def main(): print ps3a.countSubStringMatch(target, key) print ps3a.countSubStringMatchRecursive(target, key) print ps3b.subStringMatchExact(target,key) # for testing constrainedMatchPair(firstMatch, secondMatch, length) print ps3c.subStringMatchOneSub(key,target) print ps3d.subStringMatchExactlyOneSub(target,key)
def subStringMatchOneSub(target, key):
allmatches = ()
for i in range(0,len(key)):
keyone = key[:i]
keytwo = key[i+1:]
#print('\nRompiendo la key: ', key, 'en key1 = ', keyone, 'y key2 = ', keytwo)
matchone = subStringMatchExact(target, keyone)
matchtwo = subStringMatchExact(target, keytwo)
#print('El primer match: ',matchone)
#print('El segundo match: ',matchtwo)
validmatch = constrainedMatchPair(matchone, matchtwo, len(keyone))
allmatches = allmatches + validmatch
#print('Posibles matches para sustituir', validmatch)
return allmatches
#print('Las posibles sustituciones son en: ', subStringMatchOneSub('ATGACATGCACAAGTATGCAT','ATG'))
def subStringMatchExactlyOneSub(target, key):
""" return a tuple of all starting points of matches of the key to the target, such that at exactly one element of the key is incorrectly matched to the target. """
substring_match_exact = subStringMatchExact(target, key)
substring_match_one_sub = subStringMatchOneSub(key, target)
substring_match_exactly_one_sub = ()
print substring_match_exact
print substring_match_one_sub
for index in substring_match_one_sub:
if index not in substring_match_exact:
substring_match_exactly_one_sub += (index, )
return substring_match_exactly_one_sub
def subStringMatchExactlyOneSub(target, key):
""" return a tuple of all starting points of matches of the key to the target, such that at exactly one element of the key is incorrectly matched to the target. """
substring_match_exact = subStringMatchExact(target, key)
substring_match_one_sub = subStringMatchOneSub(key, target)
substring_match_exactly_one_sub = ()
print substring_match_exact
print substring_match_one_sub
for index in substring_match_one_sub:
if index not in substring_match_exact:
substring_match_exactly_one_sub += (index,)
return substring_match_exactly_one_sub
def subStringMatchExactlyOneSub(target,key): exactMatch = subStringMatchExact(target, key) oneSub = subStringMatchOneSub(key,target) solution = () for i in range(0, len(oneSub)): foundelement = False for j in range(0, len(exactMatch)): if exactMatch[j] == oneSub[i]: foundelement = True if foundelement == False: solution += (oneSub[i],) return solution
def subStringMatchOneSub(key, target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0, len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss + 1:]
### print 'breaking key "%s" into "%s", "%s"' % (key, key1, key2)
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target, key1)
match2 = subStringMatchExact(target, key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1, match2, len(key1))
allAnswers = allAnswers + filtered
### print 'match1:', match1
### print 'match2:', match2
### print 'possible matches for "%s", "%s" start at:' % (key1, key2), filtered
return allAnswers
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
### print 'breaking key "%s" into "%s", "%s"' % (key, key1, key2)
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
### print 'match1:', match1
### print 'match2:', match2
### print 'possible matches for "%s", "%s" start at:' % (key1, key2), filtered
return allAnswers
def subStringMatchExactlyOneSub(target,key):
exactMatch = ps3b.subStringMatchExact(target, key)
allAnswers = ()
for miss in range(0,len(key)):
key1 = key[:miss]
key2 = key[miss+1:]
match1 = ps3b.subStringMatchExact(target,key1)
match2 = ps3b.subStringMatchExact(target,key2)
filtered = ps3c.constrainedMatchPair(match1,match2,len(key1))
n = 0
for i in filtered:
for j in exactMatch:
if i == j:
filtered = filtered[:n] + filtered[n+1:]
n -= 1
n += 1
allAnswers = allAnswers + filtered
return allAnswers
def subStringMatchOneSub(key, target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0, len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss + 1:]
print('breaking key', key, 'into', key1, key2)
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target, key1)
match2 = subStringMatchExact(target, key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1, match2, len(key1))
allAnswers = allAnswers + (filtered, )
print(target)
print('match1', match1)
print('match2', match2)
print('possible matches for', key1, key2, 'start at', filtered)
return allAnswers
def subStringMatchExactlyOneSub(target,key):
onesubstitution = ()
perfectmatch = subStringMatchExact(target,key)
#print(perfectmatch)
possiblesubstitution = subStringMatchOneSub(target,key)
#print(possiblesubstitution)
for onesub in possiblesubstitution:
if onesub in perfectmatch:
pass
else:
onesubstitution = onesubstitution + (onesub,)
return onesubstitution
def subStringMatchExactlyOneSub(target, key):
""" find those matched and with only substitution in target
return:
a tuple contains the starting positions of substring in target, which can
matchs the key string except for exactly one char
"""
tuple_pairs = subStringMatchOneSub(key, target)
print "all pairs: ", tuple_pairs
fully_matched_pos = subStringMatchExact(target, key)
print "matched_pos:", fully_matched_pos
answer = ()
for tuple_pair in tuple_pairs:
start = list(tuple_pair).pop(0)
if start in fully_matched_pos:
pass
else:
answer = answer + (start,)
return answer
