from Bio.Seq import Seq

from Bio.Alphabet import generic_dna

from Bio.Alphabet import generic_rna

from Bio.Alphabet import generic_protein

my_dna = Seq("ATGGGGAGAAGGCCGTAG", generic_dna)

#print my_dna

#a = my_dna + 'aaa'

#print a

print my_dna.find('AGG')

print my_dna.find('AGA')

print my_dna

print my_dna.count('A')

print len(my_dna)

your_dna = my_dna.complement()

print your_dna

my_rna = my_dna.transcribe()

print my_rna

my_protr = my_rna.translate(table=1, to_stop=True)

#table = 1 is default std genetic code, http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi#SG1

#to_stop=True tells it to stop at stops

print my_protr

my_protd = my_dna.translate(to_stop=True)

print my_protd

#playing with complete CDS'

#yaaX = Seq("GTGAAAAAGATGCAATCTATCGTACTCGCACTTTCCCTGGTTCTGGTCGCTCCCATGGCA" + \

# "GCACAGGCTGCGGAAATTACGTTAGTCCCGTCAGTAAAATTACAGATAGGCGATCGTGAT" + \

# "AATCGTGGCTATTACTGGGATGGAGGTCACTGGCGCGACCACGGCTGGTGGAAACAACAT" + \

# "TATGAATGGCGAGGCAATCGCTGGCACCTACACGGACCGCCGCCACCGCCGCGCCACCAT" + \

# "AAGAAAGCTCCTCATGATCATCACGGCGGTCATGGTCCAGGCAAACATCACCGCTAA",

# generic_dna)

#print gene

#YAAX = yaaX.translate(table='Bacterial', cds=True, to_stop=True)

#print YAAX

#playing with codon usage tables

#from Bio.Data import CodonTable

#standard_table = CodonTable.unambiguous_dna_by_name["Standard"]

#mito_table = CodonTable.unambiguous_dna_by_name["Vertebrate Mitochondrial"]

#print standard_table

#mutable seq objects

from Bio.Seq import Seq

from Bio.Seq import MutableSeq

from Bio.Alphabet import IUPAC

#my_seq = Seq("GCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA", IUPAC.unambiguous_dna)

#mutable_seq = my_seq.tomutable()

#Or just create a mutable seq!

my_seq = MutableSeq("GCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA", IUPAC.unambiguous_dna)

print my_seq

#my_seq_div = my_seq

#my_seq_div[5:8] = 'tag' #how to do insertions???????? only can replace as many characters as indicated. wait it works now.

#why 5:8?

#print my_seq #why does this print as my_seq_div with SNP?

#print my_seq_div

#my_seq_del = my_seq_div.remove("T")

#print my_seq_del

my_seq_rev = my_seq.reverse() #should be able to do my_seq.reverse_complement() as well

print my_seq_rev #this should be working, but it returning None

fin_seq = my_seq_div.toseq() #converts back to immutable Seq Object