Tranform human mtDNA sequence to variant sites and vice versa
License
ryanraaum/oldowan.mtconvert
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
Transform human mtDNA sequence to variant sites and vice versa. oldowan.mtconvert is a small, pure Python, bioinformatic utility to (1) transform human mitochondral DNA sequence data into variant sites relative to the revised Cambridge Reference Sequence (rCRS) and (2) transform variant sites data into DNA sequence. Further information on the rCRS and variant site nomenclature for human mtDNA sequences is available at the mtconvert_ website. Installation Instructions ========================= This package is pure Python and has no dependencies outside of the standard library. The easist way to install is using ``easy_install`` from the setuptools_ package. This usually goes something like this:: $ easy_install oldowan.mtconvert or on a unix-like system, assuming you are installing to the main Python ``site-packages`` directory as a non-privileged user, this:: $ sudo easy_install oldowan.mtconvert You may also use the standard python distutils setup method. Download the current source archive from the file list towards the bottom of this page, unarchive it, and install. On Mac OS X and many other unix-like systems, having downloaded the archive and changed to the directory containing this archive in your shell, this might go something like:: $ tar xvzf oldowan.mtconvert* $ cd oldowan.mtconvert* $ python setup.py install Quick Start =========== Import ``seq2sites`` and ``sites2seq`` from oldowan.mtconvert:: >>> from oldowan.mtconvert import seq2sites, sites2seq Convert sequence to sites:: >>> seq = """TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAA GTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCC AGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGT ACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCA AGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAG CCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT ACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATC CCTTCTCGTCCC""" >>> seq2sites(seq) Sequences must be contiguous! Separate runs of sequence, such as HVR1 and HVR2 without the intervening sequence interval, must be analyzed separately. There is also a cutoff on the number of ambigous sites (N) allowed in the sequence. By default, this is 10 - but this is an option that can be set:: >>> seq2sites(seq, ambig_cutoff=20) Convert a list of variable sites to sequence. The default sequence region that is returned is hypervariable region 1 (HVR1), which is positions 16024 to 16365 of the rCRS (in biological one-based numbering):: >>> sites2seq('16129A 16223T') Predefined sequence regions are: - HVR1: 16024-16365 - HVR2: 73-340 - HVR1to2: 16024-340 - coding: 577-15992 - all: 1-16559 So, to convert a list of HVR2 sites to sequence:: >>> sites2seq('73G', region='HVR2') Sites may also be provided in a list:: >>> sites2seq(['16129A', '16223T', '73G'], region='HVR1to2') The rCRS sequence will be returned given an empty string, empty list, or the string 'rCRS'. All of the following are equivalent:: >>> sites2seq('') >>> sites2seq([]) >>> sites2seq('rCRS') Arbitrary positions may be selected by passing a list of sites to the ``region`` option:: >>> sites2seq('', region=[1,2,3]) The Python range function is convenient for this, but you must remember that the range does not include its ending position:: >>> sites2seq('', region=range(73,341)) # include 340, but not 341 Release History =============== 1.0.0 (March 25, 2009) initial release of module. 1.0.1 (March 25, 2009) minor versioning fix 1.0.2 (May 27, 2009) partial RFLP implementation 1.0.3 (June 22, 2015) add fix for spurious deletions at end of query 1.0.4 (June 22, 2015) improve fix for spurious deletions at end of query 1.0.5 (June 22, 2015) sites outside requested region should pass silently; fix for insertions 1.0.6 (August 4, 2015) fix version number install problem .. _setuptools: http://peak.telecommunity.com/DevCenter/EasyInstall
About
Tranform human mtDNA sequence to variant sites and vice versa
Resources
License
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published