Adam 2.0 is a design utility for hybridization oligos. Given a pool of sequences, provided as a file in FASTA format, the utility outputs putative identification primers that meet the user's design specifications. The program uses k-mer based approach that works in the following way:

1. Given a set of sequences, find the minimum k-mer length that splits all sequences up into unique, unambiguous k-mers
2. Break all sequences into unique k-mers using the identified value of k
3. Remove from consideration all k-mers that occur multiple times within the collection of sequences of interest (only consider unique kmers)
4. Generate a matrix of Hamming distances between all unique k-mers within a single sequence and all other k-mers from all other sequences
5. Remove all rows that contain a Hamming distance of 1 for any k-mer pair (unique k-mers must be at least 2 mutations from any other k-mer in the pool)
6. Map Hamming distances to similarity scores S by calculating S = k−Hamming distance and minimize the sum of the squared similarity scores
7. Find k-mer within original sequence
8. Perform sliding window primer design of varying size until desired Tm and other properties are achieved (check with primer3) to generate a pool of potential hybridization oligos
9. Prune the oligo pool to a single representative oligo based on pruning properties
10. Report the hybridization oligos in a machine/human readable format

Adam 2.0 requires Python 3.

Installation is as easy as:

git clone https://github.com/FordyceLab/adam2.git
cd adam2
pip3 install .

This will make the adam2 command line tool publicly available. You can check this with which adam2, which should not return a blank line.

Adam 2.0 (command line tool adam2) takes a requires set of IO/ parameters and has three sets of command line options used to alter its behavior:

• --input or -i - specifies the input FASTA file containing sequences for oligo design (required argument)
• --output or -o - specifies the output file prefix (required argument)

• --size or -s - desired oligo size range, must provide min and max (required argument)
• --tm or -t - desired oligo Tm range in degrees C, must provide min and max (required argument)
• --hairpin or -p - hairpin tolerance in degrees C, default = 10
• --homodimer or -d - homodimer tolerance in degrees C, default = 10
• --number or -n - number of oligos to generate per input sequence, default = 10

• --length - length penalty for oligo scoring, default = 0.5
• --gc_ends - GC ends reward for oligo scoring, default = 1
• --gc_comp - GC composition penalty for oligo scoring, default = 2
• --tm_mean - Tm mean penalty for oligo scoring, default = 1
• --hairpin_tm - hairpin Tm suppression reward for oligo scoring, default = 0.1
• --homodimer_tm - homodimer Tm suppression reward for oligo scoring, default = 0.1

• --dna_conc - DNA concentration to use for Tm calculation, default = 250
• --mv_conc - monovalent cation concentration to use for Tm calculation, default = 50
• --dv_conc - divalent cation concentration to use for Tm calculation, default = 0
• --dntp_conc - dNTP concentration to use for Tm calculation, default = 0

Let's say we have the following FASTA file (named species.fasta on disk) containing a variable region for two species below:

>Species_A
ACGTTGACAGGATTACACAGTAGATCCAGGATTATAGGACCAGGTAGCA

>SpeciesB
ACGTTTGACGTTGTACACAGTAGAGGCTAGGATTAGGTACCAGGTAGCA

We want to design a set of oligos to separate these sequences with the following parameters:

• max of 3 potential oligos designed per species
• length of 18-25 nt
• Tm of 55-60C

We can accomplish this using the following command:

adam2 -i species.fasta -o species -n 3 -s 18 25 -t 55 60 

This command will generate the following YAML file (in this case named species.yaml):

design_params:
    k: 9
    size_range: (18, 25)
    Tm_range: (55.0, 60.0)
    hairpin_tolerance: 10
    homodimer_tolerance: 10
prune_params:
    GC_ends: 1
    GC_comp: 2
    Tm_mean: 1
    hairpin_Tm: 0.1
    homodimer_Tm: 0.1
Species_A:
    ACGTTGACAGGATTACACAGTAGAT:
        length: 25
        Tm: 55.39
        start: 0
        end: 24
        hairpin_Tm: 0.0
        homodimer_Tm: -46.54
SpeciesB:
    CGTTTGACGTTGTACACAGTAGAG:
        length: 24
        Tm: 55.69
        start: 1
        end: 24
        hairpin_Tm: 32.83
        homodimer_Tm: -11.0
    CACAGTAGAGGCTAGGATTAGGTAC:
        length: 25
        Tm: 55.11
        start: 15
        end: 39
        hairpin_Tm: 0.0
        homodimer_Tm: -31.25