def testAccessByPosition(self):
ft = IndexedFastaReader(self.FASTAPATH)
r000001 = ft[0]
assert "<IndexedFastaRecord: ref000001|EGFR_Exon_2>" == repr(r000001)
firstTwo = ft[:2]
assert [ft[0], ft[1]] == firstTwo
lastTwo = ft[-2:]
assert [ft[-2], ft[-1]] == lastTwo
def testAccessByPosition(self):
ft = IndexedFastaReader(self.fastaPath)
r000001 = ft[0]
assert_equal("<IndexedFastaRecord: ref000001|EGFR_Exon_2>", repr(r000001))
firstTwo = ft[:2]
assert_equal([ft[0], ft[1]], firstTwo)
lastTwo = ft[-2:]
assert_equal([ft[-2], ft[-1]], lastTwo)
def testAccessById(self):
ft = IndexedFastaReader(self.FASTAPATH)
r000021 = ft["ref000021|EGFR_Exon_22"]
assert "ref000021|EGFR_Exon_22\tMetadataTest" == r000021.header
assert "ref000021|EGFR_Exon_22" == r000021.id
assert "MetadataTest" == r000021.comment
assert ("CACTGCCTCATCTCTCACCATCCCAAGGTGCCTATCAAGTGGATGGCATTGGAATCAATT"
"TTACACAGAATCTATACCCACCAGAGTGATGTCTGGAGCTACGGTGAGTCATAATCCTGA"
"TGCTAATGAGTTTGTACTGAGGCCAAGCTGG") == r000021.sequence[:]
def testAccessById(self):
ft = IndexedFastaReader(self.fastaPath)
r000021 = ft["ref000021|EGFR_Exon_22"]
assert_equal("ref000021|EGFR_Exon_22\tMetadataTest", r000021.header)
assert_equal("ref000021|EGFR_Exon_22", r000021.id)
assert_equal("MetadataTest", r000021.comment)
assert_equal("CACTGCCTCATCTCTCACCATCCCAAGGTGCCTATCAAGTGGATGGCATTGGAATCAATT"
"TTACACAGAATCTATACCCACCAGAGTGATGTCTGGAGCTACGGTGAGTCATAATCCTGA"
"TGCTAATGAGTTTGTACTGAGGCCAAGCTGG",
r000021.sequence[:])
def testSlice(self):
ft = IndexedFastaReader(self.FASTAPATH)
r000021 = ft["ref000021|EGFR_Exon_22"]
sequence = r000021.sequence
assert "CACTGCCTCA" == sequence[0:10]
assert "GCCAAGCTGG" == sequence[-10:]
assert "G" == sequence[-1]
assert "T" == sequence[-3]
assert "C" == sequence[0]
assert "A" == sequence[1]
def testSlice(self):
ft = IndexedFastaReader(self.fastaPath)
r000021 = ft["ref000021|EGFR_Exon_22"]
sequence = r000021.sequence
assert_equal("CACTGCCTCA", sequence[0:10])
assert_equal("GCCAAGCTGG", sequence[-10:])
assert_equal("G", sequence[-1])
assert_equal("T", sequence[-3])
assert_equal("C", sequence[0])
assert_equal("A", sequence[1])
def test_dosLineEndingsFasta(self):
fr = FastaReader(data.getDosFormattedFasta())
frEntries = list(fr)
ft = IndexedFastaReader(data.getDosFormattedFasta())
ftEntries = list(ft)
assert_equal(len(frEntries), len(ftEntries))
for (frE, ftE) in zip(frEntries, ftEntries):
assert_equal(frE.header, ftE.header)
assert_equal(frE.sequence, ftE.sequence[:])
def test_dosLineEndingsFasta(self):
fr = FastaReader(data.getDosFormattedFasta())
frEntries = list(fr)
ft = IndexedFastaReader(data.getDosFormattedFasta())
ftEntries = list(ft)
assert len(frEntries) == len(ftEntries)
for (frE, ftE) in zip(frEntries, ftEntries):
assert frE.header == ftE.header
assert frE.sequence == ftE.sequence[:]
def testIteration(self):
ft = IndexedFastaReader(self.fastaPath)
fr = FastaReader(self.fastaPath)
ftContigs = list(ft)
frContigs = list(fr)
assert_equal(len(frContigs), len(ftContigs))
assert_equal(48, len(ftContigs))
for ftC, frC in zip(ftContigs, frContigs):
assert_equal(frC.header, ftC.header)
assert_equal(frC.sequence, ftC.sequence[:])
# Unlike FastaReader, IndexedFastaReader iteration is repeatable.
assert_equal(48, len(list(ft)))
def testIteration(self):
ft = IndexedFastaReader(self.FASTAPATH)
fr = FastaReader(self.FASTAPATH)
ftContigs = list(ft)
frContigs = list(fr)
assert len(frContigs) == len(ftContigs)
assert 48 == len(ftContigs)
for ftC, frC in zip(ftContigs, frContigs):
assert frC.header == ftC.header
assert frC.sequence == ftC.sequence[:]
# Unlike FastaReader, IndexedFastaReader iteration is repeatable.
assert 48 == len(list(ft))
def SummarizeData(indexedFasta, windows, adps):
summaries = []
fa = IndexedFastaReader(indexedFasta)
for hn, (_, tid, s, e, target) in windows.iteritems():
# First skip ZMWs with no adp results, i.e. with <= 1 adp
try:
leftTc6, leftAlt, rightTc6, rightAlt = adps[hn]
except:
continue
chrm = fa[tid]
# Search for restriction sites near the ends
fiveP = chrm.sequence[max(s - 5, 0):s + 6]
threeP = chrm.sequence[e - 5:e + 6]
fiveEco = HasEcoR1(fiveP)
threeEco = HasEcoR1(threeP)
# Search for restriction sites contained within
inside = chrm.sequence[s + 6:e - 5]
insideEco = HasEcoR1(inside)
# Count and summarize any PolyA/T regions
region = chrm.sequence[s:e]
AT = LargestAsAndTs(region)
maxAT = 0 if len(AT) == 0 else max(AT)
# Check for Guide RNA matches
OutFiveP = chrm.sequence[max(s - 33, 0):s + 10]
InFiveP = FastaRecord("tmp",
chrm.sequence[max(s - 10, 0):s +
33]).reverseComplement().sequence
InThreeP = chrm.sequence[e - 33:e + 10]
OutThreeP = FastaRecord(
"tmp", chrm.sequence[e - 10:e + 33]).reverseComplement().sequence
k1, s1, a1 = ScoreCas9SiteSides(OutFiveP, InFiveP)
k2, s2, a2 = ScoreCas9SiteSides(OutThreeP, InThreeP)
# Summary columns
hasPolyA = "T" if maxAT > 0 else "F"
hasLeft = "T" if (fiveEco == "T" or k1 != "N/A") else "F"
hasRight = "T" if (threeEco == "T" or k2 != "N/A") else "F"
summaries.append(
(hn, tid, s, e, e - s, target, len(AT), maxAT, sum(AT), leftTc6,
rightTc6, leftAlt, rightAlt, fiveEco, insideEco, threeEco, k1, s1,
a1, k2, s2, a2, hasPolyA, hasLeft, hasRight))
return sorted(summaries)
def SummarizeRestrictionData(indexedFasta, windows, adps):
"""Summarize the data for each ZMW, and their left and right sides"""
results = []
fa = IndexedFastaReader(indexedFasta)
for hn, tid, s, e, target in windows:
# First skip ZMWs with no adp results, i.e. with <= 1 adp
try:
polyA = adps[hn]
except:
continue
chrm = fa[tid]
# Search for restriction sites near the alignment edges
fiveP = chrm.sequence[s - 5:s + 6]
threeP = chrm.sequence[e - 5:e + 6]
threeP_rc = threeP.translate(COMPLEMENT)[::-1]
left = SearchSequence(fiveP)
right = SearchSequence(threeP_rc)
results.append((hn, tid, s, e, target, left, right))
return sorted(results)
def test_readWeirdFastaIndex(self):
f = IndexedFastaReader(data.getWeird())
entries = list(f)
assert_equal(1, len(entries))
assert_equal("chr1", entries[0].header)
assert_equal("acgtacgtacgtact", entries[0].sequence[:])
def test_readWeirdFastaIndex(self):
f = IndexedFastaReader(data.getWeird())
entries = list(f)
assert 1 == len(entries)
assert "chr1" == entries[0].header
assert "acgtacgtacgtact" == entries[0].sequence[:]
if len(currOvl) > 1000:
ovls.append(currOvl)
currOvl = [(hn, s, e, t)]
currE = e
retval[ch] = ovls
return retval
# Second, tabulate the number of usable reads/ZMWs
windows = ReadGenomeWindowsFromPBI([inputFile], TARGETS)
adps = ReadAdaptersFromScraps(scrapsBam)
#byChrom = SortWindowsByChromosome( windows )
#ovls = FindOverlaps( byChrom )
print "HoleNumber,Chromosome,Start,End,Target,PolyAAdp,PolyARegion,MaxPolyARegion,TotalPolyARegion,LeftEcoR1,LeftBamH1,RightEcoRI,RightBamH1,LeftRna,LeftRnaSide,LeftRnaAcc,RightRna,RightRnaSide,RightRna,HasPolyA,HasLeft,HasRight"
fa = IndexedFastaReader(indexedFasta)
for hn, tid, s, e, target in windows:
# First skip ZMWs with no adp results, i.e. with <= 1 adp
try:
polyA = adps[hn]
except:
continue
chrm = fa[tid]
# Search for restriction sites near
fiveP = chrm.sequence[s - 5:s + 6]
threeP = chrm.sequence[e - 5:e + 6]
fiveEco, fiveBam = HasEcoR1(fiveP), HasBamH1(fiveP)
threeEco, threeBam = HasEcoR1(threeP), HasBamH1(threeP)