def test_get_next_from_file(self): '''get_next_from_file() should read seqs from OK, and raise error at badly formatted file''' bad_files = [ 'sequences_test_fail_no_AT.fq', 'sequences_test_fail_no_seq.fq', 'sequences_test_fail_no_plus.fq', 'sequences_test_fail_no_qual.fq' ] bad_files = [os.path.join(data_dir, x) for x in bad_files] for fname in bad_files: f_in = utils.open_file_read(fname) fq = sequences.Fastq() with self.assertRaises(sequences.Error): while fq.get_next_from_file(f_in): pass utils.close(f_in) fname = os.path.join(data_dir, 'sequences_test_good_file.fq') try: f_in = open(fname) except IOError: print("Error opening '" + fname + "'", file=sys.stderr) sys.exit(1) fq = sequences.Fastq() while fq.get_next_from_file(f_in): self.assertEqual(fq, sequences.Fastq('ID', 'ACGTA', 'IIIII')) utils.close(f_in)
def get_assembly_stats(options): f = utils.open_file_read(options.infile) csv_headers = [] stats = {} float_headers = set([ 'Avg Contig Length', 'Average Quality', 'Insert Size Average', 'Insert Size Std Dev' ]) for line in f: if len(csv_headers) == 0: csv_headers = line.rstrip().split('\t')[2:] stats = {k:[] for k in csv_headers} else: data = line.rstrip().split('\t')[2:] assert len(data) == len(csv_headers) == len(stats) for i in range(len(data)): if csv_headers[i] in float_headers: stats[csv_headers[i]].append(float(data[i])) else: stats[csv_headers[i]].append(int(data[i])) utils.close(f) return stats
def extend_gaps(infile, outfile, trim): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: if len(seq) < 2 * trim: continue gaps = seq.gaps() bases = list(seq.seq) # extend the length of each gap for gap in gaps: left_start = max(gap.start - trim, 0) right_end = min(gap.end + trim + 1, len(seq)) for i in range(left_start, gap.start): bases[i] = 'N' for i in range(gap.end, right_end): bases[i] = 'N' seq.seq = ''.join(bases) # trim start/end bases and tidy up any resulting Ns at either end of the trimmed seq seq.trim(trim, trim) seq.trim_Ns() # check that there is some non-N sequence left over regex = re.compile('[^nN]') if regex.search(seq.seq) is not None: print(seq, file=fout) utils.close(fout)
def enumerate_names(infile, outfile, start_index=1, keep_illumina_suffix=False, rename_file=None): seq_reader = sequences.file_reader(infile) fout_seqs = utils.open_file_write(outfile) counter = start_index if keep_illumina_suffix: sequence_suffixes = ['/1', '/2'] else: sequence_suffixes = [] if rename_file is not None: fout_rename = utils.open_file_write(rename_file) print('#old\tnew', file=fout_rename) for seq in seq_reader: old_id = seq.id seq.id = str(counter) for suff in sequence_suffixes: if old_id.endswith(suff): seq.id += suff break if rename_file is not None: print(old_id, seq.id, sep='\t', file=fout_rename) print(seq, file=fout_seqs) counter += 1 utils.close(fout_seqs) if rename_file is not None: utils.close(fout_rename)
def translate(infile, outfile, frame=0): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: print(seq.translate(frame=frame), file=fout) utils.close(fout)
def strip_illumina_suffix(infile, outfile): seq_reader = sequences.file_reader(infile) f_out = utils.open_file_write(outfile) for seq in seq_reader: seq.strip_illumina_suffix() print(seq, file=f_out) utils.close(f_out)
def reverse_complement(infile, outfile): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: seq.revcomp() print(seq, file=fout) utils.close(fout)
def replace_bases(infile, outfile, old, new): seq_reader = sequences.file_reader(infile) f_out = utils.open_file_write(outfile) for seq in seq_reader: seq.replace_bases(old, new) print(seq, file=f_out) utils.close(f_out)
def to_fasta_union(infile, outfile, seqname='union'): seq_reader = sequences.file_reader(infile) new_seq = [] for seq in seq_reader: new_seq.append(seq.seq) f_out = utils.open_file_write(outfile) print(sequences.Fasta(seqname, ''.join(new_seq)), file=f_out) utils.close(f_out)
def search_for_seq(infile, outfile, search_string): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: hits = seq.search(search_string) for hit in hits: print(seq.id, hit[0]+1, hit[1], sep='\t', file=fout) utils.close(fout)
def trim(infile, outfile, start, end): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: seq.trim(start, end) if len(seq): print(seq, file=fout) utils.close(fout)
def trim_Ns_at_end(infile, outfile): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: seq.trim_Ns() if len(seq): print(seq, file=fout) utils.close(fout)
def to_quasr_primers(infile, outfile): seq_reader = sequences.file_reader(infile) f_out = utils.open_file_write(outfile) for seq in seq_reader: seq2 = copy.copy(seq) seq2.revcomp() print(seq.seq, seq2.seq, sep='\t', file=f_out) utils.close(f_out)
def make_long_reads(infile, outfile, method='tiling', fixed_read_length=20000, tile_step=10000, gamma_shape=1.2, gamma_scale=6000, coverage=10, gamma_min_length=20000, seed=None, ins_skip=None, ins_window=None,): assert method in ['tiling', 'gamma', 'uniform'] assert ins_skip == ins_window == None or None not in [ins_skip, ins_window] if seed is not None: random.seed(a=seed) seq_reader = sequences.file_reader(infile) f = utils.open_file_write(outfile) for seq in seq_reader: if method == 'tiling': if len(seq) < fixed_read_length: print('Skipping sequence', seq.id, 'because it is too short at', len(seq), 'bases', file=sys.stderr) continue for i in range(0, len(seq), tile_step): end = min(len(seq), i + fixed_read_length) fa = sequences.Fasta('_'.join([seq.id, str(i + 1), str(end)]), seq[i:end]) if ins_skip: fa.add_insertions(skip=ins_skip, window=ins_window) print(fa, file=f) if end >= len(seq): break elif method == 'gamma': if len(seq) < gamma_min_length: print('Skipping sequence', seq.id, 'because it is too short at', len(seq), 'bases', file=sys.stderr) continue total_read_length = 0 while total_read_length < coverage * len(seq) - 0.5 * gamma_min_length: read_length = int(numpy.random.gamma(gamma_shape, scale=gamma_scale)) while read_length < gamma_min_length or read_length > len(seq): read_length = int(numpy.random.gamma(gamma_shape, scale=gamma_scale)) start = random.randint(0, len(seq) - read_length) end = start + read_length - 1 fa = sequences.Fasta('_'.join([seq.id, str(start + 1), str(end + 1)]), seq[start:end+1]) total_read_length += len(fa) if ins_skip: fa.add_insertions(skip=ins_skip, window=ins_window) print(fa, file=f) elif method == 'uniform': if len(seq) < fixed_read_length: print('Skipping sequence', seq.id, 'because it is too short at', len(seq), 'bases', file=sys.stderr) continue total_read_length = 0 while total_read_length < coverage * len(seq) - 0.5 * fixed_read_length: start = random.randint(0, len(seq) - fixed_read_length) end = start + fixed_read_length - 1 fa = sequences.Fasta('_'.join([seq.id, str(start + 1), str(end + 1)]), seq[start:end+1]) total_read_length += len(fa) if ins_skip: fa.add_insertions(skip=ins_skip, window=ins_window) print(fa, file=f) utils.close(f)
def nucmer_file_reader(fname): f = utils.open_file_read(fname) in_header = True for line in f: if in_header: if line.startswith('['): in_header = False continue yield NucmerHit(line) utils.close(f)
def test_get_next_from_file(self): '''get_next_from_file() should read seqs from OK, including weirdness in file''' f_in = utils.open_file_read(os.path.join(data_dir, 'sequences_test.fa')) fa = sequences.Fasta() counter = 1 while fa.get_next_from_file(f_in): self.assertEqual(fa, sequences.Fasta(str(counter), 'ACGTA')) counter += 1 utils.close(f_in)
def fastaq_to_fake_qual(infile, outfile, q=40): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: print('>' + seq.id, file=fout) if sequences.Fasta.line_length == 0: print(' '.join([str(q)] * len(seq)), file=fout) else: for i in range(0, len(seq), sequences.Fasta.line_length): print(' '.join([str(q)] * min(sequences.Fasta.line_length, len(seq) - i)), file=fout) utils.close(fout)
def fastaq_to_orfs_gff(infile, outfile, min_length=300, tool_name='fastaq'): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: orfs = seq.all_orfs(min_length=min_length) for coords, revcomp in orfs: if revcomp: strand = '-' else: strand = '+' print(seq.id, tool_name, 'CDS', coords.start+1, coords.end+1, '.', strand, '.', sep='\t', file=fout) utils.close(fout)
def test_get_next_from_embl_file(self): f_in = utils.open_file_read( os.path.join(data_dir, 'sequences_test.embl')) embl = sequences.Embl() counter = 1 while embl.get_next_from_file(f_in): self.assertEqual( embl, sequences.Fasta('seq' + str(counter), expected_embl[counter - 1])) counter += 1 utils.close(f_in)
def fastaq_to_mira_xml(infile, outfile): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) print('<?xml version="1.0"?>', '<trace_volume>', sep='\n', file=fout) for seq in seq_reader: print(' <trace>', ' <trace_name>' + seq.id + '</trace_name>', ' <clip_quality_right>' + str(len(seq)) + '</clip_quality_right>', ' <clip_vector_left>1</clip_vector_left>', ' </trace>', sep='\n', file=fout) print('</trace_volume>', file=fout) utils.close(fout)
def fasta_to_fastq(fasta_in, qual_in, outfile): fa_reader = sequences.file_reader(fasta_in) qual_reader = sequences.file_reader(qual_in, read_quals=True) f_out = utils.open_file_write(outfile) for seq in fa_reader: qual = next(qual_reader) if seq.id != qual.id: utils.close(f_out) raise Error('Mismatch in names from fasta and qual file', seq.id, qual.id) qual.seq = [int(x) for x in qual.seq.split()] print(seq.to_Fastq(qual.seq), file=f_out) utils.close(f_out)
def split_by_fixed_size(infile, outfiles_prefix, chunk_size, tolerance, skip_if_all_Ns=False): '''Splits fasta/q file into separate files, with up to (chunk_size + tolerance) bases in each file''' file_count = 1 coords = [] small_sequences = [] # sequences shorter than chunk_size seq_reader = sequences.file_reader(infile) f_coords = utils.open_file_write(outfiles_prefix + '.coords') for seq in seq_reader: if skip_if_all_Ns and seq.is_all_Ns(): continue if len(seq) < chunk_size: small_sequences.append(copy.copy(seq)) elif len(seq) <= chunk_size + tolerance: f = utils.open_file_write(outfiles_prefix + '.' + str(file_count)) print(seq, file=f) utils.close(f) file_count += 1 else: # make list of chunk coords chunks = [(x,x+chunk_size) for x in range(0, len(seq), chunk_size)] if chunks[-1][1] - 1 > len(seq): chunks[-1] = (chunks[-1][0], len(seq)) if len(chunks) > 1 and (chunks[-1][1] - chunks[-1][0]) <= tolerance: chunks[-2] = (chunks[-2][0], chunks[-1][1]) chunks.pop() # write one output file per chunk offset = 0 for chunk in chunks: if not(skip_if_all_Ns and seq.is_all_Ns(start=chunk[0], end=chunk[1]-1)): f = utils.open_file_write(outfiles_prefix + '.' + str(file_count)) chunk_id = seq.id + ':' + str(chunk[0]+1) + '-' + str(chunk[1]) print(sequences.Fasta(chunk_id, seq[chunk[0]:chunk[1]]), file=f) print(chunk_id, seq.id, offset, sep='\t', file=f_coords) utils.close(f) file_count += 1 offset += chunk[1] - chunk[0] # write files of small sequences if len(small_sequences): f = utils.open_file_write(outfiles_prefix + '.' + str(file_count)) file_count += 1 base_count = 0 for seq in small_sequences: if base_count > 0 and base_count + len(seq) > chunk_size + tolerance: utils.close(f) f = utils.open_file_write(outfiles_prefix + '.' + str(file_count)) file_count += 1 base_count = 0 print(seq, file=f) base_count += len(seq) utils.close(f)
def to_fasta(infile, outfile, line_length=60, strip_after_first_whitespace=False): seq_reader = sequences.file_reader(infile) f_out = utils.open_file_write(outfile) original_line_length = sequences.Fasta.line_length sequences.Fasta.line_length = line_length for seq in seq_reader: if strip_after_first_whitespace: seq.strip_after_first_whitespace() if type(seq) == sequences.Fastq: print(sequences.Fasta(seq.id, seq.seq), file=f_out) else: print(seq, file=f_out) utils.close(f_out) sequences.Fasta.line_length = original_line_length
def test_get_next_from_gbk_file(self): f_in = utils.open_file_read( os.path.join(data_dir, 'sequences_test.gbk')) embl = sequences.Embl() counter = 1 expected = [ 'gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattgccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagctctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaatgccatgactcagattctaattttaagctattcaatttctctttgatc', 'gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattgccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagctctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaatgccatgactcagattctaattttaagctattcaatttctctttgaaa' ] while embl.get_next_from_file(f_in): self.assertEqual( embl, sequences.Fasta('NAME' + str(counter), expected[counter - 1])) counter += 1 utils.close(f_in)
def capillary_to_pairs(infile, outprefix): # hash the sequences, only taking longest where an end has been sequenced more than once seq_reader = sequences.file_reader(infile) fwd_seqs = {} rev_seqs = {} unpaired_seqs = {} for seq in seq_reader: id_info = seq.split_capillary_id() if id_info['dir'] == 'fwd': seq.id = id_info['prefix'] + '/1' h = fwd_seqs elif id_info['dir'] == 'rev': seq.id = id_info['prefix'] + '/2' h = rev_seqs else: seq.id = id_info['prefix'] h = unpaired_seqs key = id_info['prefix'] if key not in h or len(h[key]) < len(seq): h[key] = copy.copy(seq) # write the output files f_pe = utils.open_file_write(outprefix + '.paired.gz') f_up = utils.open_file_write(outprefix + '.unpaired.gz') for id in fwd_seqs: if id in rev_seqs: print(fwd_seqs[id], file=f_pe) print(rev_seqs[id], file=f_pe) del rev_seqs[id] else: print(fwd_seqs[id], file=f_up) for seq in rev_seqs.values(): print(seq, file=f_up) for seq in unpaired_seqs.values(): print(seq, file=f_up) utils.close(f_pe) utils.close(f_up)
def scaffolds_to_contigs(infile, outfile, number_contigs=False): '''Makes a file of contigs from scaffolds by splitting at every N. Use number_contigs=True to add .1, .2, etc onto end of each contig, instead of default to append coordinates.''' seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) for seq in seq_reader: contigs = seq.contig_coords() counter = 1 for contig in contigs: if number_contigs: name = seq.id + '.' + str(counter) counter += 1 else: name = '.'.join([seq.id, str(contig.start + 1), str(contig.end + 1)]) print(sequences.Fasta(name, seq[contig.start:contig.end+1]), file=fout) utils.close(fout)
def make_random_contigs(contigs, length, outfile, name_by_letters=False, prefix='', seed=None, first_number=1): '''Makes a multi fasta file of random sequences, all the same length''' random.seed(a=seed) fout = utils.open_file_write(outfile) letters = list('ABCDEFGHIJKLMNOPQRSTUVWXYZ') letters_index = 0 for i in range(contigs): if name_by_letters: name = letters[letters_index] letters_index += 1 if letters_index == len(letters): letters_index = 0 else: name = str(i + first_number) fa = sequences.Fasta(prefix + name, ''.join([random.choice('ACGT') for x in range(length)])) print(fa, file=fout) utils.close(fout)
def get_seqs_flanking_gaps(infile, outfile, left, right): seq_reader = sequences.file_reader(infile) fout = utils.open_file_write(outfile) print('#id', 'gap_start', 'gap_end', 'left_bases', 'right_bases', sep='\t', file=fout) for seq in seq_reader: gaps = seq.gaps() for gap in gaps: left_start = max(gap.start - left, 0) right_end = min(gap.end + right + 1, len(seq)) print(seq.id, gap.start + 1, gap.end + 1, seq.seq[left_start:gap.start], seq.seq[gap.end + 1:right_end], sep='\t', file=fout) utils.close(fout)
def filter(infile, outfile, minlength=0, maxlength=float('inf'), regex=None, ids_file=None, invert=False): ids_from_file = set() if ids_file is not None: f = utils.open_file_read(ids_file) for line in f: ids_from_file.add(line.rstrip()) utils.close(f) seq_reader = sequences.file_reader(infile) f_out = utils.open_file_write(outfile) if regex is not None: r = re.compile(regex) for seq in seq_reader: hit = minlength <= len(seq) <= maxlength \ and (regex is None or r.search(seq.id) is not None) \ and (ids_file is None or seq.id in ids_from_file) if hit != invert: print(seq, file=f_out) utils.close(f_out)
def to_unique_by_id(infile, outfile): seq_reader = sequences.file_reader(infile) seqs = {} ids_in_order = [] # has the reads, keeping the longest one when we get the same # name more than once for seq in seq_reader: if len(seq) == 0: continue if seq.id not in seqs: seqs[seq.id] = copy.copy(seq) ids_in_order.append(seq.id) elif len(seqs[seq.id]) < len(seq): seqs[seq.id] = copy.copy(seq) # write the output f_out = utils.open_file_write(outfile) for id in ids_in_order: print(seqs[id], file=f_out) utils.close(f_out)
def merge_to_one_seq(infile, outfile, seqname='union'): '''Takes a multi fasta or fastq file and writes a new file that contains just one sequence, with the original sequences catted together, preserving their order''' seq_reader = sequences.file_reader(infile) seqs = [] for seq in seq_reader: seqs.append(copy.copy(seq)) new_seq = ''.join([seq.seq for seq in seqs]) if type(seqs[0]) == sequences.Fastq: new_qual = ''.join([seq.qual for seq in seqs]) seqs[:] = [] merged = sequences.Fastq(seqname, new_seq, new_qual) else: merged = sequences.Fasta(seqname, new_seq) seqs[:] = [] f = utils.open_file_write(outfile) print(merged, file=f) utils.close(f)
def interleave(infile_1, infile_2, outfile): seq_reader_1 = sequences.file_reader(infile_1) seq_reader_2 = sequences.file_reader(infile_2) f_out = utils.open_file_write(outfile) for seq_1 in seq_reader_1: try: seq_2 = next(seq_reader_2) except: utils.close(f_out) raise Error('Error getting mate for sequence', seq_1.id, ' ... cannot continue') print(seq_1, file=f_out) print(seq_2, file=f_out) try: seq_2 = next(seq_reader_2) except: seq_2 = None if seq_2 is not None: utils.close(f_out) raise Error('Error getting mate for sequence', seq_2.id, ' ... cannot continue') utils.close(f_out)
def sequence_trim(infile_1, infile_2, outfile_1, outfile_2, to_trim_file, min_length=50): trim_seqs = {} file_to_dict(to_trim_file, trim_seqs) trim_seqs = [x.seq for x in trim_seqs.values()] seq_reader_1 = sequences.file_reader(infile_1) seq_reader_2 = sequences.file_reader(infile_2) f_out_1 = utils.open_file_write(outfile_1) f_out_2 = utils.open_file_write(outfile_2) for seq_1 in seq_reader_1: try: seq_2 = next(seq_reader_2) except: utils.close(f_out) raise Error('Error getting mate for sequence', seq_1.id, ' ... cannot continue') for seq in seq_1, seq_2: for trim_seq in trim_seqs: if seq.seq.startswith(trim_seq): seq.trim(len(trim_seq),0) break if len(seq_1) >= min_length and len(seq_2) >= min_length: print(seq_1, file=f_out_1) print(seq_2, file=f_out_2) utils.close(f_out_1) utils.close(f_out_2)
def test_write_and_read(self): '''open_file_write() and open_file_read() should do the right thing depending gzipped or not''' for filename in ['utils.tmp', 'utils.tmp.gz', 'utils.tmp.bgz']: f = utils.open_file_write(filename) for i in range(3): print(i, file=f) utils.close(f) counter = 0 f = utils.open_file_read(filename) for line in f: self.assertEqual(counter, int(line.strip())) counter += 1 utils.close(f) os.unlink(filename) f = utils.open_file_read('-') self.assertEqual(sys.stdin, f) f = utils.open_file_write('-') self.assertEqual(sys.stdout, f)
def deinterleave(infile, outfile_1, outfile_2, fasta_out=False): seq_reader = sequences.file_reader(infile) f_1 = utils.open_file_write(outfile_1) f_2 = utils.open_file_write(outfile_2) for seq in seq_reader: if fasta_out: print(sequences.Fasta(seq.id, seq.seq), file=f_1) else: print(seq, file=f_1) try: next(seq_reader) except StopIteration: utils.close(f_1) utils.close(f_2) raise Error('Error getting mate for sequence. Cannot continue') if fasta_out: print(sequences.Fasta(seq.id, seq.seq), file=f_2) else: print(seq, file=f_2) utils.close(f_1) utils.close(f_2)