def makeTree(data, label, attributes, level, max_depth): level += 1 default = majorityLabel(data[:, label]) # Max depth check if max_depth == level: return Tree.Tree(default, level) if len(attributes) <= 0: return Tree.Tree(default, level) elif sameLabel(data[:, label]): return Tree.Tree(default, level) else: bestAttribute = chooseAttr(data, label, attributes) tree = Tree.Tree(bestAttribute, level) newAttributes = attributes newAttributes.remove(bestAttribute) for i in range(1, 11): examples = getExamples(data, bestAttribute, i) if examples[:, 1].size == 0: tree.addChild(Tree.Tree(default, level + 1), i) else: tree.addChild( makeTree(examples, label, newAttributes, level, max_depth), i) return tree
def fromSKLearn(self, forest, roundSplit=False): # TODO: Add AdaBoostRegressor # TODO: Add RandomForestRegressor if (issubclass(type(forest), AdaBoostClassifier)): sumW = sum([w for w in forest.estimator_weights_]) # https://github.com/scikit-learn/scikit-learn/blob/a24c8b46/sklearn/ensemble/weight_boosting.py#L297 # see: decision_function if (forest.algorithm == "SAMME"): for e, w in zip(forest.estimators_, forest.estimator_weights_): tree = Tree.Tree() tree.fromSKLearn(e, roundSplit, "SAMME", w / sumW) self.trees.append(tree) else: for e in forest.estimators_: tree = Tree.Tree() tree.fromSKLearn(e, roundSplit, "SAMME.R", 1.0 / sumW) self.trees.append(tree) elif (issubclass(type(forest), RandomForestClassifier)) or (issubclass( type(forest), ExtraTreesClassifier)): for e in forest.estimators_: tree = Tree.Tree() tree.fromSKLearn(e, roundSplit, "RandomForest", 1.0 / len(forest.estimators_)) self.trees.append(tree) else: raise NotImplementedError( "fromSKLearn() is not implemented for class ", type(forest))
def fit(self, training_file, output_file, word_map_file='word_map.bin'): if not os.path.exists(word_map_file): tr.build_word_map(training_file, word_map_file) self.word_map_file = word_map_file self.trees = tr.load_trees(self.data_folder + training_file, self.word_map_file) self.num_words = len(tr.load_word_map(self.word_map_file)) self.rntn = RNTN.RNTN(self.vect_dim, self.output_dim, self.num_words, self.mini_batch_size) self.sgd = SGD.SGD(self.rntn, self.learning_rate, self.mini_batch_size) for e in range(self.optim_epochs): # Fit model # -------------------------- start = time.time() print "Running epoch %d" % e self.sgd.optimize(self.trees) end = time.time() print "\nTime per epoch : %f" % (end - start) # Save model specifications with open(output_file, 'w+') as fid: pickle.dump([(i, self.values[i]) for i in self.args][1:], fid) pickle.dump(self.sgd.cost_list, fid) pickle.dump(self.rntn.stack, fid)
def buildDecisionTree(self, data, threshold, attributes): if self.binary: root = Tree.BinarySplitTree() else: root = Tree.MultiSplitTree() mostLabel = self.mostLabel(data) if self.isPure(data) or len(attributes) == 0 or data.shape[0] < threshold: root.isLeaf = True root.label = mostLabel return root else: root.isLeaf = False root.entropy = self.entropy(data) root.mostLabel = mostLabel attribute, value = self.bestAttribute(data, root.entropy, attributes) root.attribute = attribute newAttributes = attributes[:] newAttributes.remove(attribute) if self.binary: root.value = value root.leftChild = self.getChild(data.loc[data[attribute] < value], threshold, newAttributes, mostLabel) root.rightChild = self.getChild(data.loc[data[attribute] >= value], threshold, newAttributes, mostLabel) else: for newValue in data[attribute].unique(): dataset = data.loc[data[attribute] == newValue] child = self.buildDecisionTree(dataset, threshold, newAttributes) child.value = newValue root.children.append(child) return root
def __generate_test_case(self): tmp_path = self.p.get_current_test_case_path() + SETTINGS.get( "test_case_folder_name") + "_" + str( self.p.get_current_test_case_nb()) + ".test_case" if self.verbose: print("Current path: " + misc.color(self.p.get_current_test_case_path(), "cyan")) if misc.check_file(tmp_path, self.verbose): if self.verbose: print("Parsing existing test case: " + misc.color(tmp_path, "cyan")) self.tree.read_test_case(tmp_path) else: if self.verbose: print("Create new test case: " + misc.color( SETTINGS.get("test_case_folder_name") + ".test_case", "cyan")) counter = 0 while not self.tree.generate(self.verbose): print(counter) self.tree = Tree( SETTINGS.get("template_path") + SETTINGS.get("template_file_name")) counter += 1 if self.verbose: self.tree.print_current_node() self.tree.write_test_case(tmp_path)
def check_perms(s, set, handles, **kwargs): ask_flag = kwargs.get('Ask', True) if not ask_flag: if not MyUtil.get_yn('!!! Warning !!! ask = False: Will not ask to make changes, okay? Enter N to Exit, Y to Continue:'): print('exiting...') sys.exit(0) for handle in handles: if 'Document-' in handle: fd = DCC.prop_get(s, handle, InfoSet = 'DocBasic') elif 'Collection-' in handle: fd = DCC.prop_get(s, handle, InfoSet = 'CollData') else: fd = DCC.prop_get(s, handle, InfoSet = 'Title') fd['permissions'] = DCC.prop_get(s, handle, InfoSet = 'Perms') # print(fd['handle'], ':', fd['title']) print('\n>>>>>>>>>>>>>> DCC Information <<<<<<<<<<<<<<') if 'Document-' in handle: DCC.print_doc_basic(fd) elif 'Collection-' in handle: DCC.print_coll_data(fd) else: print('Not Document or Collection:', handle, ':', fd['title']) print('\n\tDoc Properties URL: ',Tree.url_view(handle)) print('\tPermissions URL: ',Tree.url_perm(handle)) print('\tGet Document URL: ',Tree.url_access(handle)) print() fix_objact(s, fd, handle, set, **kwargs) fix_permact(s, fd, handle, set, **kwargs)
def __init__(self, actionList, learningRate, discountFactor): self.actionList = actionList self.learningRate = learningRate self.discountFactor = discountFactor #Contains information of what states+actions lead to what states self.TransitionTable = {} #Contains Q-values for state-action pairs self.QTable = {} #Contains average reward for state-action pairs self.ETable = {} #A tree structure of rewarded sequences. Each sequence is stored in reverse to quickly find equivalent sequences self.rewardedSequences = Tree() #Same as above but not stored in reverse self.rewardedSequencesForward = Tree() self.rewardedSequencesForward.node = None #A set with all rewarded sequences self.rewardedSet = set() #A set with all punished sequences self.inputSet = set()
def Format(self, data): rootNode = Tree.Node(nodeLabel='[' + '/'.join(self.groupByAttrs) + ']', children=[], nodesDict={}) for item in data: node = rootNode for groupByAttr in self.groupByAttrs: groupByValue = str(rec_getattr(item, groupByAttr)) nodesDict = node.nodesDict oldNode = node node = nodesDict.get(groupByValue, None) if not node: node = Tree.Node(nodeLabel=groupByValue, children=[], nodesDict={}) oldNode.nodesDict[groupByValue] = node oldNode.children.append(node) node.children.append(item) print Tree.FormatAsTree(data=rootNode, labelAttr='nodeLabel', labelFunc=self.labelFunc, childrenAttr='children', useVt100LineDrawingChars=True) return ''
def fit(self, training_file, output_file, word_map_file='word_map.bin'): if not os.path.exists(word_map_file): tr.build_word_map(training_file, word_map_file) self.word_map_file = word_map_file self.trees = tr.load_trees(self.data_folder + training_file, self.word_map_file) self.num_words = len(tr.load_word_map(self.word_map_file)) self.rntn = RNTN.RNTN(self.vect_dim, self.output_dim, self.num_words, self.mini_batch_size) self.sgd = SGD.SGD(self.rntn, self.learning_rate, self.mini_batch_size) for e in range(self.optim_epochs): # Fit model # -------------------------- start = time.time() print "Running epoch %d" % e self.sgd.optimize(self.trees) end = time.time() print "\nTime per epoch : %f" % (end-start) # Save model specifications with open(output_file, 'w+') as fid: pickle.dump([(i, self.values[i]) for i in self.args][1:], fid) pickle.dump(self.sgd.cost_list, fid) pickle.dump(self.rntn.stack, fid)
def build_ann(exset, num_hidden, weight_decay_coef, num_iter): learning_rate = 0.01 num_examples = exset.shape[0] num_nodes_l1 = exset.shape[1] - 2 num_nodes_l3 = 1 if num_hidden != 0: num_nodes_l2 = num_hidden num_nodes_per_layer = [num_nodes_l1, num_nodes_l2, num_nodes_l3] else: num_nodes_per_layer = [num_nodes_l1, num_nodes_l3] tree = Tree(num_nodes_per_layer) if num_iter < 1: # train until convergence eps = 0.01 # convergence test delta_w = 1 # initialize delta larger than eps iteration = 0 while delta_w > eps: w_start = tree.compute_all_weights() w_final = iterate_example_set(tree, exset, learning_rate, weight_decay_coef) iteration += np.shape(exset)[0] delta_w = abs(w_start - w_final) print iteration else: iteration = 0 while iteration < num_iter: iterate_example_set(tree, exset, learning_rate, weight_decay_coef) iteration += np.shape(exset)[0] return tree
def addRewardedSequence(self, sequence, reward=None, action=None): nextChar = sequence[-1] branch = self.rewardedSequences for x in range(len(sequence)): char = nextChar if x < len(sequence) - 1: nextChar = sequence[-(x + 2)] else: nextChar = 1 if char not in branch.connections: branch.connections[char] = Tree() branch.connections[char].node = False if nextChar == 1: branch.connections[char].node = True branch = branch.connections[char] nextChar = sequence[0] branch = self.rewardedSequencesForward for x in range(len(sequence)): char = nextChar if x < len(sequence) - 1: nextChar = sequence[x + 1] else: nextChar = 1 if char not in branch.connections: branch.connections[char] = Tree() branch.connections[char].node = None if nextChar == 1: branch.connections[char].node = (action, reward) branch = branch.connections[char]
def AddToTree(board19, Candidate, player): temp = [] if (player == 10): enemy = 20 else: enemy = 10 for i in board19: temp += [i] evalTree = Tree(temp) for i in Candidate: for q in i[1]: tempboard = genNewBoard(temp, [i[0], q], player) tempTree = genTree(tempboard) tempCandidate = CandidateMoves(tempboard, enemy) for a in tempCandidate: for b in a[1]: temp2 = genNewBoard(tempboard, [a[0], b], enemy) temp2Tree = genTree(temp2) Candidate2 = CandidateMoves(temp2, player) for c in Candidate2: for d in c[1]: temp3 = genNewBoard(temp2, [c[0], d], player) temp3Tree = genTree(temp3) temp2Tree.AddSuccessor(temp3Tree) tempTree.AddSuccessor(temp2Tree) evalTree.AddSuccessor(tempTree) return evalTree
def main(): array = list(range(7)) array = [1, 2, 4, 4, 5, 6, 7, 8] tree = Tree(array) tree.print_tree() print(validate_BST(tree.root))
def DisplayDevicesAsTree(self, vm, attrs, useVt100Chars): """ Display virtual devices as a tree. """ def FormatRecord(record): return ', '.join( [str(rec_getattr(record, attr)) for attr in attrs]).rstrip() def GetDevices(obj): if isinstance(obj, Tree.Node): return [ device for device in vm.GetAllDevices() if device.controller is None ] elif hasattr(obj, 'managedObject'): if hasattr(obj.managedObject, 'device'): return [ vm.GetDevice(key) for key in obj.managedObject.device ] else: return [] rootNode = Tree.Node(nodeLabel=vm.name) print Tree.FormatAsTree(data=rootNode, labelAttr='nodeLabel', labelFunc=FormatRecord, childrenFunc=GetDevices, useVt100LineDrawingChars=useVt100Chars)
def compileSubroutineBody(self, subTreeNode): token = self.tokenizer.getNextToken() if token.getToken() != "{": raise ValueError( "Expeced \'{\' at start of subroutine body, but received: " + token.getToken()) subTreeNode.addChild(token) # handle 0 or more varDecs nextToken = self.tokenizer.peekNextToken() while nextToken.getToken() == 'var': varDecSubTreeNode = Tree.Node("varDec", subTreeNode.depth + 1) self.compileVarDec(varDecSubTreeNode) subTreeNode.addChildTree(varDecSubTreeNode) nextToken = self.tokenizer.peekNextToken() # handle 0 or more statements statementsSubTreeNode = Tree.Node("statements", subTreeNode.depth + 1) self.compileStatements(statementsSubTreeNode) subTreeNode.addChildTree(statementsSubTreeNode) token = self.tokenizer.getNextToken() if token.getToken() != '}': raise ValueError( "Expeced \'}\' at end of subroutine body, but got " + token.getToken() + " instead.") subTreeNode.addChild(token) return subTreeNode
def background(): """Creates the general background scenery""" #Creates random clouds in the sky for r in range(0,cloudNum): #Initialize variables x = randint(-100,1200) y = randint(-20,100) width = randint(60,90) height = randint(20,50) cloudColor = choice(["gray92","gray95","gray98"]) #Create lots of ovals to represent clouds for i in range(0,20): x1 = x - randint(1, width) y1 = y - randint(1, height) x2 = x + randint(1, width) y2 = y + randint(1, height) oval = screen.create_oval(x1, y1, x2, y2, fill=cloudColor, outline=cloudColor) #Ground behind the trees screen.create_oval(-100,320,1100,600, fill ="gainsboro", outline ="gainsboro") #Trees from Tree.py Tree.tree(screen) #Snowy Ground screen.create_rectangle (0,500,1000,800,fill="snow",outline="snow") screen.create_polygon (0,500,50,500,100,450,250,470,400,430,500,450,650,420,700,450,800,460,1020,470,1000,600, fill="snow",outline="snow",smooth="true") #Scorebox screen.create_rectangle( 320,100,680,350, fill="#80d5ff", outline="white", width="8")
def do_generate(self, arg): if self.tree is None: print("A template must be parsed first") return if not self.p.check_path(self.auto, self.verbose): print("file hierarchy is incomplete!") return while True: start = time.time() self.__generate_test_case() end = time.time() with open(self.p.get_experiment_path() + "time", "a") as f: f.write(str(end - start) + "\n") print("time: " + str(end - start)) while True: if self.verbose: print("generate test artifact") self.__generate_test_artifact() if not self.p.next_test_artifact(): if not self.p.next_path(): return break self.tree = Tree( SETTINGS.get("template_path") + SETTINGS.get("template_file_name"))
def compileWhileStatement(self, subTreeNode): token = self.tokenizer.getNextToken() if token.getToken() != "while": raise ValueError("Expected \'while\'.") subTreeNode.addChild(token) token = self.tokenizer.getNextToken() if token.getToken() != "(": raise ValueError("Expected \'(\'.") subTreeNode.addChild(token) exprSubTreeNode = Tree.Node("expression", subTreeNode.depth + 1) self.compileExpression(exprSubTreeNode) subTreeNode.addChildTree(exprSubTreeNode) token = self.tokenizer.getNextToken() if token.getToken() != ")": raise ValueError("Expected \')\'.") subTreeNode.addChild(token) token = self.tokenizer.getNextToken() if token.getToken() != "{": raise ValueError("Expected \'{\'.") subTreeNode.addChild(token) whileStatementsSubTreeNode = Tree.Node("statements", subTreeNode.depth + 1) self.compileStatements(whileStatementsSubTreeNode) subTreeNode.addChildTree(whileStatementsSubTreeNode) token = self.tokenizer.getNextToken() if token.getToken() != "}": raise ValueError("Expected \'}\'.") subTreeNode.addChild(token) return subTreeNode
def isBalanced(bt): if bt is None: return True d = Tree.getHeight(bt.left) - Tree.getHeight(bt.right) if abs(d) > 1: return False else: return isBalanced(bt.left) and isBalanced(bt.right)
def main(): array = list(range(7)) tree = Tree(array) tree.print_tree() print( get_first_common_ancestor(tree.root.left_child.left_child, tree.root.right_child))
def isBalanced(bt): if bt is None: return True d = Tree.getHeight(bt.left) - Tree.getHeight(bt.right) if abs(d) > 1: return False else: return isBalanced(bt.left) and isBalanced(bt.right)
def __init__(self, iface,user): # Save reference to the QGIS interface self.iface = iface self.message=None self.tree=Tree(user) self.message="selected" self.progressBar=ProgressBarWindow(True,True)# apro la progress bar con due barre self.progressBar.setMaximumOverall(4) self.ui_tree=MainWindowAlbero(iface,self.tree)
def fib_tree(n): if n == 1: return Tree(0) elif n == 2: return Tree(1) else: left = fib_tree(n-2) right = fib_tree(n-1) return Tree(left.label + right.label, (left, right))
def print_to_file(self, folder, is_pruned): for i in range(0, len(self.trees)): # Tree.print_tree(self.trees[i].root_node) if (is_pruned): Tree.write_tree_to_file(self.pruned_trees[i].root_node, i + 1, folder, is_pruned) else: Tree.write_tree_to_file(self.trees[i].root_node, i + 1, folder, is_pruned)
def Read(self): # yarab.program() # print(yarab.token_type) # print(yarab.token_value) # print(yarab.error_type) # print(yarab.error_type) # if yarab.error_type != "": # Tree.process(token_value,token_type) # else: # print('error') token_value = [] string_t_value = '' token_type = [] string_t_type = '' bool_colon_found = 0 j = 0 token_len = 0 set = stat('test.txt').st_size == 0 if set != True: with open('test.txt') as fp: for cnt, line in enumerate(fp): print(line) for i in line: if i == ' ': pass elif i == ',': bool_colon_found = 1 elif bool_colon_found == 0: string_t_value += i elif (bool_colon_found == 1) and (i != '\n'): string_t_type += i token_value.append(string_t_value) token_type.append(string_t_type) token_len = len(token_type) bool_colon_found = 0 string_t_value = '' string_t_type = '' # print(token_value) # print(token_type) yarab.token_value = token_value yarab.token_type = token_type yarab.token_len = token_len yarab.program() if yarab.error_type == "": Tree.process(token_value, token_type) else: QMessageBox.about(self, "error Messsage", yarab.error_type) print(yarab.error_type) # //give me the msg box for error_type else: error_type = "the file is empty" QMessageBox.about(self, "error Messsage", error_type) print(error_type)
class Page(Base.Page): def childFactory(self, ctx, seg): set = { "Edit": Edit.editPage, "Groups": Group.editGroups, "GroupMod": Group.editGroupsByGroup, "GroupAdd": Group.addGroups, "Delete": Delete.deletePage, "Add": Add.addPage, "DomainAdd": Domains.addDomain, "DomainDel": Domains.delDomain, "Bulk": Bulk.bulkUsers, "Failed": Base.FailurePage } if seg in set.keys(): return set[seg](self.avatarId, db=self.db) else: return Page(self.avatarId, self.db, seg) def render_editContent(self, ctx, data): return ctx.tag[ tags.h2[self.text.userManagement], tags.p[self.text.usersBeginInstruction], tags.br, tags.img(src="/images/truck.png", alt="Bulk", style="vertical-align: middle"), " ", tags.a(href="Bulk/")["Bulk modifications"] ] def render_treeView(self, ctx, data): try: T = Tree.Tree("r", "Domains") l = Tree.retrieveTree(Settings.LDAPServer, Settings.LDAPManager, Settings.LDAPPass, 'o='+Settings.LDAPBase) flatL = Tree.flattenTree(l, 'o='+Settings.LDAPBase) flatL.sort() self.flatFil = [] except Exception, e: flatL = [] Utils.exceptionOccured(e) if not self.avatarId.isAdmin: for nod in flatL: for d in self.avatarId.domains: if (d in nod): self.flatFil.append(nod) elif not "dm=" in nod: self.flatFil.append(nod) else: self.flatFil = flatL for node in self.flatFil: Tree.addPath(node, T) return ctx.tag[ tags.div(id="TreeCont")[Tree.StanTree(T, self.cid)], ]
def compileIfStatement(self, subTreeNode): token = self.tokenizer.getNextToken() if token.getToken() != "if": raise ValueError("Expected if.") subTreeNode.addChild(token) token = self.tokenizer.getNextToken() if token.getToken() != "(": raise ValueError("Expected \'(\'.") subTreeNode.addChild(token) ifExprSubTreeNode = Tree.Node("expression", subTreeNode.depth + 1) self.compileExpression(ifExprSubTreeNode) subTreeNode.addChildTree(ifExprSubTreeNode) token = self.tokenizer.getNextToken() if token.getToken() != ")": raise ValueError("Expected \')\'.") subTreeNode.addChild(token) token = self.tokenizer.getNextToken() if token.getToken() != "{": raise ValueError("Expected \'{\'.") subTreeNode.addChild(token) ifStatementsSubTreeNode = Tree.Node("statements", subTreeNode.depth + 1) self.compileStatements(ifStatementsSubTreeNode) subTreeNode.addChildTree(ifStatementsSubTreeNode) token = self.tokenizer.getNextToken() if token.getToken() != "}": raise ValueError("Expected \'}\'.") subTreeNode.addChild(token) nextToken = self.tokenizer.peekNextToken() if nextToken.getToken() == "else": token = self.tokenizer.getNextToken() subTreeNode.addChild(token) token = self.tokenizer.getNextToken() if token.getToken() != "{": raise ValueError("Expected \'{\'.") subTreeNode.addChild(token) elseStatementsSubTreeNode = Tree.Node("statements", subTreeNode.depth + 1) self.compileStatements(elseStatementsSubTreeNode) subTreeNode.addChildTree(elseStatementsSubTreeNode) token = self.tokenizer.getNextToken() if token.getToken() != "}": raise ValueError("Expected \'}\'.") subTreeNode.addChild(token) return subTreeNode
def draw_picture(): # window wn.clearscreen() wn.bgcolor("light blue") # sun sun_size_range = [100,200,150,125,175] random_number = random.randint(0,4) sun_size = sun_size_range[random_number] sun_pos_range = [150 ,100, 0, -100, -150] sun_pos = sun_pos_range[random_number] sun = Sun() sun.pen.penup() sun.pen.goto(sun_pos, 100) sun.draw(sun_size, "yellow") # trees positions = [-250, -100, 0, 100, 200] sizes = [100, 150, 200, 125, 175] tree_amount_range = [1,3,4,5,6,] random_number = random.randint(0,4) tree_amount = tree_amount_range[random_number] random_track = 0 for i in range(tree_amount): random_number = random.randint(0, 4) random_track = random_number while (random_number == random_track): random_number = random.randint(0, 4) random_position = positions[random_number] tree_size = sizes[random_number] tree = Tree() tree.pen.goto(random_position, -300) tree.draw(tree_size) # Houses house = House() house.pen.penup() house.pen.goto(-300, -300) size = [100, 50, 200, 25, 75] space = [50, 100, 10, 25, 75] house_amount_range = [1,2,3,4,5] random_number = random.randint(0,4) house_amount = house_amount_range[random_number] color = ["blue", "orange", "cyan", "purple", "pink"] for i in range(house_amount): random_number = random.randint(0, 4) house_color = color[random_number] house_size = size[random_number] house_space = space[random_number] house.draw(house_size, house_color, house_space) wn.listen() wn.onkeypress(draw_picture, 'Up') wn.mainloop()
def createTreeForRule(self, rule): children = [] for child in rule._alpha: if child._type == 'Sigma': children.append(Tree.Tree("Basic", child, (), [], self)) else: # DEBUG: if here with a bug, you should consider that there might be a problem with the rules of the extended child" children.append(Tree.Tree("Complex", child, [], [], self)) return Tree.Tree("Complex", rule._A, rule, children, self)
def render_treeView(self, ctx, data): try: T = Tree.Tree("r", "Domains") l = Tree.retrieveTree(Settings.LDAPServer, Settings.LDAPManager, Settings.LDAPPass, 'o='+Settings.LDAPBase) flatL = Tree.flattenTree(l, 'o='+Settings.LDAPBase) flatL.sort() self.flatFil = [] except Exception, e: flatL = [] Utils.exceptionOccured(e)
def check_perms(s, set, handle, treename, **kwargs): ask_flag = kwargs.get('Ask', True) if not ask_flag: if not MyUtil.get_yn('!!! Warning !!! ask = False: Will not ask to make changes, okay? Enter N to Exit, Y to Continue:'): print('exiting...') sys.exit(0) tr = Tree.return_tree(s, handle, treename) handles = Tree.get_flat_tree(tr) for handle in handles: fix_set(s, handle, set, **kwargs)
def __init__(self, type, key_words, secondary_words, excluding_words): self.type_name = type key_words_tree = Tree.AVLTree() self.key_words = key_words_tree.insert_array(key_words) secondary_words_tree = Tree.AVLTree() self.secondary_words = secondary_words_tree.insert_array( secondary_words) excluding_Words_tree = Tree.AVLTree() self.excluding_words = excluding_Words_tree.insert_array( excluding_words)
def lightrun(self, list_surface=[Surface()], light_in=Light(), i_t=1): # i_t is reflection times and trans times # this function will simulate the ray, and return a tree and list_surface tree_light = Tree() tree_light.add(light_in) # this will be a for command for i_t for i in range(i_t): # calcute for list_surface # get myQueue length q_length = len(tree_light.myQueue) # run over myQueue,to add new light in tree, but we build a new list, queue is dynamic # select light list_light_temp = [] for index in range(q_length): light_temp = tree_light.myQueue[index].elem list_light_temp.append(light_temp) for light_temp in list_light_temp: if light_temp == None: # no light to reflect tree_light.add(None) tree_light.add(None) else: # get p,t,surface list_mpts = self.get_mp_t0_and_surface( list_surface, light_temp) mp_t0 = list_mpts[0] surface_m = list_mpts[1] # judge if surface is None if surface_m == None: # no reflect and transmisson tree_light.add(None) tree_light.add(None) else: # set the current light_in time # find light_temp index in tree, through it's dynamic, bud no influence, cause if light_temp is finish , we dont need that for i in range(len(tree_light.myQueue)): if tree_light.myQueue[i].elem == light_temp: index = i tree_light.myQueue[index].elem.set_t( np.arange(0, mp_t0[3] + mp_t0[3] / 10, mp_t0[3] / 10)) # set the point in surface is meeting point to save the value to plot list_surface_index = list_surface.index(surface_m) # mp = [mp_t0[0], mp_t0[1], mp_t0[2]] # list_surface[list_surface_index].set_p(np.array(mp)) # calcute trans and ref light_t_temp = self.transmisson2(surface_m, light_temp) light_r_temp = self.reflection(surface_m, light_temp) # add to tree tree_light.add(light_t_temp) tree_light.add(light_r_temp) return [tree_light, list_surface]
def compileSubroutineDec(self, subTreeNode): # handle constuctor, function, method token = self.tokenizer.getNextToken() if token.getToken() not in ['constructor', 'function', 'method']: raise ValueError( "Subroutine declaration must begin with \'constructor\', \'function\', \'method\'." ) subTreeNode.addChild(token) # handle 'void' | type token = self.tokenizer.getNextToken() if token.getToken() == "void": subTreeNode.addChild(token) elif self.validateType( token): # if not validateType, then we necessarily throw error subTreeNode.addChild(token) # handle subRoutineName token = self.tokenizer.getNextToken() self.validateSubroutineName(token) subTreeNode.addChild(token) # handle '(' token = self.tokenizer.getNextToken() if token.getToken() != '(': raise ValueError("Expected \'(\' before parameter list.") subTreeNode.addChild(token) # handle parameterList pListSubTreeNode = Tree.Node("parameterList", subTreeNode.depth + 1) self.compileParameterList( pListSubTreeNode ) # needs to printed like <parameterList></paremeterList> (even if no children) subTreeNode.addChildTree(pListSubTreeNode) # handle ')' token = self.tokenizer.getNextToken() if token.getToken() != ')': raise ValueError("Expected \')\' after parameter list, but got " + token.getToken() + " instead.") subTreeNode.addChild(token) # handle subroutineBody nextToken = self.tokenizer.peekNextToken() if nextToken.getToken() != '{': raise ValueError( "Expeced \'{\' at start of subroutine body, but received: " + nextToken.getToken()) subroutineBodySubTreeNode = Tree.Node("subroutineBody", subTreeNode.depth + 1) self.compileSubroutineBody(subroutineBodySubTreeNode) subTreeNode.addChildTree(subroutineBodySubTreeNode) return subTreeNode
def imprimir_predicciones(tree, test, header): os.system("cls") print("Imprimiendo...\n") os.system("pause") os.system("cls") for row in test: print("Actual: %s. Predicted: %s" % (row[-1], Tree.print_prediction(Tree.classify(row, tree.root)))) print() os.system("pause") pass
def makeParseTreeNode(p, value): '''Returns a Tree object containing as children p[1:] and a value of value''' toReturn = Tree() for element in p[1:]: if type(element) == type(toReturn): toReturn.children.append(element) toReturn.errors += element.errors else: # the element is not a tree. wrap it in a tree newElement = Tree() if isinstance(element, tuple): newElement.value = element[0] newElement.type = element[1] else: newElement.value = element toReturn.children.append(newElement) if isinstance(value, tuple): toReturn.value = value[0] toReturn.type = value[1] else: toReturn.value = value if value == "error": errorMessage = str(p[1][2]) + ": " + p[1][0] toReturn.errors.append(errorMessage) return toReturn
def optimize_branch_fast(tlobj, tprime, children_index_list): """ Quick optimization of subset of branches (indicated by <children_index_list>) in tprime while using tlobj for parameters children_index_list --- list of (i, j) indicating that we want to iteratively refine the branch of node label i --- node label j Most likely will be the 3 local branches at the new insertion point of a subtree. For fast optimization, relax the branch length variation to 0.1. Returns: final (positive) log likelihood of tprime NOTE: this only changes branch lengths in tprime. tlobj not affected!! NOTE: reversible_subtree_func currently cheats by only recalc-ing the entries of parent and up, to ensure this works, I think making sure copy_{S|P} are correct is important and therefore the two g() calls. """ g = MyMat.calc_likelihood meat = scipy.optimize.fmin_l_bfgs_b def reversible_subtree_func(copy_S, copy_P, parent, child, t_a): #assert len(t_a) == 1 child.edge_length = t_a[0] order = Tree.postorder_cheat_traverse(parent) L_single = g(tlobj.single_model.gtr.R, copy_S, tlobj.log_freq_single, \ order, range(tlobj.ncol), tlobj.nnode, tlobj.ncol, tlobj.nbase) L_paired = g(tlobj.paired_model.gtr.R, copy_P, tlobj.log_freq_paired, \ order, range(tlobj.ncol_p), tlobj.nnode_p, tlobj.ncol_p, tlobj.nbase_p) ans = -(L_single.sum() + L_paired.sum()) return ans # TODO: make this more efficient! copy_S = tlobj.S.copy() copy_P = tlobj.P.copy() order = Tree.postorder_assign_then_traverse(tprime, None, False) g(tlobj.single_model.gtr.R, copy_S, tlobj.log_freq_single, \ order, range(tlobj.ncol), tlobj.nnode, tlobj.ncol, tlobj.nbase) g(tlobj.paired_model.gtr.R, copy_P, tlobj.log_freq_paired, \ order, range(tlobj.ncol_p), tlobj.nnode_p, tlobj.ncol_p, tlobj.nbase_p) changed = True while changed: changed = False for i, j in children_index_list: parent = tprime.find_node_with_label(i) child = tprime.find_node_with_label(j) old_t_a = child.edge_length func = lambda x: reversible_subtree_func(copy_S, copy_P, parent, child, x) x, fx, d = meat(func, [old_t_a], approx_grad=True, \ bounds=[(1e-3, 10)], pgtol=1e-2) # print "calling func {0}--{1} done".format(i,j), x, fx, d, x[0], old_t_a, abs(x[0] - old_t_a) if d['warnflag'] != 0: return None, None # handle this appropriately! if abs(x[0] - old_t_a) > 0.1: changed = True return fx, tprime
def NNI(t): """ Randomly select an internal node to do NNI alters the tree <t> Returns: t, (new) order """ while True: parent = random.choice(t.internal_nodes()) # choose one of the kids as target # and another as sibling target, sibling = random.sample(parent.child_nodes(), 2) if target.is_leaf(): continue else: # select one children from target to swap w/ sibling child = random.choice(target.child_nodes()) break print >> sys.stderr, "NNI: parent {0}, target {1}, sibling {2}, child {3}".format(\ parent.label, target.label, sibling.label, child.label) # swap child & sibling in tree new_child_branch = child.edge_length + target.edge_length new_sibling_branch = sibling.edge_length - target.edge_length parent.remove_child(sibling) target.remove_child(child) parent.add_child(child, new_child_branch) target.add_child(sibling, new_sibling_branch) # obtain new order via postorder traversal (should be fast enough) order = Tree.postorder_assign_then_traverse(t, None, do_assign=False) return t, order
def optimize_branch_func(self, parent, child, t_a): """ <t_a> is the new branch length between <parent> --- <child> (t_a is dressed in an array...should always be just [t_a]) We can cheat & speed up likelihood calculation by re-using likelihods of subtrees below child and T' where T' is the subtree under root that does not contain parent/child Returns: POSITIVE sum of log likelihood (so we try to minimize it) currently wrapped up by ::optimize_branch:: NOTE: it is ::optimize_branch::'s responsibility to update self.order and self.like when all is done!!! p.s. potentialy speed-up by simultaneously optimizing two child branches of the same parent?? """ #assert len(t_a) == 1 g = MyMat.calc_likelihood child.edge_length = t_a[0] # TODO: make this more efficient! cheat_order = Tree.postorder_cheat_traverse(parent) L_single = g(self.single_model.gtr.R, self.S, self.log_freq_single, \ cheat_order, range(self.ncol), self.nnode, self.ncol, self.nbase) L_paired = g(self.paired_model.gtr.R, self.P, self.log_freq_paired, \ cheat_order, range(self.ncol_p), self.nnode_p, self.ncol_p, self.nbase_p) return -(L_single.sum() + L_paired.sum())
def __init__(self, msa, tree, single_model, paired_model, treat_gap_as_missing): """ Input: msa --- MSA object (the alignment) tree --- initially is the starting tree (dendropy.Tree) single/paired model -- EvoModel.{single|paired}model objects Also has the following attributes: single_cols --- list of unpaired positions paired_cols --- list of paired positions (i, j) order --- postorder traversal (often changes! beware!) like --- positive log likelihood (often changes! beware!) nnode, ncol, nbase for single/paired parameters... NOTE: ENFORCES tree TO BE BINARY """ self.msa = msa self.tree = tree self.single_model = single_model self.paired_model = paired_model self.treat_gap_as_missing = treat_gap_as_missing self.log_freq_single = log(self.single_model.Frequency) self.log_freq_paired = log(self.paired_model.Frequency) self.single_cols = msa.single_cols() self.paired_cols = msa.BP.items() self.paired_cols.sort() self.nnode = 2*msa.nseq + 1 self.ncol = len(self.single_cols) self.nbase = 5 self.nnode_p = self.nnode self.ncol_p = len(self.paired_cols) self.nbase_p = 25 Tree.make_tree_binary(self.tree) # must preceded self.order! self.order = Tree.postorder_assign_then_traverse(tree, list(msa.ids)) self.like = None # should be the positive log likelihood self.S = None # likelihood matrix for single positions self.P = None # likelihood matrix for paired positions
def setupDefaultTree( idx, pname, listCodeList ): """ 프로젝트가 생성될시 디폴트 트리를 구성합니다 """ # 프로젝트 정보 트리에 등록 treeList = [{ "text": pname, "pos":"000", "pidx": idx, "place": "PROJECT", "ntype": "PAGE", "icon":"ico-project", "gourl": "/project/view2/"+ str(idx), "issystem": True }] # 기본 리스트 트리에 등록 for nListCode in listCodeList: alist = gLister[nListCode] treeList.append({ "text": alist.Title, "pos": "001", "pidx": idx, "place": "PROJECT", "icon": alist.IconCls, "ntype": "LIST", "gourl": "/lister/list2/%s/%s" % (nListCode, idx), "issystem": True}) Tree.save( treeList ) return
def reset_trees(self): self.__canvas = CanvasApp(self, 6, 8) self.__tpa = Tree(PointerAlgorithm()) self.__ms1 = MH(1) self.__ms2 = MH(2) fill_tree(self.__tpa, self.__canvas) self.__ms1.add_gui(self.__canvas.add_circle(0, 0, 0, fill="white", outline="black", width=2, name="MS 1")) self.__tpa.put_ms_into_node_name(self.__ms1, 7) self.__ms2.add_gui(self.__canvas.add_circle(0, 0, 0, fill="white", outline="black", width=2, name="MS 2")) self.__tpa.put_ms_into_node_name(self.__ms2, 18)
def reversible_subtree_func(copy_S, copy_P, parent, child, t_a): #assert len(t_a) == 1 child.edge_length = t_a[0] order = Tree.postorder_cheat_traverse(parent) L_single = g(tlobj.single_model.gtr.R, copy_S, tlobj.log_freq_single, \ order, range(tlobj.ncol), tlobj.nnode, tlobj.ncol, tlobj.nbase) L_paired = g(tlobj.paired_model.gtr.R, copy_P, tlobj.log_freq_paired, \ order, range(tlobj.ncol_p), tlobj.nnode_p, tlobj.ncol_p, tlobj.nbase_p) ans = -(L_single.sum() + L_paired.sum()) return ans
def test(self, specs_file, data_test_file): trees = tr.load_trees(self.data_folder + data_test_file) assert specs_file is not None, "Please provide a model to test." with open(specs_file, 'r') as fid: _ = pickle.load(fid) _ = pickle.load(fid) rntn = RNTN.RNTN(self.output_dim, self.num_words, self.mini_batch_size) rntn.stack = pickle.load(fid) print "Testing..." cost, correct, total = rntn.cost_and_gradients(trees, test=True) print "\nCost : :%f \nCorrectly labelled : %d/%d \nAccuracy : %f." % (cost, correct, total, correct / float(total))
def fit(self, word_map_file='word_map.bin'): data_train_file = self.opts.training_file print '================\nTRAINING\n================' # If the word map file does not exist, create it. if not os.path.exists(word_map_file): tr.build_word_map(data_train_file, word_map_file) self.word_map_file = word_map_file # Load trees and set the RNTN. self.trees = tr.load_trees(self.opts.data_folder + data_train_file, self.word_map_file) self.num_words = len(tr.load_word_map(self.word_map_file)) self.rntn = RNTN.RNTN(vec_dim=self.opts.vect_dim, output_dim=self.opts.output_dim, num_words=self.num_words, mini_batch_size=self.opts.mini_batch_size) self.sgd = optimizer.SGD(self.rntn, self.opts.learning_rate, self.opts.mini_batch_size) for e in range(self.opts.optim_epochs): # Fit model. # After the training phase, model specifications # are in self.rntn.stack. # -------------------------- start = time.time() print "Running epoch %d" % e self.sgd.optimize(self.trees) end = time.time() print "Time per epoch : %f" % (end-start)
def test(self): data_test_file = self.opts.testing_file print '\n================\nTESTING\n================' trees = tr.load_trees(self.opts.data_folder + data_test_file) # Load the test RNTN. test_rntn = RNTN.RNTN(self.opts.vect_dim, self.opts.output_dim, self.num_words, self.opts.mini_batch_size) test_rntn.params = self.rntn.params test_rntn.V, test_rntn.W, test_rntn.b, test_rntn.W_s, test_rntn.b_s = \ self.rntn.V, self.rntn.W, self.rntn.b, self.rntn.W_s, self.rntn.b_s test_rntn.L = self.rntn.L cost, correct, total = test_rntn.cost_and_updates(trees, 1, test=True) print "Cost : %f, Correct : %d/%d, Acc %f %%" % (cost, correct, total, 100 * correct / float(total))
def rearr(t, log_l, rL, rU): for target in t.postorder_node_iter(): if target.parent_node is None: break # first make a deep copy of the tree t_prime = dendropy.Tree(t) print "finding subtree rearrangement for {0}".format(target.label) dest = cello.subtree_rearrangement(t_prime, target, rL, rU) print "inserting subtree {0} into branch above {1}".format(target.label, dest.label) try: # attach the subtree of <target> to branch above <dest> t_prime, affected = Subtree.move_subtree(t_prime, target.label, dest.label) except Exception: print "could not succesfully do the move, forget it! move on!" continue cheat_order = Tree.postorder_traverse_with_cheat(t_prime, affected) # the three local branche we need to optimize are edges of # target, dest, and parent of target lst = [] for i, (k, bunch) in enumerate(cheat_order): for j, (a, t_a) in enumerate(bunch): if a in (target.label, dest.label, target.parent_node.label): lst.append((i, j)) print 'list is', lst log_l_prime = MyMat.optimize_branch_fast(lst, cheat_order, msa, single_model, paired_model, S, P) if log_l_prime < log_l: print "subtree rearrangement improved log like from {0}-->{1}, keep!".format(log_l, log_l_prime) t = t_prime log_l = log_l_prime # put in the fastly optimized branch lengths for i, j in lst: t.find_node_with_label(cheat_order[i][1][j][0]).edge_length = cheat_order[i][1][j][1] raw_input("continue?") return else: print "subtree rearrangment made log likelihood worse. Move on" raw_input("continue") return return t, log_l
def p_empty(p): '''empty :''' p[0] = Tree() p[0].value = "empty"
from Tree import * from Node import * from numpy import random from random import randint from math import log import numpy as np c = Counter() count = [] logn = [] for k in range(1,50): n = int(5*((1.2)**k)) j = randint(1,n) N = Tree(c) logn.append(log(n)) for i in range(1,n+1): j = randint(1,n) N.insert(j) #N.delete(N.root) avg = N.c.query()/n N.c.reset() count.append(avg) #inorder(N.root) #print(count) import matplotlib.pyplot as plt logn = np.array(logn) count = np.array(count)
""" Given a sorted (increasing order) array with unique integer elements, write an algorithm to create a binary search tree with minimal height. """ import Tree def createMBST_a(ary, start, end): if end < start: return None mid = int((start + end) / 2) n = Tree.Node(ary[mid]) n.left = createMBST_a(ary, start, mid - 1) n.right = createMBST_a(ary, mid + 1, end) return n def createMBST(ary): return createMBST_a(ary, 0, len(ary) - 1) ary = [0, 1, 2, 3, 4, 5, 6] n = createMBST(ary) Tree.levelorderTraversal(n)
def isBST2(bt): return isBST2_a(bt, -99999, 99999) def isBST2_a(bt, min, max): if bt is None: return True if bt.data <= min or bt.data > max: return False if not isBST2_a(bt.left, min, bt.data) or not isBST2_a(bt.right, bt.data, max): return False return True bt = Tree.Node(1) bt.left = Tree.Node(0) bt.right = Tree.Node(20) Tree.levelorderTraversal(bt) print() print(isBST(bt)) print(isBST2(bt)) bt2 = Tree.Node(10) bt2.left = bt Tree.levelorderTraversal(bt2) print() print(isBST(bt2)) # wrong print(isBST2(bt2)) bt2 = Tree.Node(10) bt2.left = bt bt2.right = Tree.Node(9) Tree.levelorderTraversal(bt2)
def visualize(self, filename): Tree.eteVisualize(self.toEteTree(), filename)
For the purposes of this question, a balanced tree is defined to be a tree such that the heights of the two subtrees of any node never differ by more than one. """ import Tree def isBalanced(bt): if bt is None: return True d = Tree.getHeight(bt.left) - Tree.getHeight(bt.right) if abs(d) > 1: return False else: return isBalanced(bt.left) and isBalanced(bt.right) # Balanced tree bt = Tree.createPerfectTree(3) Tree.levelorderTraversal(bt) print() print(Tree.getHeight(bt)) print(isBalanced(bt)) # Unbalanced tree bt = Tree.Node(0) bt.left = Tree.Node(1) bt.right = Tree.Node(2) bt2 = Tree.Node(3) bt2.left = bt Tree.levelorderTraversal(bt2) print() print(Tree.getHeight(bt2)) print(isBalanced(bt2))
def create_DCC_mirror(s, dcc_handle, dirpath, **kwargs): tr = Tree.get_tree(s,dcc_handle) Tree.print_tree(s, tr) docList = Tree.get_flat_tree(tr) traverse(s, tr, tr['root']['collections'][0], dirpath, **kwargs)
def p_statement_newline(p): '''simple_statement : newline_opt_comment''' p[0] = Tree() p[0].value = "empty"
def main(): s = RandomFSSequence( no_of_shifts=2, min_length=50, max_length=100 ) s.generate() print s.info( "without UGA" ) # a Sequence object #t = BiologicalSequence( s.sequence ) #t = BiologicalSequence( "GCTGGTGGGGTAGCAGGTGTTTCTGTTGACTTGATATTATTTCCTCTGGATACCATTAAAACCAGGCTGCAGAGTCCCCAAGGATTTAGTAAGGCTGGTGGTTTTCATGGAATATATGCTGGCGTTCCTTCTGCTGCTATTGGATCCTTTCCTAATG" ) t = BiologicalSequence( "AAATGACGAACACAGAGGAAAGAAGAGAGGCAACTGCTGAGGTCCCCTAGGCCTTTGAGAAAACGGAGTTGTACCTTTGGCAACATAAGTGCATATCTACAAGAAAGGCGATAATGTAGACACCAAGGGAATGGGTACTGTCCAAAAAGAAATGCCTCACAAATGTCACCATGGCAAAACTAAAAGAGTCTACAAAGTTACCTAGCATGCTGTTGGCATCATTGTAAACAAACAAGTTAAGGGCAAGATTCTTGCCAAGAGAATTAATATGCATATTGGGCATATTAAGCACTCTAAGAGCCAAGATGATTTCCTGAAAGTGTGTGAAGGAAAATAACCAGCATAAAGAGGGAAGCTAAAGAGAAACCTGAAGCTGCAGCCTGTTCCACCCAGAGAAGCACACTTTGTAAGAACCAATGAAAAGGAGCCTGAGCTGCTGGAGTCTATTAACTGAATTCATGGT" ) #t = RandomSequence( 100 ) #t.generate() # t.stops.append( "UGA" ) print print t.info() for i in xrange( 3 ): print t.colour_frame( i, sep="" ) print " |"*(( s.length )//10 ) t.get_stop_sequence() print "The raw stop sequence (%s)..." % len( t.stop_sequence ) print t.stop_sequence print # now to create paths p = Paths( t.stop_sequence ) print "The sanitised stop sequence (%d)..." % len( p.unique_frame_sequence ) print p.unique_frame_sequence print print "Create the branches from the stop sequence..." p.create_branches() print print "Create a tree..." T = Tree() print "View and graft the branches..." for B in p.branches: #print B T.graft( B ) print T print "Build the paths..." paths = T.get_paths( simplify=True ) print paths print for frame in xrange( 3 ): print "Frameshift sequences for frame %d:" % frame for j in T.get_frame_paths( frame ): print len( j ), " : ", j print """ frameshifted_sequence, fragments = t.frameshift_from_path( all_paths[0] ) q = BiologicalSequence( s.sequence ) print s.info() for i in xrange( 3 ): print q.colour_frame( i, sep="" ) print " |"*(( s.length )//10 ) print print " ".join( fragments ) print print t.path print t.colour_frameshifted_sequence( sep="" ) print " |"*(( s.length )//10 ) """ for i in xrange( 3 ): all_paths = T.get_frame_paths( i ) for a in all_paths: frameshifted_sequence, fragments, frameshift_signals = t.frameshift_from_path( a ) print t.path print t.colour_frameshifted_sequence( sep="" ) print " ".join( fragments ) print " ".join( frameshift_signals ) print
def checkPerms(target, permissions): # Login to DCC s = DCC.login(CF.dcc_url + CF.dcc_login) if 'Collection' in target: tr = Tree.get_tree(s,target) Tree.print_tree(s, tr) docList = Tree.get_flat_tree(tr) else: docList = [target] printCheckCriteria(target, permissions) passList = [] failList = [] for doc in docList: checkFlag = True if 'Document' in doc: fd = DCC.prop_get(s, doc, InfoSet = 'DocBasic') fd['permissions'] = DCC.prop_get(s, doc, InfoSet = 'Perms', Depth = '0') print("\n\n*** Document Entry", fd['handle'], "***") print("DCC Name: \"",fd['title'],"\"",sep="") print("TMT Document Number: ", fd['tmtnum']) print("https://docushare.tmt.org/docushare/dsweb/ServicesLib/" + fd['handle'] + "/view") elif 'Collection' in doc: fd = DCC.prop_get(s, doc, InfoSet = 'CollData') fd['permissions'] = DCC.prop_get(s, doc, InfoSet = 'Perms', Depth = '0') print("\n\n*** Collection Entry", fd['handle'], "***") print("https://docushare.tmt.org/docushare/dsweb/ServicesLib/" + fd['handle'] + "/view") else: checkFlag = False print("\nNot checking permissions on object that is not a Collection or Document):",doc) if checkFlag: OkayPerms = [] for perm in sorted(fd["permissions"]["perms"], key = lambda x: x["handle"]): # Go through each set and create a dictionary of entries that have perms okay for sets in permissions: for item,plist in sets.items(): if perm["handle"] == item: if printCheckPerms(perm,plist) == True: OkayPerms.append(item) permFlag = False for sets in permissions: testFlag = True for item in sets: if not item in OkayPerms: testFlag = False if testFlag == True: permFlag = True if permFlag == True: print("*** PERMISSIONS MEET CRITERIA ***") passList.append(doc) else: print("!!! PERMISSIONS DO NOT MEET CRITERIA !!!") failList.append(doc) return([passList,failList])
default=0) parser.add_argument('--maxChildren', '-M', help="The maximum number of children by nodes", type=int, default=8) parser.add_argument('--alpha', '-a', help="The 'a' parameter of the Weibull distribution " "used to create the task length.", type=float, default=1) parser.add_argument('--scale', '-s', help="The mean time of each task.", type = float, default=1) parser.add_argument('--filename', '-f', help="The filename to save the tree.", default="tree.txt") args = parser.parse_args() if args.minChildren > args.maxChildren: args.maxChildren = args.minChildren + 1 tree = Tree.Tree(args.height, args.minChildren, args.maxChildren, args.alpha, *Tree.calibrate(args.scale)) Tree.exportTree(tree, args.filename) print("Generated :\n{0}".format(tree))
tree = None, branch_scale = 0, height_scale = 0, ) (options, args) = Experiment.Start( parser, add_pipe_options = True ) if options.filename_tree: tree_lines = open(options.filename_tree, "r").readlines() elif options.tree: tree_lines = options.tree else: raise "please supply a species tree." nexus = TreeTools.Newick2Nexus( tree_lines ) Tree.updateNexus( nexus ) tree = nexus.trees[0] if options.loglevel >= 2: tree.display() plot = SVGTree( tree ) plot.setBranchScale( options.branch_scale ) plot.setHeightScale( options.height_scale ) if options.colour_by_species: rx = re.compile(options.species_regex) extract_species = lambda x: rx.search( x ).groups()[0] plot.setDecoratorExternalNodes( NodeDecoratorBySpecies( tree, extract_species= extract_species ) )