def test_old_parser(self):
parser = parse_data(self.big_data)
name, sequence = next(parser)
self.assertEqual(name, 'Rosalind_3496')
self.assertEqual(sequence,
'ATGGCAGTCCGAGTTCACGAACCGAATACGTTTAATAGGTAGTCGCCACCACTTAGACGGGTTCTCGCCTATAGGGAACATTAAAGGCGTGGAATTCG')
self.assertEqual(len(self.big_data), 0)
def test_old_parser(self):
parser = parse_data(self.big_data)
name, sequence = next(parser)
self.assertEqual(name, 'Rosalind_3496')
self.assertEqual(
sequence,
'ATGGCAGTCCGAGTTCACGAACCGAATACGTTTAATAGGTAGTCGCCACCACTTAGACGGGTTCTCGCCTATAGGGAACATTAAAGGCGTGGAATTCG'
)
self.assertEqual(len(self.big_data), 0)
def setUp(cls):
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
labeled = list(parse_data(data))
cls.matches = compare_all_pairs_both_ways(labeled)
with open('CENPA_8chunks.txt', 'r') as g:
big_data = g.readlines()
longer = list(parse_data(big_data))
cls.more_matches = compare_all_pairs_both_ways(longer)
with open('CA_superstring3_expected.txt', 'r') as h:
cls.ss = h.readline().strip()
with open('CA_superstring8_expected.txt', 'r') as m:
lines = m.readlines()
cls.ss8 = ''.join([x.strip() for x in lines])
def setUp(cls):
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
labeled = list(parse_data(data))
cls.matches = compare_all_pairs_both_ways(labeled)
with open('CENPA_8chunks.txt', 'r') as g:
big_data = g.readlines()
longer = list(parse_data(big_data))
cls.more_matches = compare_all_pairs_both_ways(longer)
with open('CA_superstring3_expected.txt', 'r') as h:
cls.ss = h.readline().strip()
with open('CA_superstring8_expected.txt', 'r') as m:
lines = m.readlines()
cls.ss8 = ''.join([x.strip() for x in lines])
def get_rescore_from_labeled(rescore, data):
"""
This should not be needed.
:param rescore: list of (name,name) tuples
:param data: raw data
:return: subset of labeled where all names in rescore are keys in labeled
"""
labeled_list = list(parse_data(data))
labeled_dict = {x[0]:x[1] for x in labeled_list}
losers = dict()
for x in rescore:
losers[x[0]] = labeled.get(x[0])
losers[x[1]] = labeled.get(x[1])
#convert back to tuples for rescoring
underdogs = list(losers.items())
return underdogs
def test_multiple_sequences(self):
name, sequence = parse_data(self.big_data)
self.assertEqual(name, 'Rosalind_0808')
name, percent = gc_content(name, sequence, debug=True)
self.assertEqual(percent, 60.919540)
def test_raw_parsing_one(self):
self.assertEqual(len(self.data[1].strip() + self.data[2].strip()), 87)
name, sequence = parse_data(self.data)
self.assertEqual(name, 'Rosalind_0808')
self.assertEqual(len(sequence), 87)
def test_gc_content(self):
name, sequence = parse_data(self.data)
name, percent = gc_content(name, sequence, debug=True)
self.assertEqual(percent, 60.919540)
def test_gc_content(self):
name, sequence = parse_data(self.data)
name, percent = gc_content(name, sequence, debug=True)
self.assertEqual(percent, 60.919540)
try:
newedge = next(edges)
listofedges.append(newedge)
except StopIteration:
break
return listofedges
if __name__=='__main__':
with open('CENPA_8chunks.txt', 'r') as f:
data = f.readlines()
labeled = list(parse_data(data))
expected_pairs=8
matches = compare_all_pairs_both_ways(labeled)
if len(matches) != expected_pairs:
print("warning! expected {} but found {}"
.format(expected_pairs, len(matches)))
listofedges = make_listofedges(matches)
newgraph = Graph(listofedges)
newgraph.sort_edges()
superstring = newgraph.flatten_graph(matches)
print(superstring)
def setUp(cls):
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
cls.labeled = list(parse_data(data))
def setUp(cls):
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
labeled = list(parse_data(data))
cls.matches = compare_all_pairs_both_ways(labeled)
if result[1] not in matches[result[0]]:
matches[result[0]].append((result[1], result[2]))
if debug == True:
for k, v in matches.items():
print(k[0], [(x[0][0], x[1]) for x in v])
return matches
if __name__ == '__main__':
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
labeled = list(parse_data(data))
expected_pairs = 3
matches = compare_all_pairs_both_ways(labeled, debug=True)
#matches = itertools_combinations(labeled)
if len(matches) != expected_pairs:
print("warning! expected {} but found {}".format(
expected_pairs, len(matches)))
#to make a graph with Gephi:
matches_to_graph(matches)
#to make results file for Rosalind
matches_to_rosalind(matches)
def test_old_parser(self):
parsed = list(parse_data(self.big_data))
self.assertEqual(len(parsed), 100)
def test_raw_parsing_one(self):
self.assertEqual(len(self.data[1].strip() + self.data[2].strip()), 87)
name, sequence = parse_data(self.data)
self.assertEqual(name, 'Rosalind_0808')
self.assertEqual(len(sequence), 87)
def test_multiple_sequences(self):
name, sequence = parse_data(self.big_data)
self.assertEqual(name, 'Rosalind_0808')
name, percent = gc_content(name, sequence, debug=True)
self.assertEqual(percent, 60.919540)
def test_old_parser(self):
parsed = list(parse_data(self.big_data))
self.assertEqual(len(parsed), 100)
def setUp(cls):
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
cls.labeled = list(parse_data(data))
def setUp(cls):
with open('CENPA_3chunks.txt', 'r') as f:
data = f.readlines()
labeled = list(parse_data(data))
cls.matches = compare_all_pairs_both_ways(labeled)