def trinucleotid_runs(data):
"""
Calculates the dropchance based on the chance of trinucleotid microsatellites to mutate. Microsatellites are
repeats of two to six units that have a higher chance to mutate than regular polymers.
The dropchances are additive in this case (@shouldDrop()).
:param data: The DNA sequence to check for microsatellites with length 3.
:return: The dropchance based on the occurence of microsatellites with length 3.
"""
return shouldDrop(
data,
[
("microsatelliteLongerThanX(3,10)", 0.001),
("microsatelliteLongerThanX(3,15)", 0.002),
("microsatelliteLongerThanX(3,20)", 0.003),
("microsatelliteLongerThanX(3,25)", 0.004),
("microsatelliteLongerThanX(3,30)", 0.005),
("microsatelliteLongerThanX(3,35)", 0.006),
("microsatelliteLongerThanX(3,40)", 0.007),
("microsatelliteLongerThanX(3,45)", 0.008),
("microsatelliteLongerThanX(3,50)", 0.009),
("microsatelliteLongerThanX(3,55)", 0.010),
("microsatelliteLongerThanX(3,60)", 0.011),
("microsatelliteLongerThanX(3,65)", 0.012),
("microsatelliteLongerThanX(3,70)", 0.013),
("microsatelliteLongerThanX(3,75)", 0.014),
("microsatelliteLongerThanX(3,80)", 0.015),
("microsatelliteLongerThanX(3,85)", 0.016),
("microsatelliteLongerThanX(3,90)", 0.017),
("microsatelliteLongerThanX(3,95)", 0.018),
("microsatelliteLongerThanX(3,100)", 0.019),
],
)
def ch_at_permutation(data, ch):
"""
Calculates the dropchance based on the number of occurrences of a nucleotide, A and T in this case since their
chance to mutate is generally lower.
These errors are additiv.
:param data: The sequence to check for the number of occurences of a nucleotide.
:param ch: The nucleotide to check for.
:return: The dropchance based on the number of occurences of the given nucleotide.
"""
preamble = "charCountBiggerEqualThanX("
return shouldDrop(
data,
[
(preamble + ch + ",20)", 0.001),
(preamble + ch + ",40)", 0.001),
(preamble + ch + ",60)", 0.001),
(preamble + ch + ",80)", 0.001),
(preamble + ch + ",100)", 0.001),
(preamble + ch + ",120)", 0.001),
(preamble + ch + ",140)", 0.001),
(preamble + ch + ",160)", 0.001),
(preamble + ch + ",180)", 0.001),
(preamble + ch + ",200)", 0.001),
],
)
def random_permutations(data):
"""
Calculates the dropchance for simulated random mutations in the DNA-Data.
:param data: The sequence to simulate random mutations for.
:return: The dropchance based on random mutations.
"""
return shouldDrop(data, [("*", 0.02)])
def illegal_symbols(data):
"""
Checks the DNA data for illegal symbols and returns a dropchance of 1.0 if the sequence contains them.
:param data: The sequence to check for illegal symbols.
:return: The dropchance based on the occurence of illegal symbols (0.0 or 1.0).
"""
res = shouldDrop(data, [("strContainsIllegalChars(ACGT)", 1.0)])
return res
def motif_regex_search(data):
"""
:param data:
:return:
"""
return shouldDrop(
data,
[
# Promoter recognition motif (Euk).
("strContainsSubRegex(CANYYY)", 0.01),
("strContainsSubRegex(ANCCAATCA)", 0.01),
("strContainsSubRegex(KGGGCGGRRY)", 0.01),
("strContainsSubRegex(KRGGCGKRRY)", 0.01),
# Promoter recognition motifs (Prok).
("strContainsSubRegex(AAAWWTWTTTTNNNAAA)", 0.05),
# Ribosomal binding site (Euk).
("strContainsSubRegex(RCCACCATGG)", 0.05),
# Ribosomal binding site (Prok).
("strContainsSubRegex(AGGAGGACAGCTAUG)", 0.05),
# Lox sites.
("strContainsSubRegex(ATAACTTCGTATAGTAYACATTATACGAAGTTAT)",
0.01),
])
def motif_search(data):
"""
:param data:
:return:
"""
return shouldDrop(
data,
[
# Promoter recognition motif (Euk).
("strContainsSub(TATAAA)", 0.01),
# Promoter recognition motifs (Prok).
("strContainsSub(TTGACA)", 0.05),
("strContainsSub(TGTATAATG)", 0.05),
# Polyadenylation signals (Euk).
("strContainsSub(AATAAA)", 0.01),
("strContainsSub(TTGTGTGTTG)", 0.01),
# Lox sites.
("strContainsSub(ATAACTTCGTATAGCATACATTATACGAAGTTAT)", 1.01),
("strContainsSub(ATAACTTCGTATAGCATACATTATACGAACGGTA)", 1.01),
("strContainsSub(TACCGTTCGTATAGCATACATTATACGAAGTTAT)", 1.01),
("strContainsSub(TACCGTTCGTATAGCATACATTATACGAACGGTA)", 1.01),
("strContainsSub(TACCGTTCGTATATGGTATTATATACGAAGTTAT)", 1.01),
("strContainsSub(TACCGTTCGTATATTCTATCTTATACGAAGTTAT)", 1.01),
("strContainsSub(TACCGTTCGTATAGGATACTTTATACGAAGTTAT)", 1.01),
("strContainsSub(TACCGTTCGTATATACTATACTATACGAAGTTAT)", 1.01),
("strContainsSub(TACCGTTCGTATACTATAGCCTATACGAAGTTAT)", 1.01),
("strContainsSub(ATAACTTCGTATATGGTATTATATACGAACGGTA)", 1.01),
("strContainsSub(ATAACTTCGTATAGTATACCTTATACGAAGTTAT)", 1.01),
# Lox site spacers not covered by the Lox sites.
("strContainsSub(AGGTATGC)", 1.01),
("strContainsSub(TTGTATGG)", 1.01),
("strContainsSub(GGATAGTA)", 1.01),
("strContainsSub(GTGTATTT)", 1.01),
("strContainsSub(GGTTACGG)", 1.01),
("strContainsSub(TTTTAGGT)", 1.01),
("strContainsSub(GTACACAT)", 1.01),
# Restriction enzyme recognition motifs.
# BpiI
("strContainsSub(GAAGAC)", 1.01),
# inverse BpiI
("strContainsSub(CTTCTG)", 1.01),
# BsaI
("strContainsSub(GGTCTC)", 1.01),
# inverse BsaI
("strContainsSub(CCAGAG)", 1.01),
("strContainsSub(CGTCTC)", 0.01),
("strContainsSub(GCGATG)", 0.01),
("strContainsSub(GCTCTTC)", 0.01),
# Oligo Adapters.
("strContainsSub(CTCGTAGACTGCGTACCA)", 0.01),
("strContainsSub(GACGATGAGTCCTGAGTA)", 0.01),
# 5' extensions.
("strContainsSub(GGTTCCACGTAAGCTTCC)", 0.01),
("strContainsSub(GCGATTACCCTGTACACC)", 0.01),
("strContainsSub(GCCAGTACATCAATTGCC)", 0.01),
# Twister Adapters:
("strContainsSub(GAAGTGCCATTCCGCCTGACCT)", 1.0
), # Twister 5' Adapter
("strContainsSub(AGGCTAGGTGGAGGCTCAGTG)",
1.0), # Twister 3' Adapter
])