def test_make_fasta_str_04():
"Error: Comment with newlines."
comment = 'Comment\nwith\nnewlines\n.'
seq = 'GATTACA'
with pytest.raises(ValueError):
e3.make_fasta_str(comment, seq)
def test_make_fasta_str_05():
"Error: Sequence with newlines."
comment = 'Comment.'
seq = 'GAT\nTAC\nA\n\n'
with pytest.raises(ValueError):
e3.make_fasta_str(comment, seq)
def test_make_fasta_str_03():
"Error: Long comment."
comment = ('This is a veeeeeeeeeeeery looooooooooooooooooong comment '
'and it will trigger an error in make_fasta_str()!!!!')
seq = 'GATTACA'
with pytest.raises(ValueError):
e3.make_fasta_str(comment, seq)
def test_make_fasta_str_01():
"Standard test."
comment = 'This is a comment'
seq = 'GATTACA'
ref = '>This is a comment\nGATTACA'
res = e3.make_fasta_str(comment, seq)
assert res == ref
def test_make_fasta_str_00():
"Empty strings."
comment = ''
seq = ''
ref = '>'
res = e3.make_fasta_str(comment, seq)
assert res == ref
def make_exons_fasta_str(exons: List[str]) -> str:
"""Translates a list of exon dna sequences into a single fasta string.
- Each exon starts with a comment line like this: >exon
- Each exon is separated by a blank line from other exons.
- The last exon does not have any whitespace nor newlines at the end.
"""
fasta_arr = [e3.make_fasta_str('exon', exon) for exon in exons]
fasta_str = '\n\n'.join(fasta_arr)
res = fasta_str
return res
def test_make_fasta_str_02():
"Long seq."
comment = 'This is a comment'
seq = '''
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGT
CCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTC
AAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTC
'''.replace(' ', '').replace('\n', '')
ref = (
'>This is a comment\n'
'CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGT\n'
'CCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTC\n'
'AAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTC')
res = e3.make_fasta_str(comment, seq)
assert res == ref