Below you can find installation instructions with all necessary libraries.

1. install few first prerequisites

    sudo aptitude install build-essential python-dev curl 
    sudo aptitude install software-properties-common unzip 
   

2. install BEDTools

   run following commands in shell

    curl -O http://bedtools.googlecode.com/files/BEDTools.v2.17.0.tar.gz
    tar xvzf BEDTools.v2.17.0.tar.gz
    cd bedtools-2.17.0
    make
    cp bin/* /usr/local/bin/
   

3. install MongoDB

   follow instructions for ubuntu at mongodb website

   after installation mongod process should be running and database should be located at /var/lib/mongodb

4. install virtualenv

   create directory for virtualenvs

    mkdir ~/venvs
   

   download and unpack python-virtualenv wget https://pypi.python.org/packages/source/v/virtualenv/virtualenv-1.10.1.tar.gz tar xvzf virtualenv-1.10.1.tar.gz cd virtualenv-1.10.1

   create virtual environment for ave and activate it

    python virtualenv.py --no-site-packages ~/venvs/ave_env
    source ~/venvs/ave_env/bin/activate
   

5. install node.js

   follow instructions at node.js website

These instructions are independent of the operating system. It is important to work in virtualenv (`source ~/venvs/ave_env/bin/activate', as explained above).

1. Download the application.

2. Unpack ave and enter ave directory

3. install node packages

    npm install
   

4. install python libraries

   from within ave directory run (make sure that ave virtualenv is activated):

    pip install -U cython
    pip install -r requirements.txt
   

5. Setup the db

   To setup the db with your own data, all Arabidopsis example data you can use provided script. You will need:

   • reference sequence in fasta format

     make sure that name of the chromosome (or some other meaningful identifier) is provided as fasta identifier (the string just after ">"). Like in the example for Chromosome 1 sequence:

       >Chr1 CHROMOSOME dumped from ADB: Jun/20/09 14:53
       CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTA
     

   • gene annotations in gff3 format

   • SNP annotations in gff3 format

   • chromInfo.txt file containing information about chromosome names and sizes, for example for Arabidopis:

       Chr1 30427671
       Chr2 19698289
       Chr3 23459830
       Chr4 18585056
       Chr5 26975502
       ChrC 154478
       ChrM 366924
     

     identifiers in first column must match identifiers in fasta and gff files

   • currently configuration uses json file, it should be valid json format (json validator), it should look like following:

        {
       "genome": "TAIR10",
       "ref": [
       "/path/to/data/annots/TAIR10_chr1.fas",
       "/path/to/data/annots/TAIR10_chr2.fas",
       "/path/to/data/annots/TAIR10_chr3.fas",
       "/path/to/data/annots/TAIR10_chr4.fas",
       "/path/to/data/annots/TAIR10_chr5.fas",
       "/path/to/data/annots/TAIR10_chrC.fas",
       "/path/to/data/annots/TAIR10_chrM.fas"
       ],
       "annot": [
       "/path/to/data/annots/TAIR10_GFF3_genes.gff",
       "/path/to/data/annots/snps/CDS_snps.gff",
       "/path/to/data/annots/snps/three_prime_UTR_snps.gff",
       "/path/to/data/annots/snps/five_prime_UTR_snps.gff"
       ],
       "chromInfo": "/path/to/data/annots/chromInfo.txt"
       }
     

   Please validate gff files before importing them. This can be done at genome tools webiste

   SNPs should be annotated like in this example ("SNP_" in col 3 is important for fature to be recognised as snp) columns 1-7:

    Chr1 1001Genomes SNP_adal_3	138 138 3 . .
   

   column 8 (key value pairs):

    Change=T:C;Strain=adal_3;Project=GMINordborg2010;ID=9323.138
   

   First column should correspond to seq id from fasta file provided as reference.

   In last column:

   Change follows reference:variant order

   Strain is the name of the strain/accession/ecotype in which this SNP have been called.

   Project is the sequencing project

   ID is any unique identifier for this SNP

   You can annotate the SNPs in gff file with SNPs location.

    python ./ave_tools.py group_snps_by_loc --annot gene_annotation.gff \
    --snps snp_file1.gff --snp_file2.gff
   

   or

    python ./ave_tools.py group_snps_by_loc --annot gene_annotation.gff \
    --snps *.gff
   

   The script generates new gff files, one for each snp location, with annotated location in last column:

    Project=GMINordborg2010;Strain=ale_stenar_44_4;variant_location=CDS;
    ID=992.6992;Change=T:C
   

   To import data into the database use config file (conf.json):

    python ./ave_tools.py import --config conf.json
   

run:

node app.js

Access app from within web browser (preferably latest chrome). Ip address and port is provided in app.js output.

Example SNP annotations have been obtained from 1001 Genomes Project. Please read the Data Usage Policy at the project website.