def print_hp(s):
e = energy([
Complex(
strands=[Strand(name="hairpin", sequence="GTTCGGGCAAAAGCCCGAAC")],
structure=s)
], o, Complex_Energy)[0]
print(s + ' (%5.2f)' % e)
return e
def print_trajectory(o):
seqstring = ''
for i in range(len(o.full_trajectory)
): # go through each output microstate of the trajectory
time = o.full_trajectory_times[
i] # time at which this microstate is entered
states = o.full_trajectory[
i] # this is a list of the complexes present in this tube microstate
newseqs = []
for state in states:
newseqs += [
state[3]
] # extract the strand sequences in each complex (joined by "+" for multistranded complexes)
newseqstring = ' '.join(
newseqs
) # make a space-separated string of complexes, to represent the whole tube system sequence
if not newseqstring == seqstring:
print newseqstring
seqstring = newseqstring # because strand order can change upon association of dissociation, print it when it changes
structs = []
for state in states:
structs += [
state[4]
] # similarly extract the secondary structures for each complex
tubestruct = ' '.join(
structs
) # give the dot-paren secondary structure for the whole test tube
dG = 0
for state in states:
dG += state[5]
print '%s t=%11.9f seconds, dG=%6.2f kcal/mol' % (tubestruct, time, dG)
# Needlessly verify that the reported trajectory energies are the Tube_Energy values
dGv = 0
for state in states:
cs = state[3].split('+')
st = state[4]
dGv += energy([
Complex(strands=[Strand(sequence=s) for s in cs], structure=st)
], o, Tube_Energy)[0]
if not dGv == dG: print "Energy Mismatch"
o
) # necessary if you want to use energy() without running a simulation first.
# see more about the energy model usage and initialization in threewaybm_trajectories.py
# More meaningful names for argument values to the energy() function call, below.
Loop_Energy = 0 # requesting no dG_assoc or dG_volume terms to be added. So only loop energies remain.
Volume_Energy = 1 # requesting dG_volume but not dG_assoc terms to be added. No clear interpretation for this.
Complex_Energy = 2 # requesting dG_assoc but not dG_volume terms to be added. This is the NUPACK complex microstate energy, sans symmetry terms.
Tube_Energy = 3 # requesting both dG_assoc and dG_volume terms to be added. Summed over complexes, this is the system state energy.
# Sequence is from Schaeffer's PhD thesis, chapter 7, figure 7.1
# Just for illustration, create a hairping strand with just the outermost 4 base pairs of the stem formed:
c = Complex(strands=[Strand(name="hairpin", sequence="GTTCGGGCAAAAGCCCGAAC")],
structure='((((' + 12 * '.' + '))))')
energy([c], o, Complex_Energy) # should be -1.1449...
# Note that energy() takes a *list* of complexes, and returns a tuple of energies. Don't give it just a complex as input, else all hell may break loose.
# Try 'help(energy)' for a little more information.
# Similarly, 'help(initialize_energy_model)' or 'help(Options)' or 'help(Complex)' or 'help(Strand)' .
# But beware that the help docs are not always complete or up-to-date, sorry.
# Using this sequence, find the energy for a particular secondar structure conformation.
def print_hp(s):
e = energy([
Complex(
strands=[Strand(name="hairpin", sequence="GTTCGGGCAAAAGCCCGAAC")],
structure=s)
], o, Complex_Energy)[0]