def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("xxxatcgxxxatcgxxatcg","atcg",2,20) == "3,10,16"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0 , 4 , 8 , 12 ," assert multi_find("Hello, are you my mummy?", "my", 0, 23) == "15 , 21 ," assert multi_find("This is a sentence", "notinsentence", 0, 18) == " , " assert multi_find("Wibbley wobbly timey wimey stuff", "ey", 0, 32) == "6 , 19 , 25 ,"
def test_multi_find_basic(): """ Test multi_find function. """ #tests whether or not our code actually works assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("Ni! Ni! NI! nI!", "ni", 0, 20) == "0,4,8,12" assert multi_find("Well, I didn't vote for you.", "Concord", 0, 30) == ""
def test_multi_find_basic(): """ Test multi_find function: find multi index of "Ni" in the string with the start of 0 and end of 20. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 100, 200) == "" assert multi_find("How are you today", "Ni", 0, 100) == "" assert multi_find("How are you today", "o", 0, 20) == "1,9,13"
def test_multi_find_basic_not_present(): """ Test multi_find function when substring is not present in input_string, or outside index range. """ assert multi_find("Ni! Ni! Ni! Ni!", "ni", 0, 15) == "" assert multi_find("Who lives in a pineapple under the sea", "spongebob", 0, 38) == "" assert multi_find("Who lives in a pineapple under the sea", "sea", 0, 30) == "" assert multi_find("", "ni", 0, 0) == ""
def test_multi_find_nothing(): assert multi_find("Ni! Ni! Ni! Ni!", "Hi", 0, 20) == "No Match Found" # Test using integers multi_find(4112341156411, 411, 0, 13) == "0,5,10" # Test using special characters multi_find("!@#$ $#@! ^%$! !@*(", "!", 0, 18) == "0,8,13,15"
def test_multi_find_overlap(): """ Test multi_find function. """ assert multi_find("lololololol", "lol", 0, 11) == "0,2,4,6,8" assert multi_find("lololololol", "lol", 3, 10) == "4,6" assert multi_find("aaaaa", "aa", 0, 5) == "0,1,2,3" assert multi_find("aaaaa", "aaa", 0, 5) == "0,1,2" assert multi_find("aaaaa", "aaa", 1, 5) == "1,2"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("Fa la la la la, la la la la", "a", 0, 20) == "1,4,7,10,13,17" assert multi_find("Do Re Mi Fa Sol La Ti", "deer", 0, 20) == "-1"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0 , 4 , 8 , 12 ," assert multi_find("Hello, are you my mummy?", "my", 0, 23) == "15 , 21 ," assert multi_find("This is a sentence", "notinsentence", 0, 18) == " , " assert multi_find("Wibbley wobbly timey wimey stuff", "ey", 0, 32) == "6 , 19 , 25 ,"
def test_multi_find_more(): """ Establish other function to test more scenarios of find_multi """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni!", 2, 19) == "4,8,12" assert multi_find("Ni! nI! ni! NI!", "Ni!", 0, 15) == "0,4,8,12" assert multi_find("Ni!!!!! Ni! Ni! Ni!", "Ni", 0, -1) == "" assert multi_find("Ni ! Ni! Ni! Ni!!", "Ni", 9, -9) == "" assert multi_find("Ni! N!! Ni!Ni!", "Ni", 0, 15) == "0,9,12"
def test_multi_find_invalid_substring(): #Test if the substring is not in the input_string. assert multi_find("Ni! Ni! Ni! Ni!", "Ha", 0, 15) == "" assert multi_find("Halloween", "kee", 0, 9) == "" assert multi_find("Toronto_Pearson_Airport", "go", 0, 31) == "" assert multi_find("loading_message", "lol", 0, 15) == ""
def test_multi_find_basic(): """ Test multi_find function. """ # Test Cases added to check other correct and incorrect input/output assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0, 4, 8, 12" assert multi_find("HI HI HI HI", "HI", 0, 12) == "0, 3, 6, 9" assert multi_find("door door droo door dro", "door", 0, 20) == "0, 5, 15" # Test case shows when substring not found, -1 returned assert multi_find("Helololololololo", "Ni", 0, 20) == -1 assert multi_find("warm warm warm", "cold", 0, 20) == -1
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == [0, 4, 8, 12] assert multi_find("ABCDEFFGABCDEFF", "FF", 3, 15) == [5, 13] assert multi_find("Ni! Ni! Ni! Ni!", "No", 0, 20) == "" try: multi_find(12382938293, "asldasd", 0, 15) except TypeError: assert True
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("Ni! Ni! Ni! Ni!", "i", 0, 20) == "1,5,9,13" assert multi_find("Ni! Ni! Ni! Ni!", "No", 0, 20) == "" assert multi_find("I'm a lumberjack and I'm OK. I'm a lumberjack and I'm OK.", "OK", 0, 57) == "25,54" assert multi_find("I'm a lumberjack and I'm OK. I'm a lumberjack and I'm OK.", "lumber", 0, 57) == "6,35" assert multi_find("I'm a lumberjack and I'm OK. I'm a lumberjack and I'm OK.", "parrot", 0, 57) == "" assert multi_find("It's just a flesh wound", "s", 0, 22) == "3,7,15" assert multi_find("It's just a flesh wound", "flesh", 0, 22) == "12" assert multi_find("It's just a flesh wound", "knight", 0, 22) == ""
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" # If the substring is not found it returns an empty string. assert multi_find("Ni! Ni! Ni! Ni!", "do", 0, 20) == "" # Test case for finding the position of blank spaces. assert multi_find("Ni! Ni! Ni! Ni!", " ", 0, 20) == "3,7,11" # Test case to find special characters in the main string . assert multi_find( "Ni! Ni! Ni! Ni!", "!", 0, 20) == "2,6,10,14" # Test case to find mutiple words. assert multi_find( "HAHAHA! That was so funny", "was so funny", 0, 25) == "13"
def test_multi_find_basic(): """ Test multi_find function. """ # Positive Cases # Basic string with multiple sub-strings assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" # DNA sequence matching, there are 3 ACTG sub-strings assert multi_find("TCGAACTGACTGTCGAACTG", "ACTG", 0, 20) == "4,8,16" # Numbers assert multi_find("01234567890123456789", "456", 0, 20) == "4,14" # Returns all sub-string instances long_string = "This is the first ACTG string. This ACTG string should be returned." assert multi_find(long_string, "ACTG", 0, 66) == "18,36" # Errors # Returns "" when no sub-strings found assert multi_find(pangram, "cat", 0, 44) == "" # Empty entry assert multi_find("", "cat", 0, 0) == "" # 'start' param beyond first index occurrence leads to failure assert multi_find(pangram, "quick", 20, 71) == ""
def test_multi_find_basic(): """ Test multi_find function. """ # Positive Cases # Basic string with multiple sub-strings assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" # DNA sequence matching, there are 3 ACTG sub-strings assert multi_find("TCGAACTGACTGTCGAACTG", "ACTG", 0, 20) == "4,8,16" # Numbers assert multi_find("01234567890123456789", "456", 0, 20) == "4,14" # Returns all sub-string instances long_string = "This is the first ACTG string. This ACTG string should be returned." assert multi_find(long_string, "ACTG", 0, 66) == "18,36" # Errors # Returns "" when no sub-strings found assert multi_find(pangram, "cat", 0, 44) == "" # Empty entry assert multi_find("", "cat", 0, 0) == "" # 'start' param beyond first index occurrence leads to failure assert multi_find(pangram, "quick", 20, 71) == ""
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" # test substring multi search assert multi_find("Testing a string", "g", 0, 15) == "6,15" # test with substring not found assert multi_find("Testing a string again", "x", 0, 20) == "" # test for punctuation character as string # in string with different characters assert multi_find("abc123$!@ abc123$!@ abc123$!@", "!", 0, 30) == "7,17,27" # test for a whitespace (single space) search in string assert multi_find("Testing a string once more", " ", 0, 25) == "7,9,16,21"
def test_advanced_multi_find_basic(): """ Test the multi find function with many different situation """ assert multi_find("ccaccacca", "c", 0, 9) == "0,1,3,4,6,7" # Test when the ending slice is out of range assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 35) == "0,4,8,12" # Test when the substring is identical as input_string assert multi_find("book", "book", 0, 3) == "0" #Test when only ranging the first portion of the input_string assert multi_find("winterwinterwinter", "ter", 0, 5) == "3" #Test when only ranging from the last portion of the input_string assert multi_find("winterwinterwinter", "ter", 12, 17) == "15"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 15) == "0,4,8,12" assert multi_find("Catdogcatdog", "cat", 0, 12) == "6" assert multi_find("Catdogcatdog", "Cat", 0, 12) == "0" assert multi_find("Catdogcatdog", "dog", 0, 12) == "3,9" assert multi_find("aaaaa", "a", 0, 5) == "0,1,2,3,4" assert multi_find("aaaaa", "aaaaa", 0, 5) == "0" assert multi_find("aaaaa", "aaa", 1, 4) == "1"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("How do you do", "do", 0, 20) == "4,11" assert multi_find("456bfd8imbfd2", "fd", 0, 20) == "4,10" assert multi_find("Nice to meet you!", "o", 0, 20) == "6,14" assert multi_find("Nice to meet you!", "o", 20, 30) == "" assert multi_find("where are you going?", "457", 0, 30) == ""
def test_multi_find_additional(): """ Test multi_find function with a variety of arguments. """ # Test with numbers. assert multi_find("012345678989", "89", 0, 12) == "8,10" # Test with letters. assert multi_find("Jennifer", "n", 0, 7) == "2,3" # Test with string having multiple instances of substring. assert multi_find("DuckDuckDuckGoose", "Duck", 0, 16) == "0,4,8" # Test with string having no instances of substring. assert multi_find("Joe", "Z", 0, 2) == "" # Test with string having instances of substring outside of passed index range. assert multi_find("012345555555", "5", 0, 4) == "" # Test with index beyond the length of the string. assert multi_find("01234555", "5", 0, 44) == "5,6,7"
def test_multi_find_additional(): """ Test multi_find function with a variety of arguments. """ # Test with numbers. assert multi_find("012345678989", "89", 0, 12) == "8,10" # Test with letters. assert multi_find("Jennifer", "n", 0, 7) == "2,3" # Test with string having multiple instances of substring. assert multi_find("DuckDuckDuckGoose", "Duck", 0, 16) == "0,4,8" # Test with string having no instances of substring. assert multi_find("Joe", "Z", 0, 2) == "" # Test with string having instances of substring outside of passed index range. assert multi_find("012345555555", "5", 0, 4) == "" # Test with index beyond the length of the string. assert multi_find("01234555", "5", 0, 44) == "5,6,7"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 15) == "0,4,8,12"
def test_num_string(): # Test if the substring will return a string integer. assert multi_find("Address: 22 Street, Apt. 412, Area Code(212)", "2", 0, 44) == "9,10,27,40,42"
def test_not_in_multifind_scope(): assert multi_find(THEME_SONG, "weird", 0, 5) == "" assert multi_find(THEME_SONG, "dimension", 0, 16) == "" assert multi_find("We say Ni! We say Ni! We say Ni! We say Ni! We say Ni!", "Ni!", 0, 7) == ""
def test_not_found_multi_find(): assert multi_find(THEME_SONG, "Star Butterfly", 0, 337) == ""
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("Curly, Larry, Larry, Larry, Mo", "Larry", 0, 30) == "7,14,21"
def test_find_substring_larger_than_input_string(): """ Test multi_find function with an empty substring. """ assert multi_find("parrot", "", 0, 0) == "" assert multi_find("", "", 0, 0) == ""
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12"
def test_multi_find_basic_2(): """ Test multi_find function when substring[s] are not found. """ assert multi_find("Ni! Ni! Ni! Ni!", "ii", 0, 20) == "0"
def test_multi_find_basic(): """ Test multi_find function. """ assert multi_find("Ni! Ni! Ni! Ni!", "Ni", 0, 20) == "0,4,8,12" assert multi_find("Ni! No! No! Ni!", "Ni", 0, 20) == "0,12" assert multi_find("Ni! Ni! Ni! No!", "Ni", 0, 20) == "0,4,8" assert multi_find("Ni! Ni! Ni! Ni!", "Hi", 0, 20) == "" assert multi_find("12! Ni! Ni! 12!", "12", 0, 20) == "0,12" assert multi_find("Ni! Ni! Ni! Ni!", "NI", 0, 20) == "" assert multi_find("Ni! Ni! Ni! Ni!", "ni", 0, 20) == "" assert multi_find("ATCGGGGTGCGCGGGGAT", "GGGG", 0, 23) == "3,12" assert multi_find("ATCGGGGTGCGCGGGGAT", "GGGG", 6, 23) == "12" assert multi_find("ATCGGGGTGCGCGGGGAT", "GGGG", 0, 13) == "3" assert multi_find("ATCGGGGTGCGCGGGGAT", "GGGG", 6, 13) == "" assert multi_find("ATCGGGGTGCGCGGG", "GGGG", 0, 23) == "3"
def test_multi_find_advanced(): """ Test multi_find error function. """ multi_find("Jacob says two two", "too", 0, 20) return -1
def test_multi_find_normal(): assert multi_find(THEME_SONG, "weird", 0, 337) == "24,120,259" assert multi_find(THEME_SONG, "wild", 0, 337) == "48,283"
def test_multi_find_substring_larger_than_input_string(): """ Test multi_find function with a substring length larger than the input string length. """ assert multi_find("parrot", "This is an ex-parrot", 0, 6) == "" assert multi_find("", "parrot", 0, 0) == ""
def test_multi_find_added(): """ Test multi_find function. """ # ============= substring is found ================================================== # end index provided is out of range assert multi_find("Ni! Ni! Ni! Ni!", "Ni!", 1, 25) == "4,8,12" assert multi_find("Happy annnnn", "nn", 0, 25) == "7,8,9,10" # case sensitive assert multi_find("NI! NI! NI! Ni!", "Ni!", 0, 15) == "12" assert multi_find("Happy anNnnn", "nn", 0, 11) == "9" # end or start contain negative numbers, slicing notation does not give empty result assert multi_find("Ni! Ni! Ni! Ni!!", "Ni", 0, -1) == "0,4,8,12" assert multi_find("Ni! Ni! Ni! Ni!!", "Ni", -16, -1) == "0,4,8,12" assert multi_find("Happy annnnn.", "nn", 0, -1) == "7,8,9,10" assert multi_find("Happy annnnn", "n", -4, -3) == "8" # ============ substring is not found ============================================== # slicing notation gives empty result. assert multi_find("Ni! Ni! Ni! Ni!!", "Ni", 9, -7) == "" assert multi_find("Ni! Ni! Ni! Ni!!", "Ni", 0, 1) == "" assert multi_find("Happy annnnn", "nn", -7, 5) == "" assert multi_find("Happy annnnn", "n", -3, -4) == "" # (end - start) is less than the length of substring; Substring not in input_string[start:end]. assert multi_find("Ni! Ni! Ni! Ni!!", "Ni!", 0, 2) == "" assert multi_find("Happy annnnn", "nnn", 7, 9) == "" # word is separated by other notations; word is not wholly found. assert multi_find("N!i N!i N!i N!i!", "Ni", 0, 15) == "" assert multi_find("Happy anniversary Happy anniversary", "ann!", 0, 38) == ""