP_DEFLATED) as z:
for i in xrange(len(nms)):
if counts[i] > 0:
pth = '/'.join(nms[i].split())
z.write(tmps[i][0], pth + '/' + fn1)
os.remove(tmps[i][0])
z.write(tmps[i][1], pth + '/' + fn2)
os.remove(tmps[i][1])
hist = hist.items()
hist.sort()
for (n, f) in hist:
print '%d\t%d' % (n, f)
else:
raise "not implemented"
def main(argv):
opts = docopt.docopt(__doc__, argv)
K = int(opts['-k'])
if (K & 1) != 0:
print >> sys.stderr, "K must be even."
return
minCov = int(opts['-m'])
verbose = opts['-v']
J = K // 2
S = 2*(K - J)
Mj = (1 << (2*J)) - 1
names = []
seqs = {}
bait = {}
wtFst = []
wtLst = []
posIdx = []
rds = []
with openFile(opts['<sequences>']) as f:
for (nm, seq) in readFasta(f):
n = len(names)
names.append(nm)
seqs[nm] = seq
wf = {}
wl = {}
for x in kmersList(K, seq, False):
if x not in bait:
bait[x] = set([])
bait[x].add(n)
y0 = x >> S
y1 = x & Mj
#print '- %s\t%s\t%s' % (render(K, x), render(J, y0), render(J, y1))
if y0 not in wf:
wf[y0] = set([])
wf[y0].add(y1)
if y1 not in wl:
wl[y1] = set([])
wl[y1].add(y0)
wtFst.append(wf)
wtLst.append(wl)
px = {}
for (x,p) in kmersWithPosList(J, seq, False):
if x not in px:
px[x] = []
px[x].append(p)
posIdx.append(px)
for (a, b, c, d) in findDup(wtFst[n], wtLst[n], wtFst[n], wtLst[n]):
pps = positions(posIdx[n], J, a, b, c, d)
if pps is None:
continue
for pp in pps:
ab = a << S | b
cb = c << S | b
cd = c << S | d
dd = pp[2] - pp[0]
print >> sys.stderr, 'warning: phantom dumplication: %s-%s-%s (%d)' % (render(K, ab), render(K, cb), render(K, cd), dd)
rds.append([])
N = len(names)
L = None
X = [{} for n in range(N)]
for itm in reads(opts['<input>'], K=K, reads=True, kmers=True, both=True, verbose=verbose):
rd = itm.reads[0]
L = len(rd)
xs = itm.kmers[0]
hits = set([])
for x in xs:
if x in bait:
hits |= bait[x]
for n in hits:
for x in xs:
if x not in X[n]:
X[n][x] = 0
X[n][x] += 1
rds[n].append(rd)
hdrShown = False
vn = 0
for n in range(N):
xs = {}
for (x,c) in X[n].iteritems():
if c >= 10:
xs[x] = c
seq = seqs[names[n]]
rngs = []
st = None
en = None
inside = False
xx = []
for x in kmersList(K, seq, False):
if x in xs:
xx.append('.')
else:
xx.append('X')
print ''.join(xx)
for x in kmersList(K, seq, False):
if not inside:
if x in xs:
st = x
else:
inside = True
else:
if x in xs:
en = x
rngs.append((st, en))
st = x
en = None
inside = False
if inside:
rngs.append((st, en))
pthr = Pather(K, xs)
for (x,y) in rngs:
if x is None or y is None:
continue
print render(K, x), render(K, y)
for p in pthr.trace(x, y, 100):
print renderPath(K, p)
continue
fst = {}
lst = {}
for (x,c) in xs.iteritems():
#if c < 5:
# continue
y0 = x >> S
y1 = x & Mj
if y0 not in fst:
fst[y0] = []
fst[y0].append(y1)
if y1 not in lst:
lst[y1] = []
lst[y1].append(y0)
#for (a, b, c, d) in findDupDeNovo(fst, lst):
for (a, b, c, d) in findDup(wtFst[n], wtLst[n], fst, lst):
#continue
pps = positions(posIdx[n], J, a, b, c, d)
if pps is None:
continue
for pp in pps:
ab = a << S | b
cb = c << S | b
cd = c << S | d
#print [(render(J, w), p) for (w,p) in zip([a, b, c, d], pps)]
dd = pp[2] - pp[0]
if not opts['-a'] and dd % 3 != 0:
continue
if opts['-s']:
fstPath = interpolate(K, xs, ab, cb, dd+1)
sndPath = interpolate(K, xs, cb, cd, dd+1)
if fstPath is None:
continue
if sndPath is None:
continue
if fstPath[J:-J] != sndPath[J:-J]:
continue
pa = pp[0]
pb = pp[1]
pc = pp[2]
pd = pp[3]
cab = xs.get(ab, 0)
ccb = xs.get(cb, 0)
ccd = xs.get(cd, 0)
if cab < minCov:
continue
if ccb < minCov:
continue
if ccd < minCov:
continue
m = (cab + ccd) / 2.0
# Assume the true std dev is 10% of the mean
w = ccb / m
hgvs = '%s:c.%d_%ddup' % (names[n], pb, pd - 1)
v = Duplication(names[n], pb, pd-1, seqs)
if opts['-A']:
showAnchoredReads(K, {ab:'AB', cb:'CB', cd:'CD'}, rds[n])
vn += 1
hdrs = ['n']
fmts = ['%d']
outs = [vn]
hdrs += ['left', 'leftCov']
fmts += ['%s','%d']
outs += [render(K, ab), cab]
hdrs += ['mid', 'midCov']
fmts += ['%s','%d']
outs += [render(K, cb), ccb]
hdrs += ['right', 'rightCov']
fmts += ['%s','%d']
outs += [render(K, cd), ccd]
hdrs += ['len']
fmts += ['%d']
outs += [dd]
hdrs += ['vaf']
fmts += ['%g']
outs += [w]
hdrs += ['hgvs']
fmts += ['%s']
outs += [hgvs]
if not hdrShown:
hdrShown = True
print '\t'.join(hdrs)
print '\t'.join(fmts) % tuple(outs)