from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-------|PRACTICE {PRACTICE}, EXERCISE {EXERCISE}|-------") IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) response = c.talk("This is something random.") print("Response : ", response)
from Client0 import Client from pathlib import Path PRACTICE = 2 EXERCISE = 5 print(f'------|PRACTICE {PRACTICE}, EXERCISE {EXERCISE} |--------') IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) print(c.talk('Sending the U5 Gene to the server...')) print(c.talk(Path("./U5.txt").read_text()))
from Client0 import Client print(f"-----| Practice 3, Exercise 7 |------") IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) print("Testing PING...") print(c.talk("PING")) print("Testing GET...") for i in range(5): print(c.talk(f'GET {i}')) seq = c.talk("GET 0") print("Testing INFO...") print(c.talk(f"INFO {seq}")) print("Testing COMP...") print(c.talk(f"COMP {seq}")) print("Testing REV...") print(c.talk(f"REV {seq}")) print("Testing GENE...") for gene in ["U5", "ADA", "FRAT1", "FXN", "RNU6_269P"]: print(f"GENE {gene}") print(c.talk(f"GENE {gene}"))
from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f'------|PRACTICE {PRACTICE}, EXERCISE {EXERCISE} |--------') IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) print('Response: ', c.talk('This is something random'))
from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 2345 c = Client(IP, PORT) FOLDER = "../Session-04/" txt = ".txt" gene = "FRAT1" file_name = FOLDER + gene + txt s0 = Seq('') s0 = str(s0.seq_read_fasta(file_name)) size = 10 num_frag = 5 print(f"Gene {gene}: {s0}") fragments = [] for e in range(num_frag): print(f"fragment {e+1}: {s0[size*e:size*(e+1)]}") fragments.append(s0[size*e:size*(e+1)]) for number in range(0,5): print(c.talk(fragments[number]))
from Seq1 import Seq from Client0 import Client PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") folder = '../Session 4/' gene = 'FRAT1.txt' location = (folder + gene) length = 10 PORT = 8081 IP = '192.168.0.13' c = Client(IP, PORT) print(c) seq = Seq().read_fasta(location) b_string = str(seq) print(f"Gene {gene}: {b_string}") c.talk(f"Gene {gene} win fragment of {length} elements: ") for element in range(5): fragment = b_string[element * length:(element + 1) * length] print(f"Fragment{element+1}: {fragment}") c.talk(f"Fragment{element+1}: {fragment}")
from Client0 import Client from Seq1 import Seq IP = "127.0.0.1" PORT = 8080 FOLDER = "../Session-04/" EXT = ".txt" GENE = "FRAT1" c = Client(IP, PORT) print(c) s = Seq().read_fasta(FOLDER + GENE + EXT) b = str(s) print(f"Gene {GENE}: {b}") length = 10 c.debug_talk(f"Sending {GENE} Gene to the server..., in fragments of {length}") for i in range(5): fragm = b[i * length:(i + 1) * length] print(f"Fragment {i+10}: {fragm}") c.talk(f"Fragment {i+1}: {fragm}")
from Client0 import Client print("-----| Practice 3, Exercise 7 |------") ip = "192.168.1.39" port = 8080 c = Client(ip, port) print(c) command0 = "GET 0" gene0 = c.talk(command0) print("Testing PING...") print(c.talk("PING")) print() print("Testing GET...") for i in range(5): command = f"GET {i}" print(f"{command}: {c.talk(command)}") print() print("Testing INFO...") print(c.talk("INFO" + gene0)) print() print("Testing COMP...") print(c.talk("CONP" + gene0))
from Client0 import Client PRACTICE = 3 EXERCISE = 7 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") PORT = 8080 IP = "127.0.0.1" seq = "" c = Client(IP, PORT) print(c) print("* Testing PING...") print(Client.talk(c, "PING")) print("* Testing GET...") for i in range(0, 5): get = "GET " + str(i) print(get + ":", end=" ") print(Client.talk(c, get)) if i == 0: seq = Client.talk(c, get) print("* Testing INFO...") print(Client.talk(c, "INFO " + seq)) print("* Testing COMP...") print("COMP " + seq, Client.talk(c, "COMP " + seq)) print("* Testing REV...") print("REV " + seq, Client.talk(c, "REV " + seq)) print("* Testing GENE...") print("GENE U5", Client.talk(c, "GENE U5")) print("GENE ADA", Client.talk(c, "GENE ADA"))
from Client0 import Client from pathlib import Path PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 6123 c = Client(IP, PORT) print(c.talk("Sending the U5 Gene to the serever...")) print(c.talk(Path("./P2/U5.txt").read_text()))
from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"---- Practice {PRACTICE}, Exercise {EXERCISE} ----") IP = '127.0.0.1' PORT = 12000 c = Client(IP, PORT) print('Response: ', c.talk('Hello this is random'))
print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters IP = "127.0.0.1" PORT = 8080 # -- Create a client object c = Client(IP, PORT) sequence_test = "ACCTCCTCTCCAGCAATGCCAACCCCAGTCCAGGCCCCCATCCGCCCAGGATCTCGATCA" print("Connection to SERVER at", IP, ", PORT: ", PORT) # TEST PING print("* Testing PING...") print(c.talk("PING")) # TEST GET print("* Testing GET...") print("GET 0:", c.talk("GET 0")) print("GET 1:", c.talk("GET 1")) print("GET 2:", c.talk("GET 2")) print("GET 3:", c.talk("GET 3")) print("GET 4:", c.talk("GET 4")) # TEST INFO print("* Testing INFO...") print(c.talk("INFO " + sequence_test)) # TEST COMP print("* Testing COMP...")
from Client0 import Client PRACTICE = 2 EXERCISE = 4 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = '127.0.0.1' PORT = 6132 c = Client(IP, PORT) print('Response: ', c.talk('Message'))
from Client0 import Client c = Client('127.0.0.1', 8082) print('Testing Ping...') c.talk('PING') print('Testing Get...') for i in range(0, 5): msg = 'GET ' + str(i) c.talk(msg + '"') print('Testing Info...') c.talk('INFO ACTCGATCGAGCTGAGTCATCTAGCATCACAGT"') print('Testing Comp...') c.talk('COMP ACTCGATCGAGCTGAGTCATCTAGCATCACAGT"') print('Testing Rev...') c.talk('REV ACTCGATCGAGCTGAGTCATCTAGCATCACAGT"') print('Testing Gene...') gene_list = ['ADA', 'FRAT1', 'FXN', 'RNU6_269P', 'U5'] for gene in gene_list: msg = 'GENE ' + gene print('"' + msg + '"') c.talk(msg)
from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT0 = 8099 PORT1 = 8098 c0 = Client(IP, PORT0) c1 = Client(IP, PORT1) FOLDER = "../Session-04/" txt = ".txt" gene = "FRAT1" file_name = FOLDER + gene + txt s0 = Seq('') s0 = str(s0.read_fasta(file_name)) len0 = 10 num_frag = 10 print(f"Gene {gene}: {s0}") for e in range(num_frag): print(f"fragment {e+1}: {s0[len0*e:len0*(e+1)]}") if (e + 1) % 2 == 0: c1.talk(f"fragment {e + 1}: {s0[len0*e:len0*(e + 1)]}") else: c0.talk(f"fragment {e+1}: {s0[len0*e:len0*(e+1)]}")
from Client0 import Client IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) print("*Testing PING") print(c.talk("PING")) print() print("*Testing GET") for i in range(5): cmd = f"GET {i}" print("GET", i, ":", c.talk(cmd)) print() print("*Testing INFO") info = c.talk("GET 0") cmd = f"INFO {info}" print(c.talk(cmd)) print() print("*Testing COMP") comp = c.talk("GET 0") cmd = f"COMP {comp}" print(cmd) print(c.talk(cmd)) print()
from Client0 import Client print(f"-----| Practice 2, Exercise 3 |------") IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) # -- Send a message to the server print("Sending a message to the server...") response = c.talk("Testing!!!") print(f"Response: {response}")
from Client0 import Client # -- Parameters of the server to talk to IP = "127.0.0.1" PORT = 8083 # -- Create a client object c = Client(IP, PORT) seq0 = "ACT" print("-----| Practice 3, Exercise 7 |-----") print("Testing PING...") print(c.talk("PING")) print("Testing GET...") print(c.talk("GET 0")) print(c.talk("GET 1")) print(c.talk("GET 2")) print(c.talk("GET 3")) print(c.talk("GET 4")) print("Testing INFO...") print(c.talk(f"INFO {seq0}")) print("Testing COMP...") print(c.talk(f"COMP {seq0}")) print("Testing REV...") print(c.talk(f"REV {seq0}")) print("Testing GENE...")
from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 12100 c = Client(IP, PORT) s = Seq() s.read_fasta("FRAT1") count = 0 i = 0 while i < len(s.strbases) and count < 5: fragment = s.strbases[i:i + 10] count += 1 i += 10 print("Fragment", count, ":", fragment) print(c.talk(fragment))
# Creating fragments of length 10 frag1 = "Fragment 1: " frag2 = "Fragment 2: " frag3 = "Fragment 3: " frag4 = "Fragment 4: " frag5 = "Fragment 5: " fragments = [frag1, frag2, frag3, frag4, frag5] i = 0 f = 0 while f < 5: sequence = str(s) fragments[f] += sequence[i] i += 1 if i % 10 == 0: f += 1 # connect c = Client(IP, PORT) c.talk(fragments[0]) c.talk(fragments[1]) c.talk(fragments[2]) c.talk(fragments[3]) c.talk(fragments[4]) # Print print("Gene FRAT1:", s) for frag in fragments: print(frag)
print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") FOLDER = "../Session-04/" FILENAME = "FRAT1.txt" # -- Parameters of the server to talk to IP = "127.0.0.1" PORT = 8080 # -- Create a client object c = Client(IP, PORT) # -- Print the IP and PORTs print(c) s = Seq().read_fasta(FOLDER + FILENAME) Bases = str(s) print(f"Gene {FILENAME}: {Bases}") length = 10 # Length of fragments c.talk( f"Sending {FILENAME} Gene to the server, in fragments of {length} bases..." ) for i in range(5): fragment = Bases[i * length:(i + 1) * length] print(f"Fragment {i + 1}: {fragment}") c.talk(f"Fragment {i + 1}: {fragment}") # First we have to launch the Teacher's server of Session-08 (server.py). Then execute the EX3.py program.
from Client0 import Client from pathlib import Path PRACTICE = 2 EXERCISE = 4 print(f"----|Practice {PRACTICE}, Exercise {EXERCISE}|----") IP = "192.168.0.241" PORT = 139 c = Client(IP, PORT) print(c.talk("Sending the U5 gene to the server...")) print(c.talk(Path("U5.txt").read_text()))
port2 = 8081 c1 = Client(ip, port1) c2 = Client(ip, port2) print(c1) print(c2) folder = "../Session-04/" file = "FRAT1.txt" seq = Seq().read_fasta(folder + file) print(f"Gene FRAT1: {str(seq)}") length = 10 mes = f"Sending FRAT1 gene to the server in fragments of {length} bases..." c1.talk(mes) c2.talk(mes) print(f"Gene FRAT1: {str(seq)}") for i in range(10): frag = str(seq)[i * length:(i + 1) * length] print(f"Fragment {i + 1}: {frag}") m = f"Fragment {i + 1}: {frag}" if i % 2: c2.talk(m) else: c1.talk(m)
from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 7 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 8081 PORT_2 = 8082 c = Client(IP, PORT) c_2 = Client(IP, PORT_2) s = Seq() s.read_fasta('../Session-04/FRAT1.txt') i = 0 count = 0 while i < len(s.strbases) and count < 10: fragment = s.strbases[i:i + 10] count += 1 i += 10 print('Fragment', count, ':', fragment) if count % 2 == 0: print(c_2.talk('Fragment ' + str(count) + ' : ' + fragment)) else: print(c.talk('Fragment ' + str(count) + ' : ' + fragment))
from Client0 import Client IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) print("Testing PING...") print(c.talk("PING")) print("Testing GET...") for i in range(5): print(c.talk(f"GET {i}")) print("Testing INFO...") print(c.talk("INFO AACCGTA")) print("Testing COMP...") print(c.talk("COMP AACCGTA")) print("Testing REV...") print(c.talk("REV AACCGTA")) print("Testing GENE...") for gene in ["U5", "ADA", "FRAT1", "FXN", "RNU6_269P"]: print(f"GENE {gene}") print(c.talk(f"GENE {gene}"))
# -- CREATING c = Client(IP, PORT) print(c) # -- MESSAGING list1 = ["PING ", "GET ", "INFO ", "COMP ", "REV "] sequence = "ACCTCCTCTCCAGCAATGCCAACCCCAGTCCAGGCCCCCATCCGCCCAGGATCTCGATCA" for element in list1: print(f"*Testing {element}...") if element == "GET ": for i in range(0, 5): number = str(i) response = c.talk(element + number) print(f"GET {i}: {response}") print() else: if element != "PING " and element != "INFO ": print(f"{element} {sequence}") response = c.talk(element + sequence) print(response) print() list2 = ["U5", "ADA", "FRAT1", "FXN", "RNU6_269P"] print(f"*Testing GENE...") a = "GENE " for element in list2: print(a+element) response = c.talk(a+element)
from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 8081 c = Client(IP, PORT) response = c.talk("Message") print("Response:", response)
from Client0 import Client from pathlib import Path PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "192.168.1.54" PORT = 8080 c = Client(IP, PORT) print(c.talk('Sending the U5 gene to the server')) print(c.talk(Path('U5.txt').read_text()))
FOLDER = "../Session-04/" EXT = ".txt" GENE = "FRAT1" filename = FOLDER + GENE + EXT # Create a client object c = Client(IP, PORT) # Print the IP and PORTs print(c) # Read the Gene from a file s = Seq().seq_read_fasta(filename) # get the string bases = str(s) lenght = 10 c.talk(f"Sending {GENE} Gene to the server, in fragments of {lenght} bases...") for i in range(5): # de 10 en 10 fragment = bases[i * 10:(i + 1) * 10] # Print on Client's console print(f"Fragment {i + 1}: {fragment}") # Send the fragment to the server c.talk(f"Fragment {i + 1}: {fragment}")
# -- Create a client object c1 = Client(IP, PORT1) c2 = Client(IP, PORT2) print(c1) print(c2) # -- Import the sequence FOLDER = "../Session-04/" FILENAME = "../Session-04/FRAT1.txt" sequence = seq_read_fasta(FOLDER + FILENAME) # -- Make the sequence into fragments and send it new_seq = sequence[0:50] string = "" number = 1 c1.talk("Sending FRAT1 Gene to the server, in fragments of 10 bases...") c2.talk("Sending FRAT1 Gene to the server, in fragments of 10 bases...") print("Gene FRAT1: " + sequence) # -- Make a list for the fragments frag_list = [] new_seq = sequence[0:100] string = "" for element in new_seq: string = string + element if len(string) == 10: frag_list.append(string) print(string) string = ""