class Test_Assembly(unittest.TestCase):
def setUp(self):
self.assembly = Assembly('ce6')
self.root = self.assembly.genrep.root
self.intype = 0
"""
Gene Y54E2A.11 (-1 to each Ensembl start by convention)
4 transcripts, Y54E2A.11a.1, Y54E2A.11a.2, Y54E2A.11b.1, Y54E2A.11b.2
5327 5434 5503 5697 5742 6075 6128 6836 6906 8367
a.1.1 |--------| b.2.2 |----| a.1.3 |------| a.1.4 |---------| a.1.5 |------|
b.1.1 |------| b.1.3 |----| b.1.4 |------| a.2.5 |----|
b.2.4 |----| b.2.4 |----|
|========| |====| |======| |=========| |======|
2863 = 107 + 194 + 333 + 708 + 1461
"""
def with_without_genrep(test):
"""Decorator. Runs *test* with genrep.root successively activated (via /db/)
and disabled (via URL to GenRep)."""
@wraps(test) # gives to the wrapper the original function name
def wrapper(self):
root = self.assembly.genrep.root
test(self)
self.assembly.genrep.root = ''
test(self)
self.assembly.genrep.root = root
return wrapper
def test_fasta_from_regions(self):
expected = ({'chrI':['G','C','AAGCCTAAGCCTAAGCCTAA','CTAAGCCTAAGCCTAAGCCT','TTTTTGAAAT']}, 52)
# GenRep request, list form
regions = [('chrI',0,1),('chrI',1,2),('chrI',10,30),('chrI',20,40),('chrI',1010,1020)]
url_seq = self.assembly.fasta_from_regions(regions=regions,out={})
self.assertEqual(url_seq, expected)
# Custom fasta file, dict form
regions = {'chrI':[(0,1),(1,2),(10,30),(20,40),(1010,1020)]}
custom_seq = self.assembly.fasta_from_regions(regions=regions,out={},
path_to_ref=os.path.join(path,"chrI_ce6_30lines.fa"))
self.assertEqual(custom_seq, expected)
# Fasta from cDNA (intype=2)
regions = {'chrI':[(126947,137740)]} # F53G12.5a.1, F53G12.5b, F53G12.4, F53G12.5a.2
#seq = self.assembly.fasta_from_regions(regions=regions,out="test.txt", intype=2)
seq = self.assembly.fasta_from_regions(regions=regions,out={}, intype=2)
self.assertEqual(seq[0]['chrI'][1][:40], "ATGCCAGTCGTGAGCGTTAGACCTTTTTCTATGAGAAATG") # F53G12.5b.1
self.assertEqual(seq[1], 5870)
def test_get_features_from_gtf(self):
expected = {'eif-3.B': [(14795327, 14795434, 1, 'chrII'), (14795331, 14795434, 1, 'chrII'),
(14795333, 14795434, 1, 'chrII'), (14795503, 14795697, 1, 'chrII'),
(14795742, 14795907, 1, 'chrII'), (14795742, 14796075, 1, 'chrII'),
(14796128, 14796836, 1, 'chrII'), (14796213, 14796354, 1, 'chrII'),
(14796213, 14796836, 1, 'chrII'), (14796906, 14797767, 1, 'chrII'),
(14796906, 14798367, 1, 'chrII')]}
h = {'keys':'gene_name', 'values':'start,end,strand',
'conditions':'gene_id:Y54E2A.11,type:exon', 'uniq':'1'}
# Test with local database request
zc = self.assembly.get_features_from_gtf(h, chr='chrII')
self.assertItemsEqual(zc,expected)
# Test with url request via GenRep
self.assembly.genrep.root = ''
zc = self.assembly.get_features_from_gtf(h, chr='chrII')
self.assertItemsEqual(zc['eif-3.B'],expected['eif-3.B'])
self.assembly.genrep.root = self.root
################
# Annot tracks #
################
@with_without_genrep
def test_gene_track(self):
expected = ('chrI',4118,10232,'Y74C9A.3|Y74C9A.3',-1)
track = self.assembly.gene_track()
self.assertEqual(track.next(),expected)
@with_without_genrep
def test_exon_track(self):
expected = ('chrI',4118,4358,'Y74C9A.3.1.5|Y74C9A.3|Y74C9A.3',-1,'.')
track = self.assembly.exon_track()
self.assertEqual(track.next(),expected)
@with_without_genrep
def test_transcript_track(self):
expected = ('chrI',4118,10232,'Y74C9A.3.1|Y74C9A.3',-1)
track = self.assembly.transcript_track()
self.assertEqual(track.next(),expected)
############
# Mappings #
############
@unittest.skip('slow')
@with_without_genrep
def test_get_gene_mapping(self):
expected = ('eif-3.B',14795327,14798367,2803,1,'chrII')
gmap = self.assembly.get_gene_mapping()
g = gmap['Y54E2A.11']
self.assertTupleEqual((g.name,g.start,g.end,g.length,g.strand,g.chrom), expected)
@unittest.skip('slow')
@with_without_genrep
def test_get_transcript_mapping(self):
expected = ('Y54E2A.11',14795327,14798367,2803,1,'chrII')
tmap = self.assembly.get_transcript_mapping()
t = tmap['Y54E2A.11a.1']
self.assertTupleEqual((t.gene_id,t.start,t.end,t.length,t.strand,t.chrom), expected)
@unittest.skip('slow')
@with_without_genrep
def test_get_exon_mapping(self):
expected = (['Y54E2A.11a.1'],'Y54E2A.11','eif-3.B',14795327,14795434,1,'chrII')
emap = self.assembly.get_exon_mapping()
e = emap['Y54E2A.11a.1.1']
self.assertTupleEqual((e.transcripts,e.gene_id,e.gene_name,e.start,e.end,e.strand,e.chrom), expected)
class Test_Assembly(unittest.TestCase):
def setUp(self):
self.assembly = Assembly('ce6')
self.root = self.assembly.genrep.root
self.intype = 0
"""
Gene Y54E2A.11 (-1 to each Ensembl start by convention)
4 transcripts, Y54E2A.11a.1, Y54E2A.11a.2, Y54E2A.11b.1, Y54E2A.11b.2
5327 5434 5503 5697 5742 6075 6128 6836 6906 8367
a.1.1 |--------| b.2.2 |----| a.1.3 |------| a.1.4 |---------| a.1.5 |------|
b.1.1 |------| b.1.3 |----| b.1.4 |------| a.2.5 |----|
b.2.4 |----| b.2.4 |----|
|========| |====| |======| |=========| |======|
2863 = 107 + 194 + 333 + 708 + 1461
"""
def with_without_genrep(test):
"""Decorator. Runs *test* with genrep.root successively activated (via /db/)
and disabled (via URL to GenRep)."""
@wraps(test) # gives to the wrapper the original function name
def wrapper(self):
root = self.assembly.genrep.root
test(self)
self.assembly.genrep.root = ''
test(self)
self.assembly.genrep.root = root
return wrapper
def test_fasta_from_regions(self):
expected = ({
'chrI': [
'G', 'C', 'AAGCCTAAGCCTAAGCCTAA', 'CTAAGCCTAAGCCTAAGCCT',
'TTTTTGAAAT'
]
}, 52)
# GenRep request, list form
regions = [('chrI', 0, 1), ('chrI', 1, 2), ('chrI', 10, 30),
('chrI', 20, 40), ('chrI', 1010, 1020)]
url_seq = self.assembly.fasta_from_regions(regions=regions, out={})
self.assertEqual(url_seq, expected)
# Custom fasta file, dict form
regions = {'chrI': [(0, 1), (1, 2), (10, 30), (20, 40), (1010, 1020)]}
custom_seq = self.assembly.fasta_from_regions(
regions=regions,
out={},
path_to_ref=os.path.join(path, "chrI_ce6_30lines.fa"))
self.assertEqual(custom_seq, expected)
# Fasta from cDNA (intype=2)
regions = {
'chrI': [(126947, 137740)]
} # F53G12.5a.1, F53G12.5b, F53G12.4, F53G12.5a.2
#seq = self.assembly.fasta_from_regions(regions=regions,out="test.txt", intype=2)
seq = self.assembly.fasta_from_regions(regions=regions,
out={},
intype=2)
self.assertEqual(
seq[0]['chrI'][1][:40],
"ATGCCAGTCGTGAGCGTTAGACCTTTTTCTATGAGAAATG") # F53G12.5b.1
self.assertEqual(seq[1], 5870)
def test_get_features_from_gtf(self):
expected = {
'eif-3.B': [(14795327, 14795434, 1, 'chrII'),
(14795331, 14795434, 1, 'chrII'),
(14795333, 14795434, 1, 'chrII'),
(14795503, 14795697, 1, 'chrII'),
(14795742, 14795907, 1, 'chrII'),
(14795742, 14796075, 1, 'chrII'),
(14796128, 14796836, 1, 'chrII'),
(14796213, 14796354, 1, 'chrII'),
(14796213, 14796836, 1, 'chrII'),
(14796906, 14797767, 1, 'chrII'),
(14796906, 14798367, 1, 'chrII')]
}
h = {
'keys': 'gene_name',
'values': 'start,end,strand',
'conditions': 'gene_id:Y54E2A.11,type:exon',
'uniq': '1'
}
# Test with local database request
zc = self.assembly.get_features_from_gtf(h, chr='chrII')
self.assertItemsEqual(zc, expected)
# Test with url request via GenRep
self.assembly.genrep.root = ''
zc = self.assembly.get_features_from_gtf(h, chr='chrII')
self.assertItemsEqual(zc['eif-3.B'], expected['eif-3.B'])
self.assembly.genrep.root = self.root
################
# Annot tracks #
################
@with_without_genrep
def test_gene_track(self):
expected = ('chrI', 4118, 10232, 'Y74C9A.3|Y74C9A.3', -1)
track = self.assembly.gene_track()
self.assertEqual(track.next(), expected)
@with_without_genrep
def test_exon_track(self):
expected = ('chrI', 4118, 4358, 'Y74C9A.3.1.5|Y74C9A.3|Y74C9A.3', -1,
'.')
track = self.assembly.exon_track()
self.assertEqual(track.next(), expected)
@with_without_genrep
def test_transcript_track(self):
expected = ('chrI', 4118, 10232, 'Y74C9A.3.1|Y74C9A.3', -1)
track = self.assembly.transcript_track()
self.assertEqual(track.next(), expected)
############
# Mappings #
############
@unittest.skip('slow')
@with_without_genrep
def test_get_gene_mapping(self):
expected = ('eif-3.B', 14795327, 14798367, 2803, 1, 'chrII')
gmap = self.assembly.get_gene_mapping()
g = gmap['Y54E2A.11']
self.assertTupleEqual(
(g.name, g.start, g.end, g.length, g.strand, g.chrom), expected)
@unittest.skip('slow')
@with_without_genrep
def test_get_transcript_mapping(self):
expected = ('Y54E2A.11', 14795327, 14798367, 2803, 1, 'chrII')
tmap = self.assembly.get_transcript_mapping()
t = tmap['Y54E2A.11a.1']
self.assertTupleEqual(
(t.gene_id, t.start, t.end, t.length, t.strand, t.chrom), expected)
@unittest.skip('slow')
@with_without_genrep
def test_get_exon_mapping(self):
expected = (['Y54E2A.11a.1'], 'Y54E2A.11', 'eif-3.B', 14795327,
14795434, 1, 'chrII')
emap = self.assembly.get_exon_mapping()
e = emap['Y54E2A.11a.1.1']
self.assertTupleEqual((e.transcripts, e.gene_id, e.gene_name, e.start,
e.end, e.strand, e.chrom), expected)
