def testFindTwoKozakConsensi(self):
"""
In a given sequence with two Kozak consensuses with different offsets
and qualities, the output should be as expected.
"""
read = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedRead1 = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedRead2 = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedKozakRead1 = DNAKozakRead(expectedRead1, 3, 13, 100.0)
expectedKozakRead2 = DNAKozakRead(expectedRead2, 13, 23, 60.0)
self.assertEqual([expectedKozakRead1, expectedKozakRead2],
list(findKozakConsensus(read)))
def findKozakConsensus(read):
"""
In a given DNA sequence, search for a Kozak consensus: (gcc)gccRccATGG.
The upper case bases in that pattern are required, and the lower case
bases are the ones most frequently found at the given positions. The
initial 'gcc' sequence (in parentheses) is of uncertain significance
and is not taken into account here.
@param read: A C{DNARead} instance to be checked for Kozak consensi.
@return: A generator that yields C{DNAKozakRead} instances.
"""
from dark.reads import DNAKozakRead
readLen = len(read)
if readLen > 9:
offset = 6
readSeq = read.sequence
while offset < readLen - 3:
triplet = readSeq[offset:offset + 3]
if triplet == 'ATG':
if readSeq[offset + 3] == 'G':
if readSeq[offset - 3] in 'GA':
kozakQualityCount = sum((readSeq[offset - 1] == 'C',
readSeq[offset - 2] == 'C',
readSeq[offset - 4] == 'C',
readSeq[offset - 5] == 'C',
readSeq[offset - 6] == 'G'))
kozakQualityPercent = kozakQualityCount / 5.0 * 100
yield DNAKozakRead(read, offset - 6, offset + 4,
kozakQualityPercent)
offset += 1
def testKozakConsensusAtEnd(self):
"""
In a given sequence without a Kozak consensus, the output should be
as expected.
"""
read = DNARead('id', 'AAAAAAATTGCCGCCATGG')
expectedKozakRead = DNAKozakRead(read, 9, 19, 100.0)
(result, ) = list(findKozakConsensus(read))
self.assertEqual(expectedKozakRead, result)
def testOneKozakConsensus(self):
"""
In a given sequence with an exact Kozak consensus sequence, the offset
and quality percentage should be as expected.
"""
read = DNARead('id', 'ATTGCCGCCATGGGGG')
expectedKozakRead = DNAKozakRead(read, 3, 13, 100.0)
(result, ) = list(findKozakConsensus(read))
self.assertEqual(expectedKozakRead, result)