The arbtkf91 program tries to compute the maximum probability tkf91 alignment for a given sequence pair and set of parameter values.
Numerical error is controlled using the exact computation paradigm, so that for many inputs it is possible to verify that the alignment is optimal. This involves comparing alignment scores and using combinatorics tricks to identify situations where scores are exactly equal. If the comparison is inconclusive then the scores are re-evaluated with increased numerical precision. Unlike CGAL, the combinatorics tricks used by arbtkf91 are probably not exhaustive, so it may be possible that the program will hang as precision is fruitlessly increased in an attempt to distinguish between identical scores.
The program runs on the command line using the json format for input and output.
$ arbtkf91-align < examples/in.json
{
"parameters" :
{
"pa" : {"num" : 25, "denom" : 100},
"pc" : {"num" : 25, "denom" : 100},
"pg" : {"num" : 25, "denom" : 100},
"pt" : {"num" : 25, "denom" : 100},
"lambda" : {"num" : 1, "denom" : 1},
"mu" : {"num" : 2, "denom" : 1},
"tau" : {"num" : 1, "denom" : 10}
},
"sequence_a": "ACGACTAGTCA-GC-TACG-AT-CGA-CT-C-ATTCAACTGACTGACA-TCGACTTA",
"sequence_b": "A-GAG-AGTAATGCATACGCATGC-ATCTGCTATTC---TG-CTG-CAGTGG--T-A"
}
$ cat examples/in.json
{
"parameters" :
{
"pa" : {"num" : 25, "denom" : 100},
"pc" : {"num" : 25, "denom" : 100},
"pg" : {"num" : 25, "denom" : 100},
"pt" : {"num" : 25, "denom" : 100},
"lambda" : {"num" : 1, "denom" : 1},
"mu" : {"num" : 2, "denom" : 1},
"tau" : {"num" : 1, "denom" : 10}
},
"sequence_a" : "ACGACTAGTCAGCTACGATCGACTCATTCAACTGACTGACATCGACTTA",
"sequence_b" : "AGAGAGTAATGCATACGCATGCATCTGCTATTCTGCTGCAGTGGTA"
}
The arbtkf91 code has been tested only on Linux,
and the installation requires autotools
which should be available as autotools-dev
on Linux distributions based on debian.
The arbtkf91 package depends on these C libraries:
- arb -- C library for arbitrary-precision interval arithmetic
- flint2 -- Fast Library for Number Theory
- gmp -- The GNU Multiple Precision Arithmetic Library
- libpng -- The official PNG reference library
- jansson -- C library for encoding, decoding and manipulating JSON data
The tests depend on a few Python packages:
- numpy -- A package for scientific computing with Python
- biopython -- Python tools for computational molecular biology
- nose -- A package for unit testing
Scripts may use jq for json filtering.
Something like the usual autotools installation commands should work if you are lucky:
$ ./autogen.sh
$ ./configure CPPFLAGS='-I/path/to/include/flint'
$ make
$ make check
$ make install
The extra CPPFLAGS path is due to the idiosyncratic way that arb includes the flint2 headers.
To use a configuration tuned to your specific machine architecture,
use a configure
command like the following:
$ ./configure CFLAGS='-O3 -march=native -ffast-math' CPPFLAGS='-I/path/to/include/flint'
Some tests are run during the $ make check
step of the installation.
After installation, additional python test scripts can be run
with the $ nosetests -v
command.
examples$ arbtkf91-align < in.json | jq '. | {a: .sequence_a, b: .sequence_b}'
{
"a": "ACGACTAGTCA-GC-TACG-AT-CGA-CT-C-ATTCAACTGACTGACA-TCGACTTA",
"b": "A-GAG-AGTAATGCATACGCATGC-ATCTGCTATTC---TG-CTG-CAGTGG--T-A"
}
examples$ jq '.samples=10 | .precision="float"' in1k.json | arbtkf91-bench | jq '. | .elapsed_ticks'
[5206, 4800, 3439, 3425, 3425, 3412, 3434, 3420, 3413, 3410]
examples$ jq '.samples=10 | .precision="double"' in1k.json | arbtkf91-bench | jq '. | .elapsed_ticks'
[7957, 7407, 4340, 4354, 4357, 4315, 4350, 4323, 4336, 4324]
examples$ jq '.samples=10 | .precision="high"' in1k.json | arbtkf91-bench | jq '. | .elapsed_ticks'
[211531, 211210, 210721, 210981, 210999, 211034, 211010, 210787, 211070, 203003]
examples$ arbtkf91-align < in.json | arbtkf91-check
{
"alignment_is_optimal": true,
"alignment_is_canonical": true
}
examples$ jq '.precision="float" | .rtol=3e-7' fails-high-tolerance.json | arbtkf91-align | arbtkf91-check
{
"alignment_is_optimal": false,
"alignment_is_canonical": false
}
examples$ jq '.precision="float" | .rtol=3e-7' needs-high-tolerance.json | arbtkf91-align | arbtkf91-check
{
"alignment_is_optimal": true,
"alignment_is_canonical": false
}
examples$ arbtkf91-count < in.json
{"number_of_optimal_alignments": "56"}
examples$ jq '.image_mode="full" | .image_filename="tableau.png"' in.json | arbtkf91-image
examples$ jq '.image_mode="simple" | .image_filename="needs-high.tableau.png"' needs-high-tolerance.json | arbtkf91-image