def test_mutation_site(self): mutation1 = "A" pos = 2 snps_in_mind = ["A2G", "A2C", "A2T"] snp_output = RNAsnp.mutation_one_site(mutation1, pos) for snp in snps_in_mind: self.assertIn(snp, snp_output)
def test_mutation_site(self): mutation1 = "A" pos = 2 snps_in_mind = ["A2G", "A2C", "A2T"] snp_output = RNAsnp.mutation_one_site(mutation1, pos) for snp in snps_in_mind: self.assertIn(snp, snp_output)
def test_rebuild_sequence(self): pass #give a sequence seq_given = "ATGTGTGCCCTTGAAACCCC" # here we build fake snp file tmp_file_name = "./fake_snp.rnasnp" tmp_file_with_line = "./snp_line.rnasnp" table_head = "SNP w Slen GC interval d pvalue1 ewin interval d_max pvalue2" describe_line_one = "200 2463 0.5373 1-26 0.0361 0.0943 200 1-53 0.0072 0.4643" snp_line_picked_out = "200 2463 0.5373 1-26 0.0361 0.0943 200 1-53 0.0072 0.0643" p2_less = 0.0643 line_num_pick = 9 with open(tmp_file_name, "w") as snp_faker: snp_faker.write(table_head) snps = [] for index_nt, nt in enumerate(seq_given): snps.extend(RNAsnp.mutation_one_site(nt, index_nt + 1)) snp_faker.write("\n".join(snps)) with open(tmp_file_with_line, "w") as snps_add_line: snps_add_line.write(table_head) snp_lines = [] for snp in snps: if snps.index(snp) == line_num_pick: snp_lines.append("\t".join([snp, snp_line_picked_out])) else: snp_lines.append("\t".join([snp, describe_line_one])) snps_add_line.writelines("\n".join(snp_lines)) # use this file as input for pyRNAsnp.get_snp_list. rebuilded_seq = RNAsnp.rebuild_seq(tmp_file_name) self.assertEqual(seq_given, rebuilded_seq) # test how to pick out a line with less p-value picked_collected = [] with open(tmp_file_with_line, "r") as reader: for line in reader.readlines(): parts = line.split() p2 = float(parts[-1]) if p2 < 0.1: print line picked_collected.append(p2) self.assertIn(p2_less, picked_collected)
def test_rebuild_sequence(self): pass #give a sequence seq_given = "ATGTGTGCCCTTGAAACCCC" # here we build fake snp file tmp_file_name = "./fake_snp.rnasnp" tmp_file_with_line = "./snp_line.rnasnp" table_head = "SNP w Slen GC interval d pvalue1 ewin interval d_max pvalue2" describe_line_one = "200 2463 0.5373 1-26 0.0361 0.0943 200 1-53 0.0072 0.4643" snp_line_picked_out = "200 2463 0.5373 1-26 0.0361 0.0943 200 1-53 0.0072 0.0643" p2_less = 0.0643 line_num_pick = 9 with open(tmp_file_name, "w") as snp_faker: snp_faker.write(table_head) snps = [] for index_nt, nt in enumerate(seq_given): snps.extend(RNAsnp.mutation_one_site(nt, index_nt+1)) snp_faker.write("\n".join(snps)) with open(tmp_file_with_line, "w") as snps_add_line: snps_add_line.write(table_head) snp_lines = [] for snp in snps: if snps.index(snp) == line_num_pick: snp_lines.append("\t".join([snp, snp_line_picked_out])) else: snp_lines.append("\t".join([snp, describe_line_one])) snps_add_line.writelines("\n".join(snp_lines)) # use this file as input for pyRNAsnp.get_snp_list. rebuilded_seq = RNAsnp.rebuild_seq(tmp_file_name) self.assertEqual(seq_given, rebuilded_seq) # test how to pick out a line with less p-value picked_collected = [] with open(tmp_file_with_line, "r") as reader: for line in reader.readlines(): parts = line.split() p2 = float(parts[-1]) if p2 < 0.1: print line picked_collected.append(p2) self.assertIn(p2_less, picked_collected)