Easy access to Homo sapiens NCBI Build 37 and 38 reference sequences.

This package calls open(file).seek(range) on FASTA files of ASCII to provide ranges of sequence strings. It is exactly as fast as your disk, for better or worse.

• Python 2.7+

$ pip install seqseek

$ download_build_37 -v
$ download_build_38 -v

These commands check to see which chromosomes need to be downloaded for the specified build and initiate a download from our Amazon S3 bucket. Use the -v flag to turn verbosity on/off. Use the -uri flag to specify an alternative download site. These commands automatically run build-specific tests to ensure the integrity of the download once it is finished.

The chromosome files in this package were downloaded from http://hgdownload.cse.ucsc.edu/goldenpath/hg19/chromosomes/. The files have been modified - all newline characters have been removed from the fasta files to make retrieving sequences more simple.

In these files, lower-case letters are used to represent repeating sequences. N's are used to represent any nucleotide (A, T, C, or G). With the exception of chromosome MT (and chromosome 17 in Build 37), all of the chromosome files begin and end with a long sequence of N's.

$ test_build_37
$ test_build_38

These commands run build specific tests to ensure the chromosome files have been downloaded correctly. These tests read sequences from each chromosome file and compare the extracted sequence with sequences pulled from https://genome.ucsc.edu.

from seqseek import Chromosome

Import the chromosome class from the seqseek package.

Chromosome(17).sequence(start=141224, end=141244) #=> TTTCCTGAGAGTTCCAGTGA

The command above will return a string of 20 nucleotides from chromosome 17.

from seqseek import Chromosome, BUILD38
Chromosome(17, assembly=BUILD38).sequence(start=141224, end=141244) #=> ACCTGGTGAGGGGACATGGG

Build 37 is the default. You can specify another build with the assembly option, as shown above.