import re, regex
import logging
import GeneaPy.useful as useful
import get_AB1_file
# draw a map or mind map which visually shows how all this works. Perhaps read the OOP book to ensure best practices are adhered to.
# Perhaps have a function within this file which takes much of the actual basecalling out of the get_seq script (lines 187-214). life_saver()
# PLAYING WITH ACTUAL STRING: match_with_seq_file(), check_if_insertion(), check_if_deletion()
# HET CALLS: the rest
file_path = useful.cwd_file_path(__file__)
UIPAC = {"A":"A", "C":"C", "G":"G", "T":"T",
"R":"A/G", "Y":"C/T", "S":"G/C",
"W":"A/T", "K":"G/T", "M":"A/C",
"B":"C/G/T", "D":"A/G/T", "H":"A/C/T",
"V":"A/C/G", "N":"N"}
non_singular_bases = ["Y", "R", "W", "S", "K", "M"]
class CompareSeqs(object):
''' A collection of methods used to compare a reference sequence
with a sanger sequence contained within a .seq file
'''
def __init__(self, upstream, downstream, ref_base=None, alt_answer=None,
mut_type=None, path_to_seq_file=None, seq_dir=None,
from GeneaPy.check_sanger import *
from GeneaPy import useful
import unittest, warnings
test_dir = useful.cwd_file_path(__file__) + "test_files/"
class TestCheckSanger(unittest.TestCase):
def test_get_matching_seq_file(self):
""" Ensure the query matches the expected file in he selected dir
"""
self.assertEqual(
CompareSeqs.get_matching_seq_file("24HC1541-WYN1", test_dir)[0], test_dir + "F07_24HC1541_WYN1_011.ab1"
)
def test_compare_nucleotides(self):
""" Test both conditional outputs of the compare_nucleotides method
"""
self.assertEqual(CompareSeqs.compare_nucleotides("A", "G"), ("the nucleotides given are DIFFERENT", 2))
self.assertEqual(CompareSeqs.compare_nucleotides("C", "C"), ("the nucleotides given are the SAME", 1))
def test_get_start_end_indexes_postseq(self):
""" Test that the preseq returns the expected index numbers
"""
warnings.filterwarnings("ignore")
self.assertEqual(
CompareSeqs.get_start_end_indexes(
"TTCCTCCTTCAAACTTCGCA",
CompareSeqs.handle_seq_file(test_dir + "F01_LX18_SP_UKB2_LX18_F_011.ab1", test_dir),
),
