def test_createFlowHeader(self):
"""header_info dict turned into flowgram header"""
f = Flowgram('0.5 1.0 4.0 0.0 1.5 0.0 0.0 2.0', Name='a',
header_info = {'Bases':'TACCCCTTGG','Name Length':'14'})
self.assertEqual(f.createFlowHeader(),
""">a\n Name Length:\t14\nBases:\tTACCCCTTGG\nFlowgram:\t0.5\t1.0\t4.0\t0.0\t1.5\t0.0\t0.0\t2.0\n""")
def test_cmpByName(self):
"""Flowgrams should be the same if name, bases, or to_seqs are equal"""
f = Flowgram('0.5 1.0 4.0 0.0', Name = 'a',floworder = "TACG",
header_info = {'Bases':'TACCCC'})
f2 = Flowgram('0.5 1.0 4.0 0.0', Name = 'a',floworder = "TACG",
header_info = {'Bases':'TACCCC'})
self.assertEqual(f.cmpByName(f2), 0)
self.assertEqual(f.cmpByName(f), 0)
f2 = Flowgram('0.5 1.0 4.0 0.0', Name = 'b',floworder = "TACG",
header_info = {'Bases':'TACCCC'})
self.assertNotEqual(f.cmpByName(f2), 0)
def test_toFasta(self):
"""Flowgram toFasta() should return Fasta-format string"""
even = '0.5 1.0 4.0 0.0'
odd = '0.5 1.0 4.0 1.0'
even_f = Flowgram(even, Name='even', floworder = "TACG")
odd_f = Flowgram(odd, Name='odd', floworder = "TACG")
self.assertEqual(even_f.toFasta(), '>even\nTACCCC')
#set line wrap to small number so we can test that it works
self.assertEqual(even_f.toFasta(LineWrap = 2), '>even\nTA\nCC\nCC')
self.assertEqual(odd_f.toFasta(LineWrap = 2), '>odd\nTA\nCC\nCC\nG')
even_f = Flowgram(even, Name='even', floworder = "TACG",
header_info ={'Bases':'TACCCG'})
odd_f = Flowgram(odd, Name='odd', floworder = "TACG",
header_info ={'Bases':'TACCCGG'})
self.assertEqual(even_f.toFasta(), '>even\nTACCCG')
#set line wrap to small number so we can test that it works
self.assertEqual(even_f.toFasta(LineWrap = 2), '>even\nTA\nCC\nCG')
self.assertEqual(odd_f.toFasta(LineWrap = 2), '>odd\nTA\nCC\nCG\nG')
def test_getQualityTrimmedFlowgram(self):
"""getQualityTrimmedFlowgram trims the flowgram correctly"""
f = Flowgram('0.5 1.0 4.1 0.0 0.0 1.23 0.0 3.1',
Name = 'a', floworder = "TACG",
header_info = {'Bases':'TACCCCAGGG', 'Clip Qual Right': 7,
'Flow Indexes': "1\t2\t3\t3\t3\t3\t6\t8\t8\t8"})
trimmed = f.getQualityTrimmedFlowgram()
self.assertEqual(trimmed.toSeq(), "TACCCCA")
self.assertEqual(str(trimmed), "0.5\t1.0\t4.1\t0.0\t0.0\t1.23")
# tests on real data
flow1 = self.flows[0]
flow2 = self.flows[1]
flow1_trimmed = flow1.getQualityTrimmedFlowgram()
self.assertEqual(str(flow1_trimmed), "1.06 0.08 1.04 0.08 0.05 0.94 0.10 2.01 0.10 0.07 0.96 0.09 1.04 1.96 1.07 0.10 1.01 0.13 0.08 1.01 1.06 1.83 2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97")
self.assertEqual(flow1_trimmed.Bases,
"tcagGCTAACTGTAACCCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCA")
flow2_trimmed = flow2.getQualityTrimmedFlowgram()
self.assertEqual(str(flow2_trimmed), "1.04 0.00 1.01 0.00 0.00 1.00 0.00 1.00 0.00 1.05 0.00 0.91 0.10 1.07 0.95 1.01 0.00 0.06 0.93 0.02 0.03 1.06 1.18 0.09 1.00 0.05 0.90 0.11 0.07 1.99 0.11 0.02 1.96 1.04 0.13 0.01 2.83 0.10 1.97 0.06 0.11 1.04 0.13 0.03 0.98 1.15 0.07 1.00 0.07 0.08 0.98 0.11 1.92 0.05 0.04 2.96 1.02 1.02 0.04 0.93 1.00 0.13 0.04 1.00 1.03 0.08 0.97 0.13 0.11 1.88 0.09 0.05 1.02 1.89 0.07 0.11 0.98 0.05 0.07 1.01 0.08 0.05 1.01 0.13 1.00 0.07 0.10 1.04 0.10 0.04 0.98 0.12 1.03 0.96 0.11 0.07 1.00 0.09 0.03 1.03 0.11 1.95 1.06 0.13 0.05 1.00 0.13 0.11 1.00 0.09 0.03 2.89 0.08 0.95 0.09 1.03 1.02 1.05 1.07 0.08 0.12 2.81 0.08 0.08 1.00 1.07 0.07 0.05 1.86 0.12 0.98 0.06 2.00 0.11 1.02 0.11 0.08 1.88 0.13 1.03 0.13 0.98 0.15 0.11 1.03 1.03 1.04 0.18 0.98 0.13 0.15 1.04 0.11 1.01 0.13 0.06 1.01 0.06 1.02 0.08 0.99 0.14 0.99 0.09 0.05 1.09 0.04 0.07 2.96 0.09 2.03 0.13 2.96 1.13 0.08 1.03 0.07 0.99 0.11 0.05 1.05 1.04 0.09 0.07 1.00 1.03 0.09 0.06 1.06 1.04 2.94 0.18 0.06 0.93 0.10 1.10 0.11 2.02 0.17 1.00 1.03 0.06 0.11 0.96 0.04 3.00 0.11 0.07 1.99 0.10 2.03 0.12 0.97 0.16 0.01 2.09 0.14 1.04 0.16 0.06 1.03 0.14 1.12 0.12 0.05 0.96 1.01 0.10 0.14 0.94 0.03 0.12 1.10 0.92 0.09 1.10 1.04 1.02 0.12 0.97 2.00 0.15 1.08 0.04 1.03 1.04 0.03 0.09 5.16 1.02 0.09 0.13 2.66 0.09 0.05 1.06 0.07 0.89 0.05 0.12 1.10 0.16 0.06 1.01 0.13 1.00 0.14 0.98 0.09 2.92 1.28 0.03 2.95 0.98 0.16 0.08 0.95 0.96 1.09 0.08 1.07 1.01 0.16 0.06 4.52 0.12 1.03 0.07 0.09 1.03 0.14 0.03 1.01 1.99")
self.assertEqual(flow2_trimmed.Bases,
"tcagAGACGCACTCAATTATTTCCATAGCTTGGGTAGTGTCAATAATGCTGCTATGAACATGGGAGTACAAATATTCTTCAAGATACTGATCTCATTTCCTTTAGATATATACCCAGAAGTGAAATTCCTGGATCACATAGTAGTTCTATTTTTATTTGATGAGAAACTTTATACTATTTTTCATAA")
def test_cmpSeqToString(self):
"""Sequence should compare equal to same string."""
f = Flowgram('0.5 1.0 4.0 0.0', Name = 'a',floworder = "TACG",
header_info = {'Bases':'TACCCC'})
self.assertTrue(f.cmpSeqToString('TACCCC'))
self.assertFalse(f.cmpSeqToString('TACCC'))
f = Flowgram('0.5 1.0 4.0 0.0',floworder = "TACG")
self.assertTrue(f.cmpSeqToString('TACCCC'))
self.assertFalse(f.cmpSeqToString('TACCC'))
def test_toSeq(self):
"""toSeq should Translate flowgram to sequence"""
f = Flowgram('0.5 1.0 4.0 0.0',
Name='a',
floworder="TACG",
header_info={'Bases': 'TACCCG'})
self.assertEqual(f.toSeq(), 'TACCCG')
self.assertEqual(isinstance(f.toSeq(), Sequence), True)
self.assertEqual(f.toSeq(Bases=False), 'TACCCC')
f = Flowgram('0.5 1.0 4.0 0.0 0.0 1.23 0.0 6.1',
Name='a',
floworder="TACG",
header_info={'Bases': 'TACCCG'})
self.assertEqual(f.toSeq(), 'TACCCG')
self.assertEqual(f.toSeq(Bases=False), 'TACCCCAGGGGGG')
f = Flowgram('0.5 1.0 4.0 0.0',
Name='a',
floworder="TACG",
header_info={})
self.assertEqual(f.toSeq(), 'TACCCC')
self.assertEqual(isinstance(f.toSeq(), Sequence), True)
self.assertEqual(f.toSeq(Bases=False), 'TACCCC')
f = Flowgram('0.5 1.0 4.0 0.0 0.0 1.23 0.0 6.1',
Name='a',
floworder="TACG",
header_info={})
self.assertEqual(f.toSeq(Bases=True), 'TACCCCAGGGGGG')
f = Flowgram('0.4 0.0 0.0 0.0 0.0 1.23 0.0 1.1',
Name='a',
floworder="TACG",
header_info={})
self.assertEqual(f.toSeq(), 'NAG')
def test_str(self):
"""__str__ returns self._flowgram unmodified."""
f = Flowgram('0.5 1.0 4.0 0.0')
self.assertEqual(str(f), '0.5\t1.0\t4.0\t0.0')
f = Flowgram([0.5, 1.0, 4.0, 0.0])
self.assertEqual(str(f), '0.5\t1.0\t4.0\t0.0')
def test_iter(self):
"""Flowgram iter should iterate over sequence"""
f = Flowgram('0.5 1.0 4.0 0.0')
self.assertEqual(list(f), [0.5, 1.0, 4.0, 0.0])
def test_toFasta(self):
"""Flowgram toFasta() should return Fasta-format string"""
even = '0.5 1.0 4.0 0.0'
odd = '0.5 1.0 4.0 1.0'
even_f = Flowgram(even, Name='even', floworder="TACG")
odd_f = Flowgram(odd, Name='odd', floworder="TACG")
self.assertEqual(even_f.toFasta(), '>even\nTACCCC')
#set line wrap to small number so we can test that it works
self.assertEqual(even_f.toFasta(LineWrap=2), '>even\nTA\nCC\nCC')
self.assertEqual(odd_f.toFasta(LineWrap=2), '>odd\nTA\nCC\nCC\nG')
even_f = Flowgram(even,
Name='even',
floworder="TACG",
header_info={'Bases': 'TACCCG'})
odd_f = Flowgram(odd,
Name='odd',
floworder="TACG",
header_info={'Bases': 'TACCCGG'})
self.assertEqual(even_f.toFasta(), '>even\nTACCCG')
#set line wrap to small number so we can test that it works
self.assertEqual(even_f.toFasta(LineWrap=2), '>even\nTA\nCC\nCG')
self.assertEqual(odd_f.toFasta(LineWrap=2), '>odd\nTA\nCC\nCG\nG')
flowgram = Flowgram("0.99 0.00 0.99 0.00 0.00 1.02 0.00 1.00 1.00 1.12\t\t" +
"0.01 0.01 1.89 0.01 0.95 0.95 0.97 0.00 0.02 0.98\t" +
"0.97 0.00 0.97 0.05 0.01 1.06 0.03 0.97 0.00 0.03\t" +
"0.97 0.02 0.00 1.09 0.02 0.01 0.96 0.00 0.00 1.01\t" +
"0.04 0.00 0.99 0.06 0.97 0.00 0.09 0.97 0.04 0.00\t" +
"1.94 0.09 1.02 0.00 2.86 1.02 1.00 1.11 0.10 1.97\t" +
"0.12 0.98 0.01 0.99 2.90 0.03 0.04 1.93 0.15 1.02\t" +
"1.95 1.00 1.02 0.00 0.12 1.00 0.97 0.00 1.00 0.06\t" +
"0.97 0.00 0.96 0.05 0.10 1.03 0.12 0.99 1.98 0.09\t" +
"1.99 0.08 0.13 2.10 0.14 0.05 1.00 0.10 0.00 1.00\t" +
"1.00 0.00 0.07 4.82 0.10 1.04 2.05 0.00 2.01 0.04\t" +
"1.96 0.08 0.93 0.00 0.93 0.03 0.99 0.02 1.01 0.06\t" +
"0.09 1.04 0.14 1.06 0.07 2.04 3.49 0.15 1.02 0.80\t" +
"0.23 0.07 1.07 0.17 1.91 0.07 0.18 1.00 0.32 0.07\t" +
"0.97 0.11 0.96 0.96 0.14 1.96 0.19 2.01 2.84 0.28\t" +
"0.08 2.03 1.32 0.06 0.05 1.10 0.17 0.88 0.09 0.95\t" +
"0.14 0.13 1.85 1.07 1.78 0.89 1.94 0.19 1.09 0.14\t" +
"1.09 0.13 0.13 0.86 1.85 0.07 0.09 1.97 1.20 0.08\t" +
"0.95 0.23 0.09 0.94 0.16 0.11 1.92 0.12 0.89 1.95\t" +
"0.21 0.12 0.97 0.14 0.16 1.86 0.12 1.89 1.00 1.07\t" +
"0.06 0.16 1.05 0.11 0.06 0.95 0.12 0.13 1.01 0.15\t" +
"3.79 0.14 0.15 0.98 0.40 0.11 1.00 0.19 1.01 1.09\t" +
"0.12 0.94 0.11 0.15 1.00 2.04 2.03 0.95 0.06 3.05\t" +
"0.22 0.08 1.82 0.21 1.02 0.09 2.88 1.88 0.15 0.07\t" +
"1.05 1.89 0.08 0.06 1.87 2.87 1.87 0.06 0.15 1.15\t" +
"0.25 0.08 0.96 0.12 0.06 0.95 0.09 0.13 1.05 1.95\t" +
"3.81 1.02 0.13 0.17 2.14 1.08 0.19 0.13 1.08 1.01\t" +
"1.99 0.11 0.18 1.06 0.17 0.04 0.98 0.08 1.01 2.86\t" +
"1.06 0.96 0.10 0.22 1.99 2.04 0.14 0.00 0.97 0.16\t" +
"0.95 0.07 2.75 0.02 0.98 0.12 2.94 0.00 0.99 1.03\t" +
"0.26 2.89 0.15 1.87 0.10 0.15 0.98 0.17 1.07 0.92\t" +
"0.00 0.09 1.08 0.16 3.78 1.01 0.07 0.87 0.22 0.98\t" +
"1.97 1.09 0.08 0.17 1.08 0.03 0.97 2.04 0.18 0.14\t" +
"1.03 0.03 0.00 1.16 0.12 1.81 2.06 0.18 0.17 2.06\t" +
"0.14 0.85 0.21 0.12 1.01 1.05 1.05 0.94 0.99 0.11\t" +
"0.15 1.08 2.00 1.02 0.99 0.13 1.07 0.13 0.98 0.16\t" +
"0.09 0.99 3.00 1.05 1.02 0.02 0.10 0.93 0.11 0.09\t" +
"0.81 0.97 0.13 0.05 2.04 1.93 1.12 0.04 0.93 0.93\t" +
"0.11 0.06 1.96 0.06 0.09 1.14 0.15 0.06 1.08 0.06\t" +
"0.94 0.11 0.00 0.88 1.11 0.10 2.08 1.05 0.15 0.09")
def seqs_to_flows(seqs, keyseq = default_keyseq, floworder = default_floworder,
numflows = None, probs = None, bin_size = 0.01,
header_info = {}):
""" Transfrom a sequence into an ideal flow
seqs: a list of name sequence object tuples (name,tuple)
keyseq: the flowgram key Sequence
floworder: The chars needed to convert seq to flow
numflows: number of total flows in each flowgram, if it is specified
the flowgram will be padded to that number
probs: dictionary defining the probability distribution for each
homopolymer
WARNING:each distributions probabilities must add to 1.0
"""
flows = []
homopolymer_counter = 1.0
if probs:
for p in probs:
if round(sum(probs[p]),1) != 1.0:
raise ValueError, 'probs[%s] does not add to 1.0' % p
for name,seq in seqs:
flow_seq = FakeRandom(floworder,True)
flow = []
seq_len = len(seq)
for i, nuc in enumerate(seq):
if i < seq_len-1 and seq[i+1] == nuc:
homopolymer_counter += 1.0
else:
while flow_seq() != nuc:
if probs is None:
val = 0.0
else:
val = pick_from_prob_density(probs[0],bin_size)
flow.append(val)
if (probs is None) or (homopolymer_counter > 9):
val = homopolymer_counter
else:
val = pick_from_prob_density(probs[int(homopolymer_counter)],bin_size)
flow.append(val)
homopolymer_counter = 1.0
len_flow = len(flow)
len_order = len(floworder)
if numflows is not None and numflows % len_order != 0:
raise ValueError, "numflows must be divisable by the length of floworder"
if (len_flow % len_order != 0):
right_missing = len_order - (len_flow % len_order)
if numflows != (len_flow + right_missing) and numflows is not None:
right_missing += (numflows - (len_flow+right_missing))
if probs is None:
flow.extend([0.0]*right_missing)
else:
for i in range(0,right_missing):
flow.append(pick_from_prob_density(probs[0],bin_size))
flows.append((name, Flowgram(flow, id, keyseq, floworder)))
if keyseq is not None:
keylen = len(keyseq)
else:
keylen = None
header_info.update({'Key Sequence':keyseq,'Flow Chars':floworder,
'Key Length':keylen})
return FlowgramCollection(flows, header_info = header_info)
def test_toSeq(self):
"""toSeq should Translate flowgram to sequence"""
f = Flowgram('0.5 1.0 4.0 0.0', Name = 'a',floworder = "TACG",
header_info = {'Bases':'TACCCG'})
self.assertEqual(f.toSeq(), 'TACCCG')
self.assertEqual(isinstance(f.toSeq(),Sequence), True)
self.assertEqual(f.toSeq(Bases = False), 'TACCCC')
f = Flowgram('0.5 1.0 4.0 0.0 0.0 1.23 0.0 6.1',
Name = 'a',floworder = "TACG",
header_info = {'Bases':'TACCCG'})
self.assertEqual(f.toSeq(), 'TACCCG')
self.assertEqual(f.toSeq(Bases = False), 'TACCCCAGGGGGG')
f = Flowgram('0.5 1.0 4.0 0.0', Name = 'a',floworder = "TACG",
header_info = {})
self.assertEqual(f.toSeq(), 'TACCCC')
self.assertEqual(isinstance(f.toSeq(),Sequence), True)
self.assertEqual(f.toSeq(Bases = False), 'TACCCC')
f = Flowgram('0.5 1.0 4.0 0.0 0.0 1.23 0.0 6.1',
Name = 'a',floworder = "TACG",
header_info = {})
self.assertEqual(f.toSeq(Bases = True), 'TACCCCAGGGGGG')
f = Flowgram('0.4 0.0 0.0 0.0 0.0 1.23 0.0 1.1',
Name = 'a',floworder = "TACG",
header_info = {})
self.assertEqual(f.toSeq(), 'NAG')
def test_getPrimerTrimmedFlowgram(self):
"""getPrimerTrimmedFlowgram cuts the barcode of the flowgram correctly"""
f = Flowgram('0.5 1.0 4.1 0.0 0.0 1.23 0.0 3.1',
Name = 'a', floworder = "TACG",
header_info = {'Bases':'TACCCCAGGG', 'Clip Qual Right': 7,
'Flow Indexes': "1\t2\t3\t3\t3\t3\t6\t8\t8\t8"})
trimmed = f.getPrimerTrimmedFlowgram(primerseq="TA")
#test primer trimming
self.assertEqual(trimmed.toSeq(), "CCCCAGGG")
self.assertEqual(str(trimmed), "0.00\t0.00\t4.10\t0.00\t0.00\t1.23\t0.00\t3.10")
for (a,b) in zip(trimmed.flowgram, [0.0,0.0,4.1,0.0,0.0,1.23,0.0,3.1]):
self.assertFloatEqual(a,b)
trimmed = f.getPrimerTrimmedFlowgram(primerseq="TACC")
for (a,b) in zip(trimmed.flowgram, [0.0,0.0,2.1,0.0,0.0,1.23,0.0,3.1]):
self.assertFloatEqual(a,b)
self.assertEqual(trimmed.toSeq(), "CCAGGG")
self.assertEqual(str(trimmed), "0.00\t0.00\t2.10\t0.00\t0.00\t1.23\t0.00\t3.10")
# test that primer trimming does not leave ambig flow at begin
trimmed = f.getPrimerTrimmedFlowgram(primerseq="TACCCC")
for (a,b) in zip(trimmed.flowgram, [0.0,1.23,0.0,3.1]):
self.assertFloatEqual(a,b)
self.assertEqual(trimmed.toSeq(), "AGGG")
self.assertEqual(str(trimmed), "0.00\t1.23\t0.00\t3.10")
# tests on real data
flow1 = self.flows[0]
flow2 = self.flows[1]
flow3 = self.flows[2]
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG"+"GCTAACTGTAA")
self.assertEqual(str(flow1_trimmed), "0.00\t0.00\t2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04")
self.assertEqual(flow1_trimmed.Bases,
"CCCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc")
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG"+"GCTAACTGTAAC")
self.assertEqual(str(flow1_trimmed), "0.00\t0.00\t1.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04")
self.assertEqual(flow1_trimmed.Bases,
"CCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc")
#test that trimming does not leave 4 zero flows (homopolymer)
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG"+"GCTAACTGTAACCC")
self.assertEqual(str(flow1_trimmed), "0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04")
self.assertEqual(flow1_trimmed.Bases,
"TCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc")
#test that trimming does not leave 4 zero flows (signal <1.5)
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG"+"GCTAACTGTAACCCTC")
self.assertEqual(str(flow1_trimmed), "1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04")
self.assertEqual(flow1_trimmed.Bases,
"TTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc")
flow1_untrimmed= flow1.getPrimerTrimmedFlowgram("")
self.assertEqual(str(flow1_untrimmed), "1.06 0.08 1.04 0.08 0.05 0.94 0.10 2.01 0.10 0.07 0.96 0.09 1.04 1.96 1.07 0.10 1.01 0.13 0.08 1.01 1.06 1.83 2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04")
self.assertEqual(flow1_untrimmed.Bases, "tcagGCTAACTGTAACCCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc")
flow2_trimmed = flow2.getPrimerTrimmedFlowgram(primerseq="TCAG"+"AGACGCACT")
self.assertEqual(str(flow2_trimmed), "0.00\t0.05\t0.90 0.11 0.07 1.99 0.11 0.02 1.96 1.04 0.13 0.01 2.83 0.10 1.97 0.06 0.11 1.04 0.13 0.03 0.98 1.15 0.07 1.00 0.07 0.08 0.98 0.11 1.92 0.05 0.04 2.96 1.02 1.02 0.04 0.93 1.00 0.13 0.04 1.00 1.03 0.08 0.97 0.13 0.11 1.88 0.09 0.05 1.02 1.89 0.07 0.11 0.98 0.05 0.07 1.01 0.08 0.05 1.01 0.13 1.00 0.07 0.10 1.04 0.10 0.04 0.98 0.12 1.03 0.96 0.11 0.07 1.00 0.09 0.03 1.03 0.11 1.95 1.06 0.13 0.05 1.00 0.13 0.11 1.00 0.09 0.03 2.89 0.08 0.95 0.09 1.03 1.02 1.05 1.07 0.08 0.12 2.81 0.08 0.08 1.00 1.07 0.07 0.05 1.86 0.12 0.98 0.06 2.00 0.11 1.02 0.11 0.08 1.88 0.13 1.03 0.13 0.98 0.15 0.11 1.03 1.03 1.04 0.18 0.98 0.13 0.15 1.04 0.11 1.01 0.13 0.06 1.01 0.06 1.02 0.08 0.99 0.14 0.99 0.09 0.05 1.09 0.04 0.07 2.96 0.09 2.03 0.13 2.96 1.13 0.08 1.03 0.07 0.99 0.11 0.05 1.05 1.04 0.09 0.07 1.00 1.03 0.09 0.06 1.06 1.04 2.94 0.18 0.06 0.93 0.10 1.10 0.11 2.02 0.17 1.00 1.03 0.06 0.11 0.96 0.04 3.00 0.11 0.07 1.99 0.10 2.03 0.12 0.97 0.16 0.01 2.09 0.14 1.04 0.16 0.06 1.03 0.14 1.12 0.12 0.05 0.96 1.01 0.10 0.14 0.94 0.03 0.12 1.10 0.92 0.09 1.10 1.04 1.02 0.12 0.97 2.00 0.15 1.08 0.04 1.03 1.04 0.03 0.09 5.16 1.02 0.09 0.13 2.66 0.09 0.05 1.06 0.07 0.89 0.05 0.12 1.10 0.16 0.06 1.01 0.13 1.00 0.14 0.98 0.09 2.92 1.28 0.03 2.95 0.98 0.16 0.08 0.95 0.96 1.09 0.08 1.07 1.01 0.16 0.06 4.52 0.12 1.03 0.07 0.09 1.03 0.14 0.03 1.01 1.99 1.05 0.14 1.03 0.13 0.03 1.10 0.10 0.96 0.11 0.99 0.12 0.05 0.94 2.83 0.14 0.12 0.96 0.00 1.00 0.11 0.14 1.98 0.08 0.11 1.04 0.01 0.11 2.03 0.15 2.05 0.10 0.03 0.93 0.01 0.08 0.12 0.00 0.16 0.05 0.07 0.08 0.11 0.07 0.05 0.04 0.10 0.05 0.05 0.03 0.07 0.03 0.04 0.04 0.06 0.03 0.05 0.04 0.09 0.03 0.08 0.03 0.07 0.02 0.05 0.02 0.06 0.01 0.05 0.04 0.06 0.02 0.04 0.04 0.04 0.03 0.03 0.06 0.06 0.03 0.02 0.02 0.08 0.03 0.01 0.01 0.06 0.03 0.01 0.03 0.04 0.02 0.00 0.02 0.05 0.00 0.02 0.02 0.03 0.00 0.02 0.02 0.04 0.01 0.00 0.01 0.05")
self.assertEqual(flow2_trimmed.Bases,
"CAATTATTTCCATAGCTTGGGTAGTGTCAATAATGCTGCTATGAACATGGGAGTACAAATATTCTTCAAGATACTGATCTCATTTCCTTTAGATATATACCCAGAAGTGAAATTCCTGGATCACATAGTAGTTCTATTTTTATTTGATGAGAAACTTTATACTATTTTTCATAActgagcgggctggcaaggc")
#trimming at the end of the flow cycle works
flow3_trimmed = flow3.getPrimerTrimmedFlowgram(primerseq="TCAG"+"ATTAGATACCCNGGTAGG")
self.assertEqual(str(flow3_trimmed), "0.05 0.05 2.04 0.10 0.03 1.06 1.05 1.01 0.07 0.09 2.07 1.01 0.93 2.88 1.06 1.95 1.00 0.05 0.05 2.97 0.09 0.00 0.93 1.01 0.06 0.05 0.99 0.09 0.98 1.01 0.03 1.02 1.92 0.07 0.01 1.03 1.01 0.01 0.05 0.96 0.09 0.05 0.98 1.07 0.02 2.02 2.05 0.09 1.87 0.12 2.15 0.05 0.13 0.92 1.05 1.96 3.01 0.13 0.04 1.05 0.96 0.05 0.05 0.95 0.12 0.01 1.00 2.02 0.03 0.03 0.99 1.01 0.05 0.06 0.98 0.13 0.06 0.97 0.11 1.01 0.08 0.12 1.02 0.12 1.02 2.19 1.03 1.01 0.08 0.11 0.96 0.09 0.08 1.01 0.08 0.06 2.10 2.11 0.12 1.04 0.13 0.09 0.94 1.03 0.08 0.05 3.06 0.12 1.00 0.03 0.09 0.95 0.10 0.03 2.09 0.21 0.99 0.06 0.11 4.06 0.10 1.04 0.04 1.05 1.05 1.04 1.02 0.97 0.13 0.93 0.10 0.12 1.08 0.12 0.99 1.06 0.10 0.11 0.98 0.10 0.02 2.01 0.10 1.01 0.09 0.96 0.07 0.11 2.03 4.12 1.05 0.08 1.01 0.04 0.98 0.14 0.12 2.96 0.13 1.98 0.12 2.08 0.10 0.12 1.99 0.13 0.07 0.98 0.03 0.93 0.86 4.10 0.13 0.10 3.99 1.13 0.07 0.06 1.07 0.09 0.05 1.03 1.12 0.13 0.05 2.01 0.08 0.80 0.05 0.11 0.98 0.13 0.04 1.01 0.07 1.02 0.07 0.11 1.07 2.19 0.06 0.97 0.11 1.03 0.05 0.11 1.05 0.14 0.06 1.03 0.13 0.10 0.97 0.16 0.13 1.00 0.13 0.06 1.02 2.15 0.02 0.16 0.95 0.09 2.06 2.12 0.07 0.07 2.08 0.12 0.97 1.00 0.03 0.99 1.02 1.01 0.03 0.15 0.90 0.07 0.01 2.00 1.01 1.00 0.06 0.11 1.08 1.00 0.03 1.99 0.03 1.00 0.02 1.85 1.93 0.14 1.97 0.91 1.83 0.06 0.04 1.97 0.05 2.08 0.04 0.06 1.05 0.05 2.13 0.16 0.09 1.17 0.01 1.01 1.07 0.09 0.14 0.91 0.06 0.08 1.03 1.04 0.08 0.05 1.05 1.03 1.16 0.06 0.05 1.01 0.06 2.15 0.06 1.99 0.13 0.04 1.08 0.97 0.11 0.07 1.05 0.08 0.07 2.13 0.14 0.09 1.10 0.15 0.00 1.02 0.07 1.05 0.05 0.95 0.09 1.00 0.15 0.95 0.08 0.15 1.11 0.07 0.12 1.05 1.06 0.09 1.03 0.07 0.11 1.01 0.05 0.05 1.05 0.98 0.00 0.93 0.08 0.12 1.85 1.11 0.10 0.07 1.00 0.01 0.10 1.87 0.05 2.14 1.10 0.03 1.06 0.10 0.91 0.10 0.06 1.05 1.02 1.02 0.07 0.06 0.98 0.95 1.09 0.06 0.14 0.97 0.04 2.44")
self.assertEqual(flow3_trimmed.Bases,
"CCACGCCGTAAACGGTGGGCGCTAGTTGTGCGAACCTTCCACGGTTTGTGCGGCGCAGCTAACGCATTAAGCGCCCTGCCTGGGGAGTACGATCGCAAGATTAAAACTCAAAGGAATTGACGGGGCCCCGCACAAGCAGCGGAGCATGCGGCTTAATTCGACGCAACGCGAAGAACCTTACCAAGGCTTGACATATACAGGAATATGGCAGAGATGTCATAGCCGCAAGGTCTGTATACAGG")
flow3_trimmed = flow3.getPrimerTrimmedFlowgram(primerseq="TCAG"+"ATTAGATACCCNGGTAG")
self.assertEqual(str(flow3_trimmed), "0.00\t0.00\t0.00 1.10 0.05 0.05 2.04 0.10 0.03 1.06 1.05 1.01 0.07 0.09 2.07 1.01 0.93 2.88 1.06 1.95 1.00 0.05 0.05 2.97 0.09 0.00 0.93 1.01 0.06 0.05 0.99 0.09 0.98 1.01 0.03 1.02 1.92 0.07 0.01 1.03 1.01 0.01 0.05 0.96 0.09 0.05 0.98 1.07 0.02 2.02 2.05 0.09 1.87 0.12 2.15 0.05 0.13 0.92 1.05 1.96 3.01 0.13 0.04 1.05 0.96 0.05 0.05 0.95 0.12 0.01 1.00 2.02 0.03 0.03 0.99 1.01 0.05 0.06 0.98 0.13 0.06 0.97 0.11 1.01 0.08 0.12 1.02 0.12 1.02 2.19 1.03 1.01 0.08 0.11 0.96 0.09 0.08 1.01 0.08 0.06 2.10 2.11 0.12 1.04 0.13 0.09 0.94 1.03 0.08 0.05 3.06 0.12 1.00 0.03 0.09 0.95 0.10 0.03 2.09 0.21 0.99 0.06 0.11 4.06 0.10 1.04 0.04 1.05 1.05 1.04 1.02 0.97 0.13 0.93 0.10 0.12 1.08 0.12 0.99 1.06 0.10 0.11 0.98 0.10 0.02 2.01 0.10 1.01 0.09 0.96 0.07 0.11 2.03 4.12 1.05 0.08 1.01 0.04 0.98 0.14 0.12 2.96 0.13 1.98 0.12 2.08 0.10 0.12 1.99 0.13 0.07 0.98 0.03 0.93 0.86 4.10 0.13 0.10 3.99 1.13 0.07 0.06 1.07 0.09 0.05 1.03 1.12 0.13 0.05 2.01 0.08 0.80 0.05 0.11 0.98 0.13 0.04 1.01 0.07 1.02 0.07 0.11 1.07 2.19 0.06 0.97 0.11 1.03 0.05 0.11 1.05 0.14 0.06 1.03 0.13 0.10 0.97 0.16 0.13 1.00 0.13 0.06 1.02 2.15 0.02 0.16 0.95 0.09 2.06 2.12 0.07 0.07 2.08 0.12 0.97 1.00 0.03 0.99 1.02 1.01 0.03 0.15 0.90 0.07 0.01 2.00 1.01 1.00 0.06 0.11 1.08 1.00 0.03 1.99 0.03 1.00 0.02 1.85 1.93 0.14 1.97 0.91 1.83 0.06 0.04 1.97 0.05 2.08 0.04 0.06 1.05 0.05 2.13 0.16 0.09 1.17 0.01 1.01 1.07 0.09 0.14 0.91 0.06 0.08 1.03 1.04 0.08 0.05 1.05 1.03 1.16 0.06 0.05 1.01 0.06 2.15 0.06 1.99 0.13 0.04 1.08 0.97 0.11 0.07 1.05 0.08 0.07 2.13 0.14 0.09 1.10 0.15 0.00 1.02 0.07 1.05 0.05 0.95 0.09 1.00 0.15 0.95 0.08 0.15 1.11 0.07 0.12 1.05 1.06 0.09 1.03 0.07 0.11 1.01 0.05 0.05 1.05 0.98 0.00 0.93 0.08 0.12 1.85 1.11 0.10 0.07 1.00 0.01 0.10 1.87 0.05 2.14 1.10 0.03 1.06 0.10 0.91 0.10 0.06 1.05 1.02 1.02 0.07 0.06 0.98 0.95 1.09 0.06 0.14 0.97 0.04 2.44")
self.assertEqual(flow3_trimmed.Bases,
"GCCACGCCGTAAACGGTGGGCGCTAGTTGTGCGAACCTTCCACGGTTTGTGCGGCGCAGCTAACGCATTAAGCGCCCTGCCTGGGGAGTACGATCGCAAGATTAAAACTCAAAGGAATTGACGGGGCCCCGCACAAGCAGCGGAGCATGCGGCTTAATTCGACGCAACGCGAAGAACCTTACCAAGGCTTGACATATACAGGAATATGGCAGAGATGTCATAGCCGCAAGGTCTGTATACAGG")
def test_init_empty(self):
"""Flowgram should init correctly."""
f = Flowgram()
self.assertEqual(f._flowgram, '')
self.assertEqual(f.flowgram, [])
def __init__(self, data, Name = None, Names = None,
header_info = None, conversion_f = None,
name_conversion_f = None, remove_duplicate_names = False):
"""Initialize self with data and optionally Info.
Parameters:
data: Data to convert into a FlowgramCollection
Name: Name of the FlowgramCollection.
conversion_f: Function to convert data into Flowgram.
name_conversion_f: if present, converts name into f(name).
header_info: contains info to be printed in the common header of an sff
file, it is a dictionary. ex: Key Sequence:"ATCG"
"""
#read all the data in if we were passed a generator
if isinstance(data, GeneratorType):
data = list(data)
#set the Name
self.Name = Name
if header_info is not None:
self._check_header_info(header_info)
for i in header_info:
setattr(self,i,header_info[i])
if 'Key Sequence' in header_info:
keyseq = header_info['Key Sequence']
else:
keyseq = None
if 'Flow Chars' in header_info:
floworder = header_info['Flow Chars']
else:
floworder = default_floworder
else:
keyseq = None
floworder = default_floworder
self.header_info = header_info
per_flow_names, flows, name_order, info = \
self._names_flows_order(conversion_f, data, Names, \
name_conversion_f, remove_duplicate_names)
self.Names = name_order
#will take only the flows and names that are in name_order
if per_flow_names != name_order:
good_indices = []
for n in name_order:
good_indices.append(per_flow_names.index(n))
flows = [flows[i] for i in good_indices]
info = [info[i] for i in good_indices]
per_flow_names = name_order
self.flow_str= flows
self.flows = [Flowgram(f,n,keyseq,floworder, i)\
for f,n, i in zip(flows,self.Names,info)]
#create NamedFlows dict for fast lookups
self.NamedFlows = self._make_named_flows(self.Names, self.flows)
def test_getPrimerTrimmedFlowgram(self):
"""getPrimerTrimmedFlowgram cuts the barcode of the flowgram correctly"""
f = Flowgram('0.5 1.0 4.1 0.0 0.0 1.23 0.0 3.1',
Name='a',
floworder="TACG",
header_info={
'Bases': 'TACCCCAGGG',
'Clip Qual Right': 7,
'Flow Indexes': "1\t2\t3\t3\t3\t3\t6\t8\t8\t8"
})
trimmed = f.getPrimerTrimmedFlowgram(primerseq="TA")
#test primer trimming
self.assertEqual(trimmed.toSeq(), "CCCCAGGG")
self.assertEqual(str(trimmed),
"0.00\t0.00\t4.10\t0.00\t0.00\t1.23\t0.00\t3.10")
for (a, b) in zip(trimmed.flowgram,
[0.0, 0.0, 4.1, 0.0, 0.0, 1.23, 0.0, 3.1]):
self.assertFloatEqual(a, b)
trimmed = f.getPrimerTrimmedFlowgram(primerseq="TACC")
for (a, b) in zip(trimmed.flowgram,
[0.0, 0.0, 2.1, 0.0, 0.0, 1.23, 0.0, 3.1]):
self.assertFloatEqual(a, b)
self.assertEqual(trimmed.toSeq(), "CCAGGG")
self.assertEqual(str(trimmed),
"0.00\t0.00\t2.10\t0.00\t0.00\t1.23\t0.00\t3.10")
# test that primer trimming does not leave ambig flow at begin
trimmed = f.getPrimerTrimmedFlowgram(primerseq="TACCCC")
for (a, b) in zip(trimmed.flowgram, [0.0, 1.23, 0.0, 3.1]):
self.assertFloatEqual(a, b)
self.assertEqual(trimmed.toSeq(), "AGGG")
self.assertEqual(str(trimmed), "0.00\t1.23\t0.00\t3.10")
# tests on real data
flow1 = self.flows[0]
flow2 = self.flows[1]
flow3 = self.flows[2]
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"GCTAACTGTAA")
self.assertEqual(
str(flow1_trimmed),
"0.00\t0.00\t2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04"
)
self.assertEqual(
flow1_trimmed.Bases,
"CCCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc"
)
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"GCTAACTGTAAC")
self.assertEqual(
str(flow1_trimmed),
"0.00\t0.00\t1.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04"
)
self.assertEqual(
flow1_trimmed.Bases,
"CCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc"
)
#test that trimming does not leave 4 zero flows (homopolymer)
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"GCTAACTGTAACCC")
self.assertEqual(
str(flow1_trimmed),
"0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04"
)
self.assertEqual(
flow1_trimmed.Bases,
"TCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc"
)
#test that trimming does not leave 4 zero flows (signal <1.5)
flow1_trimmed = flow1.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"GCTAACTGTAACCCTC")
self.assertEqual(
str(flow1_trimmed),
"1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04"
)
self.assertEqual(
flow1_trimmed.Bases,
"TTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc"
)
flow1_untrimmed = flow1.getPrimerTrimmedFlowgram("")
self.assertEqual(
str(flow1_untrimmed),
"1.06 0.08 1.04 0.08 0.05 0.94 0.10 2.01 0.10 0.07 0.96 0.09 1.04 1.96 1.07 0.10 1.01 0.13 0.08 1.01 1.06 1.83 2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04"
)
self.assertEqual(
flow1_untrimmed.Bases,
"tcagGCTAACTGTAACCCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc"
)
flow2_trimmed = flow2.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"AGACGCACT")
self.assertEqual(
str(flow2_trimmed),
"0.00\t0.05\t0.90 0.11 0.07 1.99 0.11 0.02 1.96 1.04 0.13 0.01 2.83 0.10 1.97 0.06 0.11 1.04 0.13 0.03 0.98 1.15 0.07 1.00 0.07 0.08 0.98 0.11 1.92 0.05 0.04 2.96 1.02 1.02 0.04 0.93 1.00 0.13 0.04 1.00 1.03 0.08 0.97 0.13 0.11 1.88 0.09 0.05 1.02 1.89 0.07 0.11 0.98 0.05 0.07 1.01 0.08 0.05 1.01 0.13 1.00 0.07 0.10 1.04 0.10 0.04 0.98 0.12 1.03 0.96 0.11 0.07 1.00 0.09 0.03 1.03 0.11 1.95 1.06 0.13 0.05 1.00 0.13 0.11 1.00 0.09 0.03 2.89 0.08 0.95 0.09 1.03 1.02 1.05 1.07 0.08 0.12 2.81 0.08 0.08 1.00 1.07 0.07 0.05 1.86 0.12 0.98 0.06 2.00 0.11 1.02 0.11 0.08 1.88 0.13 1.03 0.13 0.98 0.15 0.11 1.03 1.03 1.04 0.18 0.98 0.13 0.15 1.04 0.11 1.01 0.13 0.06 1.01 0.06 1.02 0.08 0.99 0.14 0.99 0.09 0.05 1.09 0.04 0.07 2.96 0.09 2.03 0.13 2.96 1.13 0.08 1.03 0.07 0.99 0.11 0.05 1.05 1.04 0.09 0.07 1.00 1.03 0.09 0.06 1.06 1.04 2.94 0.18 0.06 0.93 0.10 1.10 0.11 2.02 0.17 1.00 1.03 0.06 0.11 0.96 0.04 3.00 0.11 0.07 1.99 0.10 2.03 0.12 0.97 0.16 0.01 2.09 0.14 1.04 0.16 0.06 1.03 0.14 1.12 0.12 0.05 0.96 1.01 0.10 0.14 0.94 0.03 0.12 1.10 0.92 0.09 1.10 1.04 1.02 0.12 0.97 2.00 0.15 1.08 0.04 1.03 1.04 0.03 0.09 5.16 1.02 0.09 0.13 2.66 0.09 0.05 1.06 0.07 0.89 0.05 0.12 1.10 0.16 0.06 1.01 0.13 1.00 0.14 0.98 0.09 2.92 1.28 0.03 2.95 0.98 0.16 0.08 0.95 0.96 1.09 0.08 1.07 1.01 0.16 0.06 4.52 0.12 1.03 0.07 0.09 1.03 0.14 0.03 1.01 1.99 1.05 0.14 1.03 0.13 0.03 1.10 0.10 0.96 0.11 0.99 0.12 0.05 0.94 2.83 0.14 0.12 0.96 0.00 1.00 0.11 0.14 1.98 0.08 0.11 1.04 0.01 0.11 2.03 0.15 2.05 0.10 0.03 0.93 0.01 0.08 0.12 0.00 0.16 0.05 0.07 0.08 0.11 0.07 0.05 0.04 0.10 0.05 0.05 0.03 0.07 0.03 0.04 0.04 0.06 0.03 0.05 0.04 0.09 0.03 0.08 0.03 0.07 0.02 0.05 0.02 0.06 0.01 0.05 0.04 0.06 0.02 0.04 0.04 0.04 0.03 0.03 0.06 0.06 0.03 0.02 0.02 0.08 0.03 0.01 0.01 0.06 0.03 0.01 0.03 0.04 0.02 0.00 0.02 0.05 0.00 0.02 0.02 0.03 0.00 0.02 0.02 0.04 0.01 0.00 0.01 0.05"
)
self.assertEqual(
flow2_trimmed.Bases,
"CAATTATTTCCATAGCTTGGGTAGTGTCAATAATGCTGCTATGAACATGGGAGTACAAATATTCTTCAAGATACTGATCTCATTTCCTTTAGATATATACCCAGAAGTGAAATTCCTGGATCACATAGTAGTTCTATTTTTATTTGATGAGAAACTTTATACTATTTTTCATAActgagcgggctggcaaggc"
)
#trimming at the end of the flow cycle works
flow3_trimmed = flow3.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"ATTAGATACCCNGGTAGG")
self.assertEqual(
str(flow3_trimmed),
"0.05 0.05 2.04 0.10 0.03 1.06 1.05 1.01 0.07 0.09 2.07 1.01 0.93 2.88 1.06 1.95 1.00 0.05 0.05 2.97 0.09 0.00 0.93 1.01 0.06 0.05 0.99 0.09 0.98 1.01 0.03 1.02 1.92 0.07 0.01 1.03 1.01 0.01 0.05 0.96 0.09 0.05 0.98 1.07 0.02 2.02 2.05 0.09 1.87 0.12 2.15 0.05 0.13 0.92 1.05 1.96 3.01 0.13 0.04 1.05 0.96 0.05 0.05 0.95 0.12 0.01 1.00 2.02 0.03 0.03 0.99 1.01 0.05 0.06 0.98 0.13 0.06 0.97 0.11 1.01 0.08 0.12 1.02 0.12 1.02 2.19 1.03 1.01 0.08 0.11 0.96 0.09 0.08 1.01 0.08 0.06 2.10 2.11 0.12 1.04 0.13 0.09 0.94 1.03 0.08 0.05 3.06 0.12 1.00 0.03 0.09 0.95 0.10 0.03 2.09 0.21 0.99 0.06 0.11 4.06 0.10 1.04 0.04 1.05 1.05 1.04 1.02 0.97 0.13 0.93 0.10 0.12 1.08 0.12 0.99 1.06 0.10 0.11 0.98 0.10 0.02 2.01 0.10 1.01 0.09 0.96 0.07 0.11 2.03 4.12 1.05 0.08 1.01 0.04 0.98 0.14 0.12 2.96 0.13 1.98 0.12 2.08 0.10 0.12 1.99 0.13 0.07 0.98 0.03 0.93 0.86 4.10 0.13 0.10 3.99 1.13 0.07 0.06 1.07 0.09 0.05 1.03 1.12 0.13 0.05 2.01 0.08 0.80 0.05 0.11 0.98 0.13 0.04 1.01 0.07 1.02 0.07 0.11 1.07 2.19 0.06 0.97 0.11 1.03 0.05 0.11 1.05 0.14 0.06 1.03 0.13 0.10 0.97 0.16 0.13 1.00 0.13 0.06 1.02 2.15 0.02 0.16 0.95 0.09 2.06 2.12 0.07 0.07 2.08 0.12 0.97 1.00 0.03 0.99 1.02 1.01 0.03 0.15 0.90 0.07 0.01 2.00 1.01 1.00 0.06 0.11 1.08 1.00 0.03 1.99 0.03 1.00 0.02 1.85 1.93 0.14 1.97 0.91 1.83 0.06 0.04 1.97 0.05 2.08 0.04 0.06 1.05 0.05 2.13 0.16 0.09 1.17 0.01 1.01 1.07 0.09 0.14 0.91 0.06 0.08 1.03 1.04 0.08 0.05 1.05 1.03 1.16 0.06 0.05 1.01 0.06 2.15 0.06 1.99 0.13 0.04 1.08 0.97 0.11 0.07 1.05 0.08 0.07 2.13 0.14 0.09 1.10 0.15 0.00 1.02 0.07 1.05 0.05 0.95 0.09 1.00 0.15 0.95 0.08 0.15 1.11 0.07 0.12 1.05 1.06 0.09 1.03 0.07 0.11 1.01 0.05 0.05 1.05 0.98 0.00 0.93 0.08 0.12 1.85 1.11 0.10 0.07 1.00 0.01 0.10 1.87 0.05 2.14 1.10 0.03 1.06 0.10 0.91 0.10 0.06 1.05 1.02 1.02 0.07 0.06 0.98 0.95 1.09 0.06 0.14 0.97 0.04 2.44"
)
self.assertEqual(
flow3_trimmed.Bases,
"CCACGCCGTAAACGGTGGGCGCTAGTTGTGCGAACCTTCCACGGTTTGTGCGGCGCAGCTAACGCATTAAGCGCCCTGCCTGGGGAGTACGATCGCAAGATTAAAACTCAAAGGAATTGACGGGGCCCCGCACAAGCAGCGGAGCATGCGGCTTAATTCGACGCAACGCGAAGAACCTTACCAAGGCTTGACATATACAGGAATATGGCAGAGATGTCATAGCCGCAAGGTCTGTATACAGG"
)
flow3_trimmed = flow3.getPrimerTrimmedFlowgram(primerseq="TCAG" +
"ATTAGATACCCNGGTAG")
self.assertEqual(
str(flow3_trimmed),
"0.00\t0.00\t0.00 1.10 0.05 0.05 2.04 0.10 0.03 1.06 1.05 1.01 0.07 0.09 2.07 1.01 0.93 2.88 1.06 1.95 1.00 0.05 0.05 2.97 0.09 0.00 0.93 1.01 0.06 0.05 0.99 0.09 0.98 1.01 0.03 1.02 1.92 0.07 0.01 1.03 1.01 0.01 0.05 0.96 0.09 0.05 0.98 1.07 0.02 2.02 2.05 0.09 1.87 0.12 2.15 0.05 0.13 0.92 1.05 1.96 3.01 0.13 0.04 1.05 0.96 0.05 0.05 0.95 0.12 0.01 1.00 2.02 0.03 0.03 0.99 1.01 0.05 0.06 0.98 0.13 0.06 0.97 0.11 1.01 0.08 0.12 1.02 0.12 1.02 2.19 1.03 1.01 0.08 0.11 0.96 0.09 0.08 1.01 0.08 0.06 2.10 2.11 0.12 1.04 0.13 0.09 0.94 1.03 0.08 0.05 3.06 0.12 1.00 0.03 0.09 0.95 0.10 0.03 2.09 0.21 0.99 0.06 0.11 4.06 0.10 1.04 0.04 1.05 1.05 1.04 1.02 0.97 0.13 0.93 0.10 0.12 1.08 0.12 0.99 1.06 0.10 0.11 0.98 0.10 0.02 2.01 0.10 1.01 0.09 0.96 0.07 0.11 2.03 4.12 1.05 0.08 1.01 0.04 0.98 0.14 0.12 2.96 0.13 1.98 0.12 2.08 0.10 0.12 1.99 0.13 0.07 0.98 0.03 0.93 0.86 4.10 0.13 0.10 3.99 1.13 0.07 0.06 1.07 0.09 0.05 1.03 1.12 0.13 0.05 2.01 0.08 0.80 0.05 0.11 0.98 0.13 0.04 1.01 0.07 1.02 0.07 0.11 1.07 2.19 0.06 0.97 0.11 1.03 0.05 0.11 1.05 0.14 0.06 1.03 0.13 0.10 0.97 0.16 0.13 1.00 0.13 0.06 1.02 2.15 0.02 0.16 0.95 0.09 2.06 2.12 0.07 0.07 2.08 0.12 0.97 1.00 0.03 0.99 1.02 1.01 0.03 0.15 0.90 0.07 0.01 2.00 1.01 1.00 0.06 0.11 1.08 1.00 0.03 1.99 0.03 1.00 0.02 1.85 1.93 0.14 1.97 0.91 1.83 0.06 0.04 1.97 0.05 2.08 0.04 0.06 1.05 0.05 2.13 0.16 0.09 1.17 0.01 1.01 1.07 0.09 0.14 0.91 0.06 0.08 1.03 1.04 0.08 0.05 1.05 1.03 1.16 0.06 0.05 1.01 0.06 2.15 0.06 1.99 0.13 0.04 1.08 0.97 0.11 0.07 1.05 0.08 0.07 2.13 0.14 0.09 1.10 0.15 0.00 1.02 0.07 1.05 0.05 0.95 0.09 1.00 0.15 0.95 0.08 0.15 1.11 0.07 0.12 1.05 1.06 0.09 1.03 0.07 0.11 1.01 0.05 0.05 1.05 0.98 0.00 0.93 0.08 0.12 1.85 1.11 0.10 0.07 1.00 0.01 0.10 1.87 0.05 2.14 1.10 0.03 1.06 0.10 0.91 0.10 0.06 1.05 1.02 1.02 0.07 0.06 0.98 0.95 1.09 0.06 0.14 0.97 0.04 2.44"
)
self.assertEqual(
flow3_trimmed.Bases,
"GCCACGCCGTAAACGGTGGGCGCTAGTTGTGCGAACCTTCCACGGTTTGTGCGGCGCAGCTAACGCATTAAGCGCCCTGCCTGGGGAGTACGATCGCAAGATTAAAACTCAAAGGAATTGACGGGGCCCCGCACAAGCAGCGGAGCATGCGGCTTAATTCGACGCAACGCGAAGAACCTTACCAAGGCTTGACATATACAGGAATATGGCAGAGATGTCATAGCCGCAAGGTCTGTATACAGG"
)
def setUp(self):
"""Define some standard data"""
self.rec = """Common Header:
Magic Number: 0x2E736666
Version: 0001
Index Offset: 96099976
Index Length: 1158685
# of Reads: 57902
Header Length: 440
Key Length: 4
# of Flows: 400
Flowgram Code: 1
Flow Chars: TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG
Key Sequence: TCAG
>FIQU8OX05GCVRO
Run Prefix: R_2008_10_15_16_11_02_
Region #: 5
XY Location: 2489_3906
Run Name: R_2008_10_15_16_11_02_FLX04070166_adminrig_1548jinnescurtisstanford
Analysis Name: /data/2008_10_15/R_2008_10_15_16_11_02_FLX04070166_adminrig_1548jinnescurtisstanford/D_2008_10_15_15_12_26_FLX04070166_1548jinnescurtisstanford_FullAnalysis
Full Path: /data/2008_10_15/R_2008_10_15_16_11_02_FLX04070166_adminrig_1548jinnescurtisstanford/D_2008_10_15_15_12_26_FLX04070166_1548jinnescurtisstanford_FullAnalysis
Read Header Len: 32
Name Length: 14
# of Bases: 104
Clip Qual Left: 5
Clip Qual Right: 85
Clip Adap Left: 0
Clip Adap Right: 0
Flowgram: 1.06 0.08 1.04 0.08 0.05 0.94 0.10 2.01 0.10 0.07 0.96 0.09 1.04 1.96 1.07 0.10 1.01 0.13 0.08 1.01 1.06 1.83 2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04
Flow Indexes: 1 3 6 8 8 11 13 14 14 15 17 20 21 22 22 23 23 23 25 27 29 29 32 32 35 38 39 39 39 42 43 45 46 46 46 47 48 51 51 54 54 57 59 61 61 64 67 69 72 72 74 76 77 80 81 81 81 82 83 83 86 88 88 91 94 95 95 95 98 100 103 106 106 109 112 113 116 118 118 121 122 124 125 127 130 131 133 136 138 140 143 144 144 144 147 149 152 152 155 158 158 160 160 163
Bases: tcagGCTAACTGTAACCCTCTTGGCACCCACTAAACGCCAATCTTGCTGGAGTGTTTACCAGGCACCCAGCAATGTGAATAGTCActgagcgggctggcaaggc
Quality Scores: 37 37 37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 37 37 37 37 37 39 39 39 39 24 24 24 37 34 28 24 24 24 28 34 39 39 39 39 39 39 39 39 39 39 39 39 40 40 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37
>FIQU8OX05F8ILF
Run Prefix: R_2008_10_15_16_11_02_
Region #: 5
XY Location: 2440_0913
Run Name: R_2008_10_15_16_11_02_FLX04070166_adminrig_1548jinnescurtisstanford
Analysis Name: /data/2008_10_15/R_2008_10_15_16_11_02_FLX04070166_adminrig_1548jinnescurtisstanford/D_2008_10_15_15_12_26_FLX04070166_1548jinnescurtisstanford_FullAnalysis
Full Path: /data/2008_10_15/R_2008_10_15_16_11_02_FLX04070166_adminrig_1548jinnescurtisstanford/D_2008_10_15_15_12_26_FLX04070166_1548jinnescurtisstanford_FullAnalysis
Read Header Len: 32
Name Length: 14
# of Bases: 206
Clip Qual Left: 5
Clip Qual Right: 187
Clip Adap Left: 0
Clip Adap Right: 0
Flowgram: 1.04 0.00 1.01 0.00 0.00 1.00 0.00 1.00 0.00 1.05 0.00 0.91 0.10 1.07 0.95 1.01 0.00 0.06 0.93 0.02 0.03 1.06 1.18 0.09 1.00 0.05 0.90 0.11 0.07 1.99 0.11 0.02 1.96 1.04 0.13 0.01 2.83 0.10 1.97 0.06 0.11 1.04 0.13 0.03 0.98 1.15 0.07 1.00 0.07 0.08 0.98 0.11 1.92 0.05 0.04 2.96 1.02 1.02 0.04 0.93 1.00 0.13 0.04 1.00 1.03 0.08 0.97 0.13 0.11 1.88 0.09 0.05 1.02 1.89 0.07 0.11 0.98 0.05 0.07 1.01 0.08 0.05 1.01 0.13 1.00 0.07 0.10 1.04 0.10 0.04 0.98 0.12 1.03 0.96 0.11 0.07 1.00 0.09 0.03 1.03 0.11 1.95 1.06 0.13 0.05 1.00 0.13 0.11 1.00 0.09 0.03 2.89 0.08 0.95 0.09 1.03 1.02 1.05 1.07 0.08 0.12 2.81 0.08 0.08 1.00 1.07 0.07 0.05 1.86 0.12 0.98 0.06 2.00 0.11 1.02 0.11 0.08 1.88 0.13 1.03 0.13 0.98 0.15 0.11 1.03 1.03 1.04 0.18 0.98 0.13 0.15 1.04 0.11 1.01 0.13 0.06 1.01 0.06 1.02 0.08 0.99 0.14 0.99 0.09 0.05 1.09 0.04 0.07 2.96 0.09 2.03 0.13 2.96 1.13 0.08 1.03 0.07 0.99 0.11 0.05 1.05 1.04 0.09 0.07 1.00 1.03 0.09 0.06 1.06 1.04 2.94 0.18 0.06 0.93 0.10 1.10 0.11 2.02 0.17 1.00 1.03 0.06 0.11 0.96 0.04 3.00 0.11 0.07 1.99 0.10 2.03 0.12 0.97 0.16 0.01 2.09 0.14 1.04 0.16 0.06 1.03 0.14 1.12 0.12 0.05 0.96 1.01 0.10 0.14 0.94 0.03 0.12 1.10 0.92 0.09 1.10 1.04 1.02 0.12 0.97 2.00 0.15 1.08 0.04 1.03 1.04 0.03 0.09 5.16 1.02 0.09 0.13 2.66 0.09 0.05 1.06 0.07 0.89 0.05 0.12 1.10 0.16 0.06 1.01 0.13 1.00 0.14 0.98 0.09 2.92 1.28 0.03 2.95 0.98 0.16 0.08 0.95 0.96 1.09 0.08 1.07 1.01 0.16 0.06 4.52 0.12 1.03 0.07 0.09 1.03 0.14 0.03 1.01 1.99 1.05 0.14 1.03 0.13 0.03 1.10 0.10 0.96 0.11 0.99 0.12 0.05 0.94 2.83 0.14 0.12 0.96 0.00 1.00 0.11 0.14 1.98 0.08 0.11 1.04 0.01 0.11 2.03 0.15 2.05 0.10 0.03 0.93 0.01 0.08 0.12 0.00 0.16 0.05 0.07 0.08 0.11 0.07 0.05 0.04 0.10 0.05 0.05 0.03 0.07 0.03 0.04 0.04 0.06 0.03 0.05 0.04 0.09 0.03 0.08 0.03 0.07 0.02 0.05 0.02 0.06 0.01 0.05 0.04 0.06 0.02 0.04 0.04 0.04 0.03 0.03 0.06 0.06 0.03 0.02 0.02 0.08 0.03 0.01 0.01 0.06 0.03 0.01 0.03 0.04 0.02 0.00 0.02 0.05 0.00 0.02 0.02 0.03 0.00 0.02 0.02 0.04 0.01 0.00 0.01 0.05
Flow Indexes: 1 3 6 8 10 12 14 15 16 19 22 23 25 27 30 30 33 33 34 37 37 37 39 39 42 45 46 48 51 53 53 56 56 56 57 58 60 61 64 65 67 70 70 73 74 74 77 80 83 85 88 91 93 94 97 100 102 102 103 106 109 112 112 112 114 116 117 118 119 122 122 122 125 126 129 129 131 133 133 135 138 138 140 142 145 146 147 149 152 154 157 159 161 163 166 169 169 169 171 171 173 173 173 174 176 178 181 182 185 186 189 190 191 191 191 194 196 198 198 200 201 204 206 206 206 209 209 211 211 213 216 216 218 221 223 226 227 230 233 234 236 237 238 240 241 241 243 245 246 249 249 249 249 249 250 253 253 253 256 258 261 264 266 268 270 270 270 271 273 273 273 274 277 278 279 281 282 285 285 285 285 285 287 290 293 294 294 295 297 300 302 304 307 308 308 308 311 313 316 316 319 322 322 324 324 327
Bases: tcagAGACGCACTCAATTATTTCCATAGCTTGGGTAGTGTCAATAATGCTGCTATGAACATGGGAGTACAAATATTCTTCAAGATACTGATCTCATTTCCTTTAGATATATACCCAGAAGTGAAATTCCTGGATCACATAGTAGTTCTATTTTTATTTGATGAGAAACTTTATACTATTTTTCATAActgagcgggctggcaaggc
Quality Scores: 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 38 38 38 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 34 34 34 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 36 36 38 25 25 25 38 37 37 37 37 37 37 33 33 34 37 37 37 37 37 37 37 38 34 20 20 26 26 20 34 38 37 37 37 37 37 37 37 37 37 38 38 38 37 37 37 37 37 37 37 37 37 37
""".split('\n')
self.flow = """1.06 0.08 1.04 0.08 0.05 0.94 0.10 2.01 0.10 0.07 0.96 0.09 1.04 1.96 1.07 0.10 1.01 0.13 0.08 1.01 1.06 1.83 2.89 0.18 0.96 0.13 0.99 0.11 1.94 0.12 0.13 1.92 0.21 0.07 0.94 0.17 0.03 0.97 2.76 0.15 0.05 1.02 1.14 0.10 0.98 2.54 1.13 0.96 0.15 0.21 1.90 0.16 0.07 1.78 0.22 0.07 0.93 0.22 0.97 0.08 2.02 0.15 0.19 1.02 0.19 0.09 1.02 0.17 0.99 0.09 0.18 1.84 0.16 0.91 0.10 1.10 1.00 0.20 0.09 1.11 3.01 1.07 1.98 0.14 0.22 1.09 0.17 1.99 0.15 0.20 0.92 0.17 0.07 1.01 2.96 0.15 0.07 1.06 0.20 1.00 0.10 0.12 1.00 0.15 0.08 1.90 0.19 0.10 0.99 0.18 0.09 0.99 1.08 0.15 0.07 1.06 0.14 1.84 0.13 0.11 0.95 1.05 0.13 1.04 1.10 0.18 0.94 0.14 0.10 0.97 1.08 0.12 1.08 0.18 0.08 1.00 0.13 0.98 0.15 0.87 0.13 0.19 1.01 3.06 0.17 0.11 1.04 0.09 1.03 0.10 0.11 2.02 0.16 0.11 1.04 0.04 0.09 1.87 0.13 2.09 0.13 0.10 0.97 0.17 0.08 0.08 0.04 0.12 0.05 0.08 0.07 0.08 0.05 0.07 0.06 0.07 0.03 0.05 0.04 0.09 0.04 0.07 0.04 0.07 0.06 0.03 0.06 0.06 0.06 0.06 0.07 0.09 0.04 0.05 0.08 0.05 0.04 0.09 0.06 0.03 0.02 0.08 0.04 0.06 0.05 0.08 0.03 0.08 0.05 0.05 0.05 0.10 0.05 0.05 0.07 0.06 0.04 0.06 0.05 0.03 0.04 0.05 0.06 0.04 0.04 0.07 0.04 0.04 0.05 0.05 0.04 0.07 0.06 0.05 0.03 0.08 0.05 0.06 0.04 0.06 0.05 0.04 0.04 0.04 0.05 0.06 0.04 0.05 0.04 0.05 0.05 0.06 0.05 0.06 0.04 0.06 0.07 0.06 0.05 0.05 0.05 0.06 0.06 0.04 0.05 0.06 0.03 0.06 0.04 0.06 0.05 0.03 0.06 0.06 0.05 0.06 0.04 0.03 0.06 0.06 0.06 0.03 0.04 0.05 0.05 0.07 0.04 0.05 0.06 0.07 0.07 0.05 0.07 0.06 0.05 0.06 0.05 0.07 0.06 0.05 0.06 0.07 0.05 0.06 0.04 0.06 0.05 0.05 0.06 0.04 0.06 0.04 0.03 0.06 0.05 0.05 0.04 0.05 0.05 0.04 0.04 0.05 0.06 0.06 0.04 0.04 0.05 0.06 0.04 0.04 0.04 0.05 0.05 0.04 0.05 0.05 0.03 0.06 0.06 0.06 0.04 0.07 0.05 0.05 0.04 0.06 0.06 0.05 0.05 0.07 0.04 0.06 0.06 0.06 0.04 0.06 0.03 0.06 0.04 0.06 0.04 0.09 0.05 0.05 0.05 0.07 0.06 0.05 0.05 0.06 0.05 0.05 0.05 0.04 0.04 0.06 0.05 0.05 0.05 0.05 0.04 0.05 0.05 0.06 0.04 0.05 0.05 0.05 0.05 0.05 0.04 0.06 0.04 0.05 0.05 0.04 0.05 0.05 0.05 0.04"""
self.unordered = self.Class({'a':'0.0 1.1 3.0 1.0',
'b':'0.5 1.0 4.0 0.0'})
self.ordered1 = self.Class({'a':'0.0 1.1 3.0 1.0',\
'b':'0.5 1.0 4.0 0.0'}, Names=['a','b'])
self.ordered2 = self.Class({'a':'0.0 1.1 3.0 1.0',\
'b':'0.5 1.0 4.0 0.0'}, Names=['b','a'])
self.one_seq = self.Class({'a':'0.0 1.1 3.0 1.0'})
self.ambiguous = self.Class([Flowgram('0.5 1.0 4.0 0.0 1.5 0.0 0.0 2.0', Name='a',
header_info = {'Bases':'TACCCCTTGG'}),
Flowgram('0.0 0.0 0.0 0.0 2.0 1.0 2.0 2.0', Name = 'b',
header_info = {'Bases':'NTTACCGG'}),
Flowgram('1.5 1.0 2.0 0.0 1.5 0.0 0.0 2.0', Name='c',
header_info = {'Bases':'TTACCTTGG'})],
header_info = {'Flow Chars':'TACG'})
