def test_roundtrip_model_result(self):
"""mode_result.to_json enables roundtrip and lazy evaluation"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
tree = make_tree(tip_names=aln.names)
sm = get_model("HKY85")
lf = sm.make_likelihood_function(tree)
lf.set_alignment(aln)
edge_vals = zip(aln.names, (2, 3, 4))
for edge, val in edge_vals:
lf.set_param_rule("kappa", edge=edge, init=val)
result = model_result(name="test")
result[1] = lf
self.assertIs(result[1], lf)
self.assertEqual(result.nfp, lf.nfp)
self.assertEqual(result.lnL, lf.lnL)
data = result.to_json()
got_obj = deserialise_object(data)
# lazy evaluation means initially, the value is a dict
self.assertIsInstance(got_obj[1], dict)
# and properties match original
self.assertEqual(got_obj.lnL, result.lnL)
self.assertEqual(got_obj.nfp, result.nfp)
self.assertEqual(got_obj.DLC, result.DLC)
# when we ask for the lf attribute, it's no longer a dict
self.assertNotIsInstance(got_obj.lf, dict)
self.assertEqual(got_obj.lf.nfp, got_obj.nfp)
def test_repr(self):
"""does not fail"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
show_progress=False,
opt_args=dict(max_evaluations=1, limit_action="ignore"),
)
result = mod(aln)
self.assertIsInstance(repr(result), str)
# no values set
self.assertIsInstance(repr(model_result(source="blah")), str)
def test_model_result_setitem(self):
"""TypeError if value a likelihood function, or a dict with correct type"""
v = dict(type="arbitrary")
r = model_result(name="one", source="two")
with self.assertRaises(TypeError):
r["name"] = v
with self.assertRaises(TypeError):
r["name"] = 4
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
with self.assertRaises(TypeError):
r["name"] = aln
def test_model_result_invalid_setitem(self):
"""model_result raise TypeError if trying to set incorrect item type"""
mr = model_result()
with self.assertRaises(TypeError):
mr["null"] = 23
def test_repr_str(self):
"""it works even when no values"""
mr = model_result(source="blah")
self.assertIsInstance(repr(mr), str)
