def main_resps(): in_file = Path("data/resps-perturbed-tides.txt") bibs = parse_citations(in_file) db = BibDatabase() db.entries = [ bib.to_bibtex() for bib in bibs ] id_to_count = defaultdict(lambda : 0) for entry in db.entries: id_to_count[entry["ID"]] += 1 for the_id, count in id_to_count.items(): if count > 1: for entry in [e for e in db.entries if e["ID"] == the_id]: count -= 1 entry["ID"] += ascii_lowercase[count] writer = BibTexWriter() writer.indent = " " with Path("data/resps-tides-perturbed-refs.bib").open("wb") as ref_file: ref_file.write(writer.write(db).encode())
def test_store_organism_publication(self): """Tests - store organism publication.""" test_organism = Organism.objects.create(genus="Mus", species="musculus") db2 = BibDatabase() db2.entries = [ { "journal": "Nice Journal", "comments": "A comment", "pages": "12--23", "month": "jan", "abstract": "This is an abstract. This line should be " "long enough to test multilines...", "title": "An amazing title", "year": "2013", "doi": "10.1186/s12864-016-2535-300002", "volume": "12", "ID": "Teste2018", "author": "Foo, b. and Foo1, b. and Foo b.", "keyword": "keyword1, keyword2", "ENTRYTYPE": "article", } ] for entry in db2.entries: bibtest = PublicationLoader() bibtest.store_bibtex_entry(entry) OrganismLoader().store_organism_publication( organism="Mus musculus", doi="10.1186/s12864-016-2535-300002" ) test_organismpub = OrganismPub.objects.get(organism=test_organism) self.assertEqual("An amazing title", test_organismpub.pub.title)
def entries_to_str(entries): """ Pass a list of bibtexparser entries and return a bibtex formatted string. """ db = BibDatabase() db.entries = entries return bibtexparser.dumps(db)
def work_to_bibtex(work, name=None, acronym=False, rules=None): """Convert work to bibtex text Doctest: .. doctest:: >>> reload() >>> murta2014a = work_by_varname("murta2014a") >>> print(work_to_bibtex(murta2014a)) @inproceedings{murta2014a, address = {Cologne, Germany}, author = {Murta, Leonardo and Braganholo, Vanessa and Chirigati, Fernando and Koop, David and Freire, Juliana}, booktitle = {International Provenance and Annotation Workshop}, pages = {71--83}, publisher = {Springer}, title = {no{W}orkflow: capturing and analyzing provenance of scripts}, year = {2014} } <BLANKLINE> <BLANKLINE> Custom name: >>> reload() >>> murta2014a = work_by_varname("murta2014a") >>> print(work_to_bibtex(murta2014a, name="other")) @inproceedings{other, address = {Cologne, Germany}, author = {Murta, Leonardo and Braganholo, Vanessa and Chirigati, Fernando and Koop, David and Freire, Juliana}, booktitle = {International Provenance and Annotation Workshop}, pages = {71--83}, publisher = {Springer}, title = {no{W}orkflow: capturing and analyzing provenance of scripts}, year = {2014} } <BLANKLINE> <BLANKLINE> Use acronym for place name: >>> print(work_to_bibtex(murta2014a, acronym=True)) @inproceedings{murta2014a, address = {Cologne, Germany}, author = {Murta, Leonardo and Braganholo, Vanessa and Chirigati, Fernando and Koop, David and Freire, Juliana}, booktitle = {IPAW}, pages = {71--83}, publisher = {Springer}, title = {no{W}orkflow: capturing and analyzing provenance of scripts}, year = {2014} } <BLANKLINE> <BLANKLINE> """ result = work_to_bibtex_entry(work, name=name, acronym=acronym, rules=rules) db = BibDatabase() db.entries = [result] writer = BibTexWriter() writer.indent = " " return writer.write(db)
def test_multiple_string_write(self): bib_database = BibDatabase() bib_database.strings['name1'] = 'value1' bib_database.strings['name2'] = 'value2' # Order is important! result = bibtexparser.dumps(bib_database) expected = '@string{name1 = "value1"}\n\n@string{name2 = "value2"}\n\n' self.assertEqual(result, expected)
def pull(self): user_agents = [ 'Mozilla/5.0 (Windows NT 6.1; WOW64)', 'AppleWebKit/537.36 (KHTML, like Gecko)', 'Chrome/35.0.1916.114 Safari/537.36' ] headers = {'User-Agent': " ".join(user_agents)} within = 'owners%%2Eowner%%3DHOSTED' sort = '%%5Fscore' export_format = 'bibtex' url_template = 'https://dl.acm.org/exportformats_search.cfm?query=%s&within=%s&srt=%s&expformat=%s' result = BibDatabase() for query in self.queries: url = url_template % (query, within, sort, export_format) response = requests.get(url, cookies=self.cookies, headers=headers) self.cookies.update(response.cookies) bibtex_parser = BibTexParser(customization=convert_to_unicode) result.get_entry_list().append( bibtex_parser.parse(response.text).get_entry_list()) return result
def merge_folder_tree(folder, use_backup): """ Merge bib files from the current subtree into a master bib file at the root. This function updates the 'file' link of each entry with the relative path to each subfolder that has been processed. Args: folder (str): relative or absolute path of the folder to process. Returns: Nothing, but creates a file named `master.bib` in the given folder. """ db = BibDatabase() for subdir, _dirs, _files in os.walk(os.path.abspath(folder)): if os.path.exists(os.path.join(subdir, '.nobib')): continue # Skip blacklisted folders reldir = os.path.relpath(subdir, os.path.abspath(folder)) bib_path = os.path.join(subdir, 'biblio.bib') subdb = utils.read_bib_file(bib_path) for entry in subdb.entries: filename = utils.decode_filename_field(entry['file']) filename = os.path.join(reldir, filename) entry['file'] = utils.encode_filename_field(filename) db.entries += subdb.entries # Remove duplicated entries entries_dict = db.entries_dict db.entries = [val for key, val in entries_dict.items()] # Write result bib_path = os.path.join(folder, 'master.bib') utils.write_with_backup(bib_path, utils.write_bib(db, order=True), use_backup)
def convert_ieee_xplore_json_to_bibtex_db(json_string): result = BibDatabase() for ieee_article in json.loads(json_string)['articles']: new_entry = dict() new_entry['ID'] = ieee_article['article_number'] new_entry['ENTRYTYPE'] = parse_ieee_json_type(ieee_article) new_entry['abstract'] = parse_ieee_abstract(ieee_article) new_entry['title'] = ieee_article['title'] if 'authors' in ieee_article: new_entry['author'] = parse_ieee_json_authors(ieee_article) new_entry['keywords'] = parse_ieee_json_keywords(ieee_article) new_entry['url'] = ieee_article['pdf_url'] if new_entry['ENTRYTYPE'] == 'article': parse_extra_bibtex_article_fields(ieee_article, new_entry) elif new_entry['ENTRYTYPE'] == 'inproceedings': new_entry['booktitle'] = ieee_article['publication_title'] article_date = parse_ieee_json_date(ieee_article) new_entry['year'] = article_date.strftime("%Y") new_entry['month'] = article_date.strftime("%B") new_entry['pages'] = ("%s-%s") % (ieee_article['start_page'], ieee_article['end_page']) result.get_entry_list().append(new_entry) return result
def metaDictToBib(jobid, metadict, omit_keys, path_prefix): """Export meta data to bibtex format Args: jobid (int): id of job. metadict (DocMeta): meta dict of a doc. alt_dict (dict): dict for key changes. omit_keys (list): keys to omit in the converted dict. path_prefix (str): folder path to prepend to attachment file paths. Returns: rec (int): 0 if successful, 1 otherwise. jobid (int): the input jobid as it is. dbtext (str): formated bibtex entry, '' if <rec>==1. docid (int): id of the processed document. """ try: alt_dict = INV_ALT_KEYS ord_dict = toOrdinaryDict(metadict, alt_dict, omit_keys, path_prefix) db = BibDatabase() db.entries = [ ord_dict, ] writer = BibTexWriter() writer.indent = ' ' writer.comma_first = False dbtext = writer.write(db) return 0, jobid, dbtext, metadict['id'] except Exception: LOGGER.exception('Failed to write to bibtex') return 1, jobid, '', metadict['id']
def save_tacl_bib(txt_file, year, volume): def name(n): t = n.split() return t[-1] + ', ' + ' '.join(t[:-1]) if len(t) > 1 else n.strip() entries = [] d = None for i, line in enumerate(open(txt_file)): line = line.strip() j = i % 3 if j == 0: authors = ' and '.join([name(n) for n in line[9:].split(';')]).strip() d = { 'ID': line[:8], 'ENTRYTYPE': 'article', 'author': authors, 'journal': 'Transactions of the Association for Computational Linguistics', 'year': str(year), 'volume': str(volume) } elif j == 1: d['title'] = line entries.append(d) db = BibDatabase() db.entries = entries writer = BibTexWriter() with open(txt_file + '.bib', 'w') as bout: bout.write(writer.write(db))
def format_paper_citation_dict(citation, indent=' '): """ Format a citation dict for a paper or a list of papers into a BibTeX record string. :param citation: A ``Paper`` citation dict or list of such dicts. :param indent: Indentation to be used in BibTeX output. """ if isinstance(citation, dict): entries = [citation] else: entries = citation # Handle conflicting ids for entries entries_ids = collections.defaultdict(lambda: 0) for entry in entries: entry_id = entry['ID'] entries_ids[entry_id] += 1 if entries_ids[entry_id] > 1: entry['ID'] = '%s_%s' % (entry_id, entries_ids[entry_id]) writer = BibTexWriter() writer.indent = indent with io.StringIO('') as bibfile: db = BibDatabase() db.entries = entries bibfile.write(writer.write(db)) return bibfile.getvalue().strip()
def generate_bib_from_arxiv(arxiv_item, value, field="id"): # arxiv_cat = arxiv_item.arxiv_primary_category["term"] if field == "ti": journal = "arxiv:" + arxiv_item["id"].split("http://arxiv.org/abs/")[1] else: journal = "arxiv:" + value url = arxiv_item["pdfUrl"] title = arxiv_item["title"] authors = arxiv_item["authors"] if len(authors) > 0: first_author = authors[0].split(" ") authors = " and ".join([author for author in authors]) else: first_author = authors authors = authors published = arxiv_item["published"].split("-") year = '' if len(published) > 1: year = published[0] bib = BibDatabase() bib.entries = [{ "journal": journal, "url": url, "ID": year + first_author[0] + journal, "title": title, "year": year, "author": authors, "ENTRYTYPE": "article" }] bib = BibTexWriter().write(bib) return bib
def merge_folder_tree(folder, use_backup): """ Merge bib files from the current subtree into a master bib file at the root. This function updates the 'file' link of each entry with the relative path to each subfolder that has been processed. Args: folder (str): relative or absolute path of the folder to process. Returns: Nothing, but creates a file named `master.bib` in the given folder. """ db = BibDatabase() for subdir, _dirs, _files in os.walk(os.path.abspath(folder)): if os.path.exists(os.path.join(subdir, '.nobib')): continue # Skip blacklisted folders reldir = os.path.relpath(subdir, os.path.abspath(folder)) bib_path = os.path.join(subdir, 'biblio.bib') subdb = utils.read_bib_file(bib_path) for entry in subdb.entries: filename = utils.decode_filename_field(entry['file']) filename = os.path.join(reldir, filename) entry['file'] = utils.encode_filename_field(filename) db.entries += subdb.entries # Remove duplicated entries entries_dict = db.entries_dict db.entries = [val for key, val in entries_dict.items()] # Write result bib_path = os.path.join(folder, 'master.bib') utils.write_with_backup(bib_path, utils.write_bib(db, order=True), use_backup)
def export(data, file_bool): """ Convert the data to json or bibtex and write to a temporary file. :param data: The data containing the bibliographical details :param file_bool: True for the file to be exported as json False for bibtex format :return: the filename and the mimetype """ data_ = [k for i, j in data.items() if j for k in j] for i in data_: try: if 'timestamp' in i: i['timestamp'] = i['timestamp'].strftime('%Y/%m/%d') except AttributeError: pass for k in i: i[k] = str(i[k]) path = Path(os.path.abspath(os.path.dirname(__file__))).parent if file_bool: mimetype = 'application/json' with tempfile.NamedTemporaryFile(dir=path, delete=False, suffix='.json') as temp: temp.write(bytes(json.dumps(data_), encoding='utf-8')) else: mimetype = 'application/x-bibtex' bib_db = BibDatabase() bib_db.entries = data_ bibtex_str = bibtexparser.dumps(bib_db) with tempfile.NamedTemporaryFile(dir=path, delete=False, suffix='.bib') as temp: temp.write(bytes(bibtex_str, encoding='utf-8')) return temp.name.split('\\')[-1], mimetype
def save_citation(citation_record): cite_anchor = citation_record.find('a', {'class': 'gs_nph', 'href': '#', "role": "button"}) if not cite_anchor or not cite_anchor['onclick']: logging.warn("No Cite anchor for citation: %s" % citation_record) return citation_id = cite_anchor['onclick'].split(',')[1][1:-1] logging.info("Getting formated cite from citation id: " + citation_id) params = {"q": "info:%s:scholar.google.com/" % citation_id, "output": "cite"} soup = create_soup_by_url("https://scholar.google.com/scholar", params) bib_anchor = soup.find('a', {"class": "gs_citi"}) if not bib_anchor: logging.debug("BibTex page soup is: %s" % soup.getText()) logging.warn("No BibTex citation provided for citation: %s" % citation_id) return soup = create_soup_by_url(bib_anchor['href']) global citation_num citation_num += 1 # Adding a tag to the bib entry about google scholar citation ID citation_entry = bibtexparser.loads(soup.getText()).entries[0] citationID = citation_entry['ID'] # e.g., melville2004review citation_entry["gscholar_id"] = citation_id db_entry=[] db_entry.append(citation_entry) db = BibDatabase() db.entries = db_entry g_bib_entry = bibtexparser.dumps(db) bib_entry = "%% [%d]\n%s" % (citation_num, g_bib_entry) logging.info(bib_entry.strip()) with open(opts.citation_name, "a+") as f: f.write(bib_entry.encode('utf-8')) if opts.should_download: pdf_div = citation_record.find('div', {"class": "gs_ggs gs_fl"}) if pdf_div: download_pdf(pdf_div.a['href'], citationID)
def make_bibtex_entries(self, meta_data): """ Converts the metadata from crossref.org into a formated bibliography entry. This is returned. It also saves the entry into two bibliographic repositiories. Temp.bib is overwritten with each run of this function. Repository.bib accumulates over time. The idea is to automatically build a bibliography reference as papers get imported. :param meta_data: Raw metadata from Crossref.org :return: formatted bibliography """ #TODO:base location of temp.bib and repository.bib on destination path if meta_data == None: return None # print(meta_data) db = BibDatabase() db.entries = meta_data # print(db.entries) writer = BibTexWriter() with open("../Scratch/temp.bib", 'w', encoding='utf-8') as bibfile: bibfile.write(meta_data) with open("../Scratch/repository.bib", 'a', encoding='utf-8') as bibfile: bibfile.write(meta_data) with open("../Scratch/temp.bib", encoding='utf-8') as bibtexfile: bib_database = bibtexparser.load(bibtexfile) return bib_database
def entries_to_file(entries, fn): writer = BibTexWriter() db = BibDatabase() db.entries = entries with codecs.open(fn, 'w', "utf-8") as bibtex_file: bibtex_file.write(writer.write(db))
def extract_citation(entry): entry = copy.deepcopy(entry) del entry['type'] single_entry_db = BibDatabase() single_entry_db.entries = [entry] writer = BibTexWriter() return bibtexparser.dumps(single_entry_db, writer).strip()
def exif_pdf(self, filename): fields = ["Author", "Year", "Journal", "Title", "Publisher", "Page", "Address", "Annote", "Booktitle", "Chapter", "Crossred", "Edition", "Editor", "HowPublished", "Institution", "Month", "Note", "Number", "Organization", "Pages", "School", "Series", "Type", "Url", "Volume", "Doi", "File"] op=pexif.get_json(filename) try: new_op = { field: str(value) for field in fields for key, value in op[0].items() if field.lower() in key.lower() } if 'Author' not in new_op: new_op['Author'] = 'Unknown' id_auth=new_op["Author"].split()[-1] id_tit = (new_op["Title"].split()[:2]) id_tit.append(id_auth) id_val = "_".join(id_tit) new_op["ID"] = str(id_val) new_op["ENTRYTYPE"] = "article" op[0] = new_op db = BibDatabase() db.entries = op writer = BibTexWriter() pdf_buff = (writer.write(db)) self.create_textview(pdf_buff) except: self.Messages.on_error_clicked("Can't extract data from this pdf file", "Try other methods")
def load_and_replace(bibtex_file): with open(os.path.join('publications', bibtex_file), 'r', encoding="utf-8") as f: fdata = f.read() pdict = BibTexParser(fdata).get_entry_dict() plist = BibTexParser(fdata, bc.author).get_entry_list() by_year = {} for pub in plist: pubd = pdict[pub['ID']] db = BibDatabase() db.entries = [pubd] writer = BibTexWriter() writer.indent = '\t' bibentry = writer.write(db) pub['BIB_ENTRY'] = bibentry for field in pub: if field == 'BIB_ENTRY': continue pub[field] = context.make_replacements(pub[field]) pub['author'] = _format_author_list(pub['author']) y = int(pub['year']) if 'year' in pub else 1970 if y not in by_year: by_year[y] = [] by_year[y].append(pub) ret = [] for year, pubs in sorted(by_year.items(), reverse=True): for pub in pubs: ret.append(pub) return ret
def test_multiple_string_write(self): bib_database = BibDatabase() bib_database.strings['name1'] = 'value1' bib_database.strings['name2'] = 'value2' # Order is important! result = bibtexparser.dumps(bib_database) expected = '@string{name1 = "value1"}\n\n@string{name2 = "value2"}\n\n' self.assertEqual(result, expected)
def html_citation(self, label): bibdb = BibDatabase() bibdb.entries = [self.bib_dict[label]] bibtex_str = bibtexparser.dumps(bibdb) from subprocess import Popen, PIPE import shlex f = tempfile.NamedTemporaryFile(suffix=".bib", delete=False) f.write(bibtex_str) f.close() system_str = 'bibtex2html -nokeys -o - -s plain -nodoc -q {fname}'.format( fname=f.name) args = shlex.split(system_str) proc = Popen(args, stdout=PIPE, stderr=PIPE) out, err = proc.communicate() exitcode = proc.returncode f.close() os.remove(f.name) result = out.replace( """<!-- This document was automatically generated with bibtex2html 1.98 (see http://www.lri.fr/~filliatr/bibtex2html/), with the following command: bibtex2html -nokeys -o - -s plain -nodoc -q temp.bib --> """, '').replace( """<hr><p><em>This file was generated by <a href="http://www.lri.fr/~filliatr/bibtex2html/">bibtex2html</a> 1.98.</em></p>""", '') #print out, err, exitcode htmlstr = '<li name="{name}">{citation}</li>\n'.format(name=label, citation=result) return htmlstr
def format_paper_citation_dict(citation, indent=' '): """ Format a citation dict for a paper or a list of papers into a BibTeX record string. :param citation: A ``Paper`` citation dict or list of such dicts. :param indent: Indentation to be used in BibTeX output. """ if isinstance(citation, dict): entries = [citation] else: entries = citation # Handle conflicting ids for entries entries_ids = collections.defaultdict(lambda: 0) for entry in entries: entry_id = entry['ID'] entries_ids[entry_id] += 1 if entries_ids[entry_id] > 1: entry['ID'] = '%s_%s' % (entry_id, entries_ids[entry_id]) writer = BibTexWriter() writer.indent = indent with io.StringIO('') as bibfile: db = BibDatabase() db.entries = entries bibfile.write(writer.write(db)) return bibfile.getvalue().strip()
def parse_bibtex(input_path): feedly = pd.read_csv('dump.tsv', sep='\t', encoding='ISO-8859-1') with open(input_path, encoding="ISO-8859-1") as bibtex_file: bib_database = bibtexparser.load(bibtex_file) not_found = [] feedly_titles = [ f.upper().strip().replace('-', '') for f in feedly.title.tolist() ] new_bibtex = [] db = BibDatabase() db.entries = [] for e in bib_database.entries: match_phrase = e['title'].upper().strip().replace('-', '') if match_phrase in feedly_titles: db.entries.append(e) continue for t in feedly_titles: max_fuzz = 0 fuzz_ratio = fuzz.ratio(match_phrase, t) if fuzz_ratio > max_fuzz: max_fuzz = fuzz_ratio if fuzz_ratio > 80: db.entries.append(e) break else: print(str(max_fuzz) + ': ' + e['title'] + '\n') not_found.append(e['title']) print('{} entries removed'.format(len(not_found))) return (db)
def export_to_bibtex_one_file(self, path: str = "all.bib"): """stores publications in bibtex format in one file Parameters ---------- path : optional path where the resulting file should be stored, by default "all.bib" Raises ------ KeyError if the type of publication and the handle are not specified """ self._create_dir(path) for pub in self._dep_pubs: meta = pub.get_bibtex_representation() if not meta: print("This pub has no meta") else: if meta["type"] and meta["handle"]: handle = meta.pop("handle") pub_type = meta.pop("type") db = BibDatabase() db.entries = [meta.copy()] db.entries[0].update({"ID": handle, "ENTRYTYPE": pub_type}) writer = BibTexWriter() tot = [] for key in meta: tot.append(key) writer.display_order = tot with open(path, "a") as bibfile: bibfile.write(writer.write(db)) else: raise KeyError("the type of publication and metdata" + "are required")
def merge(entry1, entry2): db = BibDatabase() entries = {} keys1 = entry1.keys() keys2 = entry2.keys() intersection = intersect(keys1, keys2) union = get_union(keys1, keys2) not_intersect = not_intersection(union, intersection) #The two entries have the same keys, so everything needs to be merged if not not_intersect: for key in keys1: if key == 'author': author = merge_author(entry1[key], entry1['author_norm'], entry2[key], entry2['author_norm']) author_norm = normalize_author(str(author)) entries = add_field(entries, key, author) entries = add_field(entries, 'author_norm', author_norm) if key == 'editor': editor = merge_author(entry1[key], entry1['editor_norm'], entry2[key], entry2['editor_norm']) editor_norm = normalize_author(str(editor)) entries = add_field(entries, key, editor) entries = add_field(entries, 'editor_norm', editor_norm) elif key == 'keywords' or key == 'topics': entries = add_field(entries, key, merge_keywords(entry1[key], entry2[key])) elif key == 'month': entries = add_field(entries, key, entry1[key]) elif len(entry1[key]) == len(entry2[key]) or len(entry1[key]) < len(entry2[key]): entries = add_field(entries, key, entry2[key]) else: entries = add_field(entries, key, entry1[key]) else: #All the keys in the two entries aren't the same, so some need to be merged #some can just be written #print "Entries are not the same!" #print keys1, keys2 for key in intersection: if key == 'author': author = merge_author(entry1[key], entry1['author_norm'], entry2[key], entry2['author_norm']) entries = add_field(entries, key, author) if key == 'editor': editor = merge_author(entry1[key], entry1['editor_norm'], entry2[key], entry2['editor_norm']) entries = add_field(entries, key, editor) elif key == 'keywords' or key == 'topics': entries = add_field(entries, key, merge_keywords(entry1[key], entry2[key])) elif key == 'month': entries = add_field(entries, key, entry1[key]) elif key == 'doi': entries = add_field(entries, get_keycount(intersection, key), entry1[key]) elif len(entry1[key]) == len(entry2[key]) or len(entry1[key]) < len(entry2[key]): entries = add_field(entries, key, entry2[key]) else: entries = add_field(entries, key, entry1[key]) for key in not_intersect: if key in keys1: entries = add_field(entries, key, entry1[key]) elif key in keys2: entries = add_field(entries, key, entry2[key]) db.entries = [entries] return db
def test_store_biopython_seq_record_DOI(self): """Tests - __init__ and store_biopython_seq_record with DOI.""" # DOI TESTING db2 = BibDatabase() db2.entries = [{ "journal": "Nice Journal", "comments": "A comment", "pages": "12--23", "month": "jan", "abstract": "This is an abstract. This line should be " "long enough to test multilines...", "title": "An amazing title", "year": "2013", "doi": "10.1186/s12864-016-2535-300002", "volume": "12", "ID": "Teste2018", "author": "Foo, b. and Foo1, b. and Foo b.", "keyword": "keyword1, keyword2", "ENTRYTYPE": "article", }] for entry in db2.entries: bibtest3 = PublicationLoader() bibtest3.store_bibtex_entry(entry) test_bibtex3 = Pub.objects.get(uniquename="Teste2018") test_bibtex3_pubdbxref = PubDbxref.objects.get(pub=test_bibtex3) test_bibtex3_dbxref = Dbxref.objects.get( dbxref_id=test_bibtex3_pubdbxref.dbxref_id) self.assertEqual("10.1186/s12864-016-2535-300002", test_bibtex3_dbxref.accession) Organism.objects.create(genus="Mus", species="musculus") test_seq_file_pub = SequenceLoader( filename="sequence_doi.fasta", doi="10.1186/s12864-016-2535-300002") test_seq_obj_pub = SeqRecord(Seq("acgtgtgtgcatgctagatcgatgcatgca"), id="chr2", description="chromosome 2") test_seq_file_pub.store_biopython_seq_record(test_seq_obj_pub, "assembly", "Mus musculus") test_feature_doi = Feature.objects.get(name="chromosome 2") self.assertEqual("chr2", test_feature_doi.uniquename) test_feature_pub_doi = FeaturePub.objects.get( pub_id=test_bibtex3.pub_id) test_pub_dbxref_doi = PubDbxref.objects.get( pub_id=test_feature_pub_doi.pub_id) test_dbxref_doi = Dbxref.objects.get( dbxref_id=test_pub_dbxref_doi.dbxref_id) self.assertEqual("10.1186/s12864-016-2535-300002", test_dbxref_doi.accession) # test remove_file self.assertTrue( Dbxrefprop.objects.filter(value="sequence_doi.fasta").exists()) call_command("remove_file", "--name=sequence_doi.fasta", "--verbosity=0") self.assertFalse( Dbxrefprop.objects.filter(value="sequence_doi.fasta").exists())
def test_write_common_strings(self): bib_database = BibDatabase() bib_database.load_common_strings() writer = BibTexWriter(write_common_strings=True) result = bibtexparser.dumps(bib_database, writer=writer) with io.open('bibtexparser/tests/data/common_strings.bib') as f: expected = f.read() self.assertEqual(result, expected)
def pull(self): result = BibDatabase() database = self.source_pipe.pull() for entry in database.get_entry_list(): if self.accept(entry): result.get_entry_list().append(entry) return result
def test_bibexport(): a = bb.entries_dict['Yttri:Urban'] db = BibDatabase() db.entries = [a] writer = BibTexWriter() with open('testoutbib.bib', 'w') as bibfile: bibfile.write(writer.write(db)) sys.exit()
def getBibtexStrFromAbstractDict(abstractDict): abstractDict.pop('url') abstractDict.pop('journal') db = BibDatabase() writer = BibTexWriter() writer.indent = ' ' db.entries = [abstractDict] return writer.write(db)
def test_write_dependent_strings(self): bib_database = BibDatabase() bib_database.strings['title'] = 'Mr' expr = BibDataStringExpression([BibDataString(bib_database, 'title'), 'Smith']) bib_database.strings['name'] = expr result = bibtexparser.dumps(bib_database) expected = '@string{title = {Mr}}\n\n@string{name = title # {Smith}}\n\n' self.assertEqual(result, expected)
def test_write_common_strings(self): bib_database = BibDatabase() bib_database.load_common_strings() writer = BibTexWriter(write_common_strings=True) result = bibtexparser.dumps(bib_database, writer=writer) with io.open('bibtexparser/tests/data/common_strings.bib') as f: expected = f.read() self.assertEqual(result, expected)
def __init__(self, data=None, customization=None, ignore_nonstandard_types=True, homogenize_fields=False, interpolate_strings=True, common_strings=False, string_provider=None): """ Creates a parser for rading BibTeX files :return: parser :rtype: `BibTexParser` """ self.bib_database = BibDatabase(string_provider) #: Load common strings such as months abbreviation #: Default: `False`. self.common_strings = common_strings if self.common_strings: self.bib_database.load_common_strings() #: Callback function to process BibTeX entries after parsing, #: for example to create a list from a string with multiple values. #: By default all BibTeX values are treated as simple strings. #: Default: `None`. self.customization = customization #: Ignore non-standard BibTeX types (`book`, `article`, etc). #: Default: `True`. self.ignore_nonstandard_types = ignore_nonstandard_types #: Sanitize BibTeX field names, for example change `url` to `link` etc. #: Field names are always converted to lowercase names. #: Default: `False`. self.homogenize_fields = homogenize_fields #: Interpolate Bibtex Strings or keep the structure self.interpolate_strings = interpolate_strings # On some sample data files, the character encoding detection simply # hangs We are going to default to utf8, and mandate it. self.encoding = 'utf8' # pre-defined set of key changes self.alt_dict = { 'keyw': u'keyword', 'keywords': u'keyword', 'authors': u'author', 'editors': u'editor', 'urls': u'url', 'link': u'url', 'links': u'url', 'subjects': u'subject' } # Setup the parser expression self._init_expressions()
def test_write_dependent_strings(self): bib_database = BibDatabase() bib_database.strings['title'] = 'Mr' expr = BibDataStringExpression( [BibDataString(bib_database, 'title'), 'Smith']) bib_database.strings['name'] = expr result = bibtexparser.dumps(bib_database) expected = '@string{title = {Mr}}\n\n@string{name = title # {Smith}}\n\n' self.assertEqual(result, expected)
def get_bibdatabase(): """ Create an empty BibDatabase """ bib_database = BibDatabase() bib_database.entries = [] return bib_database
def write_bib_file(list_of_cited_entries, output_fname): db = BibDatabase() db.entries = list_of_cited_entries writer = BibTexWriter() with open(output_fname, 'w') as bibtex_file: bibtex_file.write(writer.write(db)) print('Output written to ' + output_fname)
def bibtex(self) -> str: """Contains the publication as a bibtex entry Returns: str -- a bibtex entry """ a = BibDatabase() a.entries = [self.bib] return bibtexparser.dumps(a)
def test_align(self): bib_database = BibDatabase() bib_database.entries = [{'ID': 'abc123', 'ENTRYTYPE': 'book', 'author': 'test', 'thisisaverylongkey': 'longvalue'}] writer = BibTexWriter() writer.align_values = True result = bibtexparser.dumps(bib_database, writer) expected = \ """@book{abc123, author = {test}, thisisaverylongkey = {longvalue} } """ self.assertEqual(result, expected) with open('bibtexparser/tests/data/multiple_entries_and_comments.bib') as bibtex_file: bib_database = bibtexparser.load(bibtex_file) writer = BibTexWriter() writer.contents = ['entries'] writer.align_values = True result = bibtexparser.dumps(bib_database, writer) expected = \ """@book{Toto3000, author = {Toto, A and Titi, B}, title = {A title} } @article{Wigner1938, author = {Wigner, E.}, doi = {10.1039/TF9383400029}, issn = {0014-7672}, journal = {Trans. Faraday Soc.}, owner = {fr}, pages = {29--41}, publisher = {The Royal Society of Chemistry}, title = {The transition state method}, volume = {34}, year = {1938} } @book{Yablon2005, author = {Yablon, A.D.}, publisher = {Springer}, title = {Optical fiber fusion slicing}, year = {2005} } """ self.assertEqual(result, expected)
def write_selected_to_file(selected): db = BibDatabase() result = [] for item in selected: path = str(bib_dir) + str(files[item]) with open(path, 'r') as f: db = bibtexparser.load(f) result.append(db.entries[0]) db.entries = result print db.entries with open(website_dir, 'w') as f: bibtexparser.dump(db, f) subprocess.call(['bib2html', '-f', website_dir])
def test_entry_separator(self): bib_database = BibDatabase() bib_database.entries = [{'ID': 'abc123', 'ENTRYTYPE': 'book', 'author': 'test'}] writer = BibTexWriter() writer.entry_separator = '' result = bibtexparser.dumps(bib_database, writer) expected = \ """@book{abc123, author = {test} } """ self.assertEqual(result, expected)
def test_sort_missing_field(self): bib_database = BibDatabase() bib_database.entries = [{'ID': 'b', 'ENTRYTYPE': 'article', 'year': '2000'}, {'ID': 'c', 'ENTRYTYPE': 'book', 'year': '2010'}, {'ID': 'a', 'ENTRYTYPE': 'book'}] writer = BibTexWriter() writer.order_entries_by = ('year', ) result = bibtexparser.dumps(bib_database, writer) expected = "@book{a\n}\n\n@article{b,\n year = {2000}\n}\n\n@book{c,\n year = {2010}\n}\n\n" self.assertEqual(result, expected)
def test_indent(self): bib_database = BibDatabase() bib_database.entries = [{'id': 'abc123', 'type': 'book', 'author': 'test'}] writer = BibTexWriter() writer.indent = ' ' result = bibtexparser.dumps(bib_database, writer) expected = \ """@book{abc123, author = {test} } """ self.assertEqual(result, expected)
def __str__(self): bib = BibDatabase() bib.entries = [{ 'ENTRYTYPE': 'article', 'ID': self.entry_number, 'author': self.author, 'journal': self.journal, 'title': self.title, 'year': self.year, 'volume': self.volume, 'number': self.number, 'pages': self.pages, 'abstract': self.abstract, 'keyword': self.keyword, 'doi': self.doi, 'issn': self.issn }] return bibtexparser.dumps(bib)
def __init__(self, data=None, customization=None, ignore_nonstandard_types=True, homogenize_fields=False, interpolate_strings=True, common_strings=False): """ Creates a parser for rading BibTeX files :return: parser :rtype: `BibTexParser` """ self.bib_database = BibDatabase() #: Load common strings such as months abbreviation #: Default: `False`. self.common_strings = common_strings if self.common_strings: self.bib_database.load_common_strings() #: Callback function to process BibTeX entries after parsing, #: for example to create a list from a string with multiple values. #: By default all BibTeX values are treated as simple strings. #: Default: `None`. self.customization = customization #: Ignore non-standard BibTeX types (`book`, `article`, etc). #: Default: `True`. self.ignore_nonstandard_types = ignore_nonstandard_types #: Sanitize BibTeX field names, for example change `url` to `link` etc. #: Field names are always converted to lowercase names. #: Default: `False`. self.homogenize_fields = homogenize_fields #: Interpolate Bibtex Strings or keep the structure self.interpolate_strings = interpolate_strings # On some sample data files, the character encoding detection simply # hangs We are going to default to utf8, and mandate it. self.encoding = 'utf8' # pre-defined set of key changes self.alt_dict = { 'keyw': u'keyword', 'keywords': u'keyword', 'authors': u'author', 'editors': u'editor', 'urls': u'url', 'link': u'url', 'links': u'url', 'subjects': u'subject' } # Setup the parser expression self._init_expressions()
def _entries_to_bibtex(self, bib_database): bibtex = '' if self.order_entries_by: # TODO: allow sort field does not exist for entry entries = sorted(bib_database.entries, key=lambda x: BibDatabase.entry_sort_key(x, self.order_entries_by)) else: entries = bib_database.entries for entry in entries: bibtex += self._entry_to_bibtex(entry) return bibtex
def write_selected_to_file(self, selected, website): db = BibDatabase() result = [] for item in selected: path = str(self.bib_dir) + str(item) with open(path, 'r') as f: db = bibtexparser.load(f) result.append(db.entries[0]) db.entries = result if website == 'personal': with open(self.personal_website_bib, 'w') as f: bibtexparser.dump(db, f) elif website == 'group': with open(self.group_website_bib, 'w') as f: bibtexparser.dump(db, f) #Make sure the file is uploaded to Dropbox before it is send to BibBase time.sleep(1) #Query to BibBase with the right URL if website == 'personal': html = urllib2.urlopen("http://bibbase.org/show?bib=" + str(self.personal_link)).read() elif website == 'group': html = urllib2.urlopen("http://bibbase.org/show?bib=" + str(self.group_link)).read() #The html does not contain styling and jquery or javascript html = '<head>' + \ '<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.3/jquery.min.js"></script>' + \ '<script src="http://bibbase.org/js/bibbase.min.js" type="text/javascript"></script>' + \ '<link rel="stylesheet" href="http://maxcdn.bootstrapcdn.com/font-awesome/4.3.0/css/font-awesome.min.css">' + \ '<link rel="stylesheet" href="http://bibbase.org/css/bootstrap.min.css" type="text/css" media="screen">' + \ '<link rel="stylesheet" href="http://bibbase.org/css/styles/default.css" type="text/css" media="screen">' + \ '<link rel="stylesheet" href="http://bibbase.org/css/styles/common.css" type="text/css" media="screen">' + \ '<link rel="stylesheet" href="http://bibbase.org/css/styles/hide_text.css" type="text/css" media="screen">' + str(html) if website == 'personal': with open(self.personal_website_html, 'w') as website: website.write(html) elif website == 'group': with open(self.group_website_html, 'w') as website: website.write(html)
def main(): if len(sys.argv) < 3: print("Wrong number of arguments. Usage: \n") print("python3 dump_db.py name.db dump.bib") print("Dump database") print("Database: ", sys.argv[1]) engine = create_engine('sqlite:///app.db') Session = sessionmaker() Session.configure(bind=engine) session = Session() db = BibDatabase() db.entries = [] dbentries = session.query(BiblioEntry) for e in dbentries: db.entries.append( {'journal': e.journal, 'title': e.title, 'year': str(e.year), 'publisher': e.publisher, 'school': e.school, 'ID': e.ID, 'url': e.url, 'author': e.authors, 'keyword': e.keywords, 'ENTRYTYPE': e.ENTRYTYPE} ) print("Write file on", sys.argv[2]) writer = BibTexWriter() with open(sys.argv[2], 'w') as bibfile: bibfile.write(writer.write(db)) session.close() print("Connection closed.")
def _entries_to_bibtex(self, bib_database): bibtex = '' if self.order_entries_by: # TODO: allow sort field does not exist for entry entries = sorted(bib_database.entries, key=lambda x: BibDatabase.entry_sort_key(x, self.order_entries_by)) else: entries = bib_database.entries if self.align_values: # determine maximum field width to be used widths = [max(map(len, entry.keys())) for entry in entries] self._max_field_width = max(widths) for entry in entries: bibtex += self._entry_to_bibtex(entry) return bibtex
def arxiv2bibtex(arxiv_id, try_doi=True, ui=None): """Return a bibtex string from an arXiv ID :param arxiv_id: arXiv id, with or without the `arXiv:` prefix and version suffix (e.g. `v1`). Old an new style are accepted. Here are example of accepted identifiers: `1510.00322`, `arXiv:1510.00322`, `0901.0512`, `arXiv:0901.0512`, `hep-ph/9409201` or `arXiv:hep-ph/9409201`. Note that the `arXiv:` prefix will be automatically removed, and the version suffix automatically added if missing. :param try_doi: if a DOI is referenced in the arXiv metadata, try to download it instead. If that fails for any reason, falls back to the arXiv, with a warning message, if the UI is provided. :param ui: if not None, will display a warning if the doi request fails. """ ## handle errors url = 'https://export.arxiv.org/api/query?id_list={}'.format(arxiv_id) try: r = requests.get(url) if r.status_code == 400: # bad request msg = ("the arXiv server returned a bad request error. The " "arXiv id {} is possibly invalid or malformed.".format(arxiv_id)) raise ReferenceNotFoundError(msg) r.raise_for_status() # raise an exception for HTTP errors: # 401, 404, 400 if `ui` is None, etc. except requests.exceptions.RequestException as e: msg = ("connection error while retrieving arXiv data for " "'{}': {}".format(arxiv_id, e)) raise ReferenceNotFoundError(msg) feed = feedparser.parse(r.text) if len(feed.entries) == 0: # no results. msg = "no results for arXiv id {}".format(arxiv_id) raise ReferenceNotFoundError(msg) if len(feed.entries) > 1: # I don't know how that could happen, but let's # be ready for it. results = '\n'.join('{}. {}'.format(i, entry['title']) for entry in feed.entries) msg = ("multiple results for arXiv id {}:\n{}\nThis is unexpected. " "Please submit an issue at " "https://github.com/pubs/pubs/issues").format(arxiv_id, choices) raise ReferenceNotFoundError(msg) entry = feed.entries[0] ## try to return a doi instead of the arXiv reference if try_doi and 'arxiv_doi' in entry: try: return doi2bibtex(entry['arxiv_doi']) except ReferenceNotFoundError as e: if ui is not None: ui.warning(str(e)) ## create a bibentry from the arXiv response. db = BibDatabase() entry_id = _extract_arxiv_id(entry) author_str = ' and '.join( [author['name'] for author in entry['authors']]) db.entries = [{ 'ENTRYTYPE': 'article', 'ID': entry_id, 'author': author_str, 'title': entry['title'], 'year': str(entry['published_parsed'].tm_year), 'month': _months[entry['published_parsed'].tm_mon-1], 'eprint': entry_id, 'eprinttype': 'arxiv', 'date': entry['published'], # not really standard, but a resolution more # granular than months is increasinlgy relevant. 'url': entry['link'], 'urldate': datetime.datetime.utcnow().isoformat() + 'Z' # can't hurt. }] # we don't add eprintclass for old-style ids, as it is in the id already. if not _is_arxiv_oldstyle(entry_id): db.entries[0]['eprintclass'] = entry['arxiv_primary_category']['term'] if 'arxiv_doi' in entry: db.entries[0]['arxiv_doi'] = entry['arxiv_doi'] bibtex = bibtexparser.dumps(db) return bibtex
class BibTexParser(object): """ A parser for reading BibTeX bibliographic data files. Example:: from bibtexparser.bparser import BibTexParser bibtex_str = ... parser = BibTexParser() parser.ignore_nonstandard_types = False parser.homogenize_fields = False parser.common_strings = False bib_database = bibtexparser.loads(bibtex_str, parser) """ def __new__(cls, data=None, **args): """ To catch the old API structure in which creating the parser would immediately parse and return data. """ if data is None: return super(BibTexParser, cls).__new__(cls) else: # For backwards compatibility: if data is given, parse # and return the `BibDatabase` object instead of the parser. return parse(data, **args) def __init__(self, data=None, customization=None, ignore_nonstandard_types=True, homogenize_fields=False, common_strings=False): """ Creates a parser for rading BibTeX files :return: parser :rtype: `BibTexParser` """ self.bib_database = BibDatabase() #: Load common strings such as months abbreviation #: Default: `False`. self.common_strings = common_strings if self.common_strings: self.bib_database.load_common_strings() #: Callback function to process BibTeX entries after parsing, #: for example to create a list from a string with multiple values. #: By default all BibTeX values are treated as simple strings. #: Default: `None`. self.customization = customization #: Ignore non-standard BibTeX types (`book`, `article`, etc). #: Default: `True`. self.ignore_nonstandard_types = ignore_nonstandard_types #: Sanitize BibTeX field names, for example change `url` to `link` etc. #: Field names are always converted to lowercase names. #: Default: `False`. self.homogenize_fields = homogenize_fields # On some sample data files, the character encoding detection simply # hangs We are going to default to utf8, and mandate it. self.encoding = 'utf8' # pre-defined set of key changes self.alt_dict = { 'keyw': u'keyword', 'keywords': u'keyword', 'authors': u'author', 'editors': u'editor', 'url': u'link', 'urls': u'link', 'links': u'link', 'subjects': u'subject' } # Setup the parser expression self._init_expressions() def parse(self, bibtex_str, partial=False): """Parse a BibTeX string into an object :param bibtex_str: BibTeX string :type: str or unicode :param partial: If True, print errors only on parsing failures. If False, an exception is raised. :type: boolean :return: bibliographic database :rtype: BibDatabase """ bibtex_file_obj = self._bibtex_file_obj(bibtex_str) try: self._expr.parseFile(bibtex_file_obj) except self._expr.ParseException as exc: logger.error("Could not parse properly, starting at %s", exc.line) if not partial: raise exc return self.bib_database def parse_file(self, file, partial=False): """Parse a BibTeX file into an object :param file: BibTeX file or file-like object :type: file :param partial: If True, print errors only on parsing failures. If False, an exception is raised. :type: boolean :return: bibliographic database :rtype: BibDatabase """ return self.parse(file.read(), partial=partial) def _init_expressions(self): """ Defines all parser expressions used internally. """ self._expr = BibtexExpression() # Handle string as BibDataString object self._expr.set_string_name_parse_action( lambda s, l, t: BibDataString(self.bib_database, t[0])) self._expr.set_string_expression_parse_action( lambda s, l, t: self._interpolate_string_expression(t)) # Add notice to logger self._expr.add_log_function(logger.debug) # Set actions self._expr.entry.addParseAction( lambda s, l, t: self._add_entry( t.get('EntryType'), t.get('Key'), t.get('Fields')) ) self._expr.implicit_comment.addParseAction( lambda s, l, t: self._add_comment(t[0]) ) self._expr.explicit_comment.addParseAction( lambda s, l, t: self._add_comment(t[0]) ) self._expr.preamble_decl.addParseAction( lambda s, l, t: self._add_preamble(t[0]) ) self._expr.string_def.addParseAction( lambda s, l, t: self._add_string(t['StringName'].name, t['StringValue']) ) def _bibtex_file_obj(self, bibtex_str): # Some files have Byte-order marks inserted at the start byte = '\xef\xbb\xbf' if not isinstance(byte, ustr): byte = ustr(byte, self.encoding, 'ignore') if bibtex_str[:3] == byte: bibtex_str = bibtex_str[3:] if not isinstance(bibtex_str, ustr): bibtex_str = bibtex_str.decode(encoding=self.encoding) return io.StringIO(bibtex_str) def _clean_val(self, val): """ Clean instring before adding to dictionary :param val: a value :type val: string :returns: string -- value """ if not val or val == "{}": return '' return val def _clean_key(self, key): """ Lowercase a key and return as unicode. :param key: a key :type key: string :returns: (unicode) string -- value """ key = key.lower() if not isinstance(key, ustr): return ustr(key, 'utf-8') else: return key def _clean_field_key(self, key): """ Clean a bibtex field key and homogenize alternative forms. :param key: a key :type key: string :returns: string -- value """ key = self._clean_key(key) if self.homogenize_fields: if key in list(self.alt_dict.keys()): key = self.alt_dict[key] return key def _add_entry(self, entry_type, entry_id, fields): """ Adds a parsed entry. Includes checking type and fields, cleaning, applying customizations. :param entry_type: the entry type :type entry_type: string :param entry_id: the entry bibid :type entry_id: string :param fields: the fields and values :type fields: dictionary :returns: string -- value """ d = {} entry_type = self._clean_key(entry_type) if self.ignore_nonstandard_types and entry_type not in STANDARD_TYPES: logger.warning('Entry type %s not standard. Not considered.', entry_type) return for key in fields: d[self._clean_field_key(key)] = self._clean_val(fields[key]) d['ENTRYTYPE'] = entry_type d['ID'] = entry_id if self.customization is not None: # apply any customizations to the record object then return it logger.debug('Apply customizations and return dict') d = self.customization(d) self.bib_database.entries.append(d) def _add_comment(self, comment): """ Stores a comment in the list of comment. :param comment: the parsed comment :type comment: string """ logger.debug('Store comment in list of comments: ' + comment.__repr__()) self.bib_database.comments.append(comment) def _add_string(self, string_key, string): """ Stores a new string in the string dictionary. :param string_key: the string key :type string_key: string :param string: the string value :type string: string """ if string_key in self.bib_database.strings: logger.warning('Overwritting existing string for key: %s.', string_key) logger.debug('Store string: {} -> {}'.format(string_key, string)) self.bib_database.strings[string_key] = self._clean_val(string) def _interpolate_string_expression(self, string_expr): """ Replaces bibdatastrings by their values in an expression. :param string_expr: the parsed string as a list :type string_expr: list """ return ''.join([self._expand_string(s) for s in string_expr]) def _expand_string(self, string_or_bibdatastring): """ Eventually replaces a bibdatastring by its value. :param string_or_bibdatastring: the parsed token :type string_expr: string or BibDataString :returns: string """ if isinstance(string_or_bibdatastring, BibDataString): return string_or_bibdatastring.get_value() else: return string_or_bibdatastring def _add_preamble(self, preamble): """ Stores a preamble. :param preamble: the parsed preamble :type preamble: string """ logger.debug('Store preamble in list of preambles') self.bib_database.preambles.append(preamble)
def formatText(self): if self.BibtexfilePath != '': self.openfile() else: self.readcontent() m = self.getMap() m['IEEE Global Communications Conference'] = m['IEEE Global Communications Conference, incorporating the Global Internet Symposium'] del m['IEEE Global Communications Conference, incorporating the Global Internet Symposium'] print m length = 0 nb = {} for bibtex in self.allbibtex: for key in bibtex.keys(): if len(key) > length and key != 'ENTRYTYPE': length = len(key) for k, v in bibtex.items(): if k == 'ENTRYTYPE' or k == 'ID': nb[k] = v continue elif k == 'ID': nb[k] = v continue elif k == 'doi' or k == 'ISSN' or k == 'keywords': continue elif v == '': continue elif 'url' in k: continue nk = k + (length - len(k)) * ' ' if 'booktitle' in nk: if '(' in v: v1 = v.split('(')[1].split(')')[0] nb[nk] = 'Proc. of ' + v1 continue flag = 0 # 未更改booktitle to_remove = "~`!@#$%^&*(){}[];':<>|-=_+" table = {ord(char): None for char in to_remove} clean_v = v.translate(table) #clean_v = v.translate(string.punctuation) #print clean_v for kk, vv in m.items(): if kk in clean_v: nb[nk] = 'Proc. of ' + vv[0] publish = 'publish' + (length - 7) * ' ' nb[publish] = vv[1] flag = 1 break if flag == 0: nb[nk] = v print v continue elif nk.strip() == 'title' and 'booktitle' not in nk: self.tilte = v nv = v.split(' ') for i in range(len(nv)): # 标题除介词和冠词外,首字母大写 if nv[i] in self.prep or nv[i] in self.artie: continue # 首字母大写 else: if 97 <= ord(nv[i][0]) <= 122: nv[i] = chr(ord(nv[i][0])-32)+nv[i][1:] v = ' '.join(nv) nb[nk] = '{' + v + '}' continue elif 'pages' in nk: if '--' in v: nb[nk] = v continue nb[nk] = v.replace('-', '--') continue elif 'author' in nk: if '\n' in v: nb[nk] = v.replace('\n', ' ') continue # 其他不做改变 nb[nk] = v db = BibDatabase() db.entries = [nb] writer = BibTexWriter() writer.indent = '\t' # indent entries with 4 spaces instead of one writer.comma_first = False # place the comma at the beginning of the line with open(self.tilte+'.bib', 'wb') as bibfile: bibfile.write(writer.write(db))
import sqlite3 import re import datetime from bibtexparser.bwriter import BibTexWriter from bibtexparser.bibdatabase import BibDatabase db = sqlite3.connect("profile.db") c = db.cursor() db = BibDatabase() db.entries = [] id_dict = {} c.execute( 'SELECT title, authors, journal, journal_abbr, volume, pages, month, year FROM journal_paper WHERE locale = "international" ORDER BY year, month' ) for row in c: title, authors, journal, journal_abbr, volume, pages, month, year = row title_kwd = None authors_kwd = None journal_kwd = None bib_obj = {"ENTRYTYPE": "article"} if title is not None: bib_obj["title"] = title for word in re.split("[^A-Za-z0-9]", title): word = word.lower() if word != "a" and word != "the" and word != "an":
def test_entries_list_method(self): bib_db = BibDatabase() bib_db.entries = self.entries self.assertEqual(bib_db.entries, bib_db.get_entry_list())
def test_entries_dict_prop(self): bib_db = BibDatabase() bib_db.entries = self.entries self.assertEqual(bib_db.entries_dict, bib_db.get_entry_dict())
def test_multiple_string_write(self): bib_database = BibDatabase() bib_database.preambles = [' a ', 'b'] result = bibtexparser.dumps(bib_database) expected = '@preamble{" a "}\n\n@preamble{"b"}\n\n' self.assertEqual(result, expected)
c = 0 for k in keys: if k.startswith(key): print('\tFound Match: {} -> {}'.format(k, key)) c += 1 if (c > 0): key += chr(ord(str(c)) + 0x30) # Hehehehe, everybody needs some dirty pleasures sometimes... keys.add(key) # Build new bib entry cleaned_entry = copy(e) cleaned_entry['ID'] = key bib_entries.append(cleaned_entry) else: print('[WARNING] - No year found in {}!'.format(e)) else: print('[WARNING] - No author found in {}!'.format(e)) else: print('[WARNING] - No title found in {}!'.format(e)) print('Merged Bib Entries: {}'.format(len(bib_entries))) db = BibDatabase() db.entries = bib_entries writer = BibTexWriter() with open(os.path.join(args.output_path, args.output_file), 'w') as bibfile: bibfile.write(writer.write(db))
def test_multiple_string_write(self): bib_database = BibDatabase() bib_database.preambles = [" a ", "b"] result = bibtexparser.dumps(bib_database) expected = "@preamble{ a }\n\n@preamble{b}\n\n" self.assertEqual(result, expected)
def test_single_preamble_write(self): bib_database = BibDatabase() bib_database.preambles = [" a "] result = bibtexparser.dumps(bib_database) expected = "@preamble{ a }\n\n" self.assertEqual(result, expected)
def test_single_string_write(self): bib_database = BibDatabase() bib_database.strings['name1'] = 'value1' result = bibtexparser.dumps(bib_database) expected = '@string{name1 = "value1"}\n\n' self.assertEqual(result, expected)