Example #1
0
def test_ToEol():
    parser = Martel.ToEol("SantaFe").make_parser()
    parseString = parser.parseString
    must_parse("ToEol", parseString, "Testing, 1, 2, 3!\n")
    must_parse("ToEol", parseString, "Andrew\n")
    must_not_parse("ToEol", parseString, "Dalke")
    must_not_parse("ToEol", parseString, "This\nis")
    must_not_parse("ToEol", parseString, "This\nis a test\n")

    file = StringIO.StringIO()
    parser.setContentHandler(saxutils.XMLGenerator(file))
    parser.parseString("This is a test.\n")
    s = file.getvalue()
    expect = "<SantaFe>This is a test.</SantaFe>\n"
    assert string.find(s, expect) != -1, ("Got: %s" % (repr(s), ))
Example #2
0
"""Martel definitions for the output files produced by primer3.
"""
import Martel

any_space = Martel.Re("[ ]+")
blank_line = Martel.AnyEol()

comment_line = Martel.Str("#") + Martel.ToEol()

# comments and blank lines in the file
comments = Martel.Group("comments",
                        blank_line + comment_line + blank_line + comment_line)

#   1 PRODUCT SIZE: 289
product_size = Martel.Group("product_size", Martel.Re("[\d]+"))
start_primer = Martel.Group(
    "start_primer",
    any_space + Martel.Re("[\d]+") + Martel.Str(" PRODUCT SIZE: "))
primer_start_line = Martel.Group("primer_start_line",
                                 start_primer + product_size + Martel.AnyEol())

# a blank line that signifies a new primer is coming up
single_primer_line = Martel.Group("single_primer_line", blank_line)

#      FORWARD PRIMER    1725   20  59.96  55.00  AGGGAAGGGATGCTAGGTGT
primer_space = Martel.Str(" " * 5)

any_integer = Martel.Re("[\d]+")
any_float = Martel.Re("[\d\.]+")
sequence = Martel.Re("[GATCN]+")
Example #3
0
                         RN + \
                         RP + \
                         Martel.Opt(RC_block) + \
                         Martel.Opt(RX) + \
                         RA_block + \
                         Martel.Opt(RT_block) + \
                         RL_block
                         )

############

#--- CC

CC_begin = Martel.Group("CC",
                        Martel.Re("CC   -!- ") + \
                        Martel.ToEol("comment_text"))
CC =       Martel.Group("CC",
                        Martel.Re("CC       ") + \
                        Martel.ToEol("comment_text"))

single_comment = Martel.Group("comment", CC_begin + Martel.Rep(CC))

CC_copyright_begin = Martel.Group("CC_copyright_begin", Martel.Re("CC   -+\R"))
CC_copyright = Martel.Group("CC_copyright",
                            Martel.Re("CC   (?!-+\R)") + \
                            Martel.ToEol("copyright"))
CC_copyright_end = Martel.Group("CC_copyright_end", Martel.Re("CC   -+\R"))

# From N33_HUMAN
bogus_DR_group = Martel.Group("bogus_DR_block",
                       Martel.Re(r"(?P<DR>DR   (?P<database_identifier>MIM); " \
Example #4
0
# Copyright 2001 by Katharine Lindner.  All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license.  Please see the LICENSE file that should have been included
# as part of this package.
"""Martel regular expression for Intelligenetic format (DEPRECATED).

This is a huge regular regular expression for the IntelliGenetics/MASE format,
built using the 'regular expressions on steroids' capabilities of Martel.
"""
#http://immuno.bme.nwu.edu/seqhunt.html

# Martel
import Martel

# --- first set up some helper constants and functions
comment_line = Martel.Group( "comment_line", \
                             Martel.Str( ';' ) +
                             Martel.ToEol( "comment" ) )
comment_lines = Martel.Group("comment_lines", Martel.Rep(comment_line))
title_line = Martel.Group( "title_line", \
    Martel.Expression.Assert( Martel.Str( ';' ), 1 ) +
    Martel.ToEol() )
residue_line = Martel.Group( "residue_line", \
    Martel.Expression.Assert( Martel.Str( ';' ), 1 ) +
    Martel.ToEol( "sequence" ) )
residue_lines = Martel.Group("residue_lines", Martel.Rep1(residue_line))
intelligenetics_record = comment_lines + title_line + residue_lines
"""Martel format for primersearch output files,
"""
import Martel

blank_line = Martel.AnyEol()

# Primer name D1S2660
primer_name = Martel.Group("primer_name", Martel.ToEol())
primer_name_line = Martel.Str("Primer name ") + primer_name

# Amplimer 1
amplifier = Martel.Group("amplifier", Martel.Re("[\d]+"))
amplimer_line = Martel.Str("Amplimer ") + amplifier + Martel.AnyEol()

# Sequence: AC074298 AC074298
# Telomere associated sequence for Arabidopsis thaliana TEL1N
# CCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with 0 mismatches
# TCACATTCCCAAATGTAGATCG hits reverse strand at [114] with 0 mismatches
seq_indent = Martel.Str("\t")

sequence_id = Martel.Group("sequence_id", Martel.ToEol())
sequence_descr = Martel.Group("sequence_descr", Martel.ToEol())
sequence_info = sequence_id + sequence_descr
forward_strand_info = Martel.Group("forward_strand_info", Martel.ToEol())
reverse_strand_info = Martel.Group("reverse_strand_info", Martel.ToEol())
amplifier_sequence = Martel.Group(
    "amplifier_sequence",
    sequence_info + forward_strand_info + reverse_strand_info)
amplifier_sequence_lines = seq_indent + Martel.Str("Sequence: ") + \
                           amplifier_sequence