def test_extract_partitions_output_unassigned():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = _make_graph(
seqfile, do_partition=True, annotate_partitions=True)
in_dir = os.path.dirname(graphbase)
# get the final part file
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['-U', 'extracted', partfile]
utils.runscript(script, args, in_dir)
distfile = os.path.join(in_dir, 'extracted.dist')
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
unassigned_file = os.path.join(in_dir, 'extracted.unassigned.fa')
assert os.path.exists(distfile)
assert os.path.exists(groupfile)
assert os.path.exists(unassigned_file)
dist = open(distfile).readline()
assert dist.strip() == '99 1 1 99'
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
assert len(parts) == 99, len(parts)
parts = set(parts)
assert len(parts) == 1, len(parts)
def test_make_initial_stoptags():
# gen input files using load-graph.py -t
# should keep test_data directory size down
# or something like that
# this assumes (obv.) load-graph works properly
bzinfile = utils.get_temp_filename('test-reads.fq.bz2')
shutil.copyfile(utils.get_test_data('test-reads.fq.bz2'), bzinfile)
in_dir = os.path.dirname(bzinfile)
genscript = scriptpath('load-graph.py')
genscriptargs = ['-t', 'test-reads', 'test-reads.fq.bz2']
utils.runscript(genscript, genscriptargs, in_dir)
# test input file gen'd by load-graphs
infile = utils.get_temp_filename('test-reads.pt')
infile2 = utils.get_temp_filename('test-reads.tagset', in_dir)
# get file to compare against
ex_outfile = utils.get_test_data('test-reads.stoptags')
# actual output file
outfile1 = utils.get_temp_filename('test-reads.stoptags', in_dir)
script = scriptpath('make-initial-stoptags.py')
# make-initial-stoptags has weird file argument syntax
# read the code before modifying
args = ['test-reads']
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
def test_extract_paired_reads_1_fa():
# test input file
infile = utils.get_test_data('paired-mixed.fa')
ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe')
ex_outfile2 = utils.get_test_data('paired-mixed.fa.se')
# actual output files...
outfile1 = utils.get_temp_filename('paired-mixed.fa.pe')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired-mixed.fa.se', in_dir)
script = scriptpath('extract-paired-reads.py')
args = [infile]
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
def test_feature_extraction_metamark():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('example.mito.fasta.shreded.subset'),
infile)
outfile = infile + '.metamark_vector'
script = scriptpath('feature_extraction_metamark.py')
mmp = os.path.abspath("../scripts/gm_parameters/par_11.modified")
print mmp
tmp = os.path.abspath("./")
print tmp
print in_dir
args = [
"--input", infile, "--outfile", outfile, "--tmp", tmp, "--mmp", mmp,
"--taxid", "12345"
]
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile), outfile
print outfile
data = [x.strip() for x in open(outfile)]
print len(data)
assert len(data) == 30
assert data[1].startswith("12345\tgi|511782593|ref|NC_021399.1") == True
assert data[0].endswith("0.018679\t0.016415\t0.016415") == True
assert data[-1].startswith(
"12345\tgi|511782593|ref|NC_021399.1||pos|295582..300582") == True
assert data[-1].endswith("0.023325\t0.019296\t0.021310") == True
utils.cleanup()
def test_filter_stoptags():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
stopfile = utils.get_temp_filename('stoptags', in_dir)
# first, copy test-abund-read-2.fa to 'test.fa' in the temp dir.
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
# now, create a file with some stop tags in it --
K = 18
kh = khmer.new_hashbits(K, 1, 1)
kh.add_stop_tag('GTTGACGGGGCTCAGGGG')
kh.save_stop_tags(stopfile)
del kh
# finally, run filter-stoptags.
script = scriptpath('filter-stoptags.py')
args = ['-k', str(K), stopfile, infile, infile]
utils.runscript(script, args, in_dir)
# verify that the basic output file exists
outfile = infile + '.stopfilt'
assert os.path.exists(outfile), outfile
# it should contain only one unique sequence, because we've trimmed
# off everything after the beginning of the only long sequence in there.
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 1, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs, seqs
def test_extract_partitions_output_unassigned():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = _make_graph(seqfile,
do_partition=True,
annotate_partitions=True)
in_dir = os.path.dirname(graphbase)
# get the final part file
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['-U', 'extracted', partfile]
utils.runscript(script, args, in_dir)
distfile = os.path.join(in_dir, 'extracted.dist')
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
unassigned_file = os.path.join(in_dir, 'extracted.unassigned.fa')
assert os.path.exists(distfile)
assert os.path.exists(groupfile)
assert os.path.exists(unassigned_file)
dist = open(distfile).readline()
assert dist.strip() == '99 1 1 99'
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
assert len(parts) == 99, len(parts)
parts = set(parts)
assert len(parts) == 1, len(parts)
def test_abund_dist_gz_bigcount():
infile = utils.get_temp_filename('test.fa')
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
outfile = utils.get_temp_filename('test_ct.gz')
script = scriptpath('load-into-counting.py')
htfile = utils.get_temp_filename('test_ct')
args = ['-x', str(1e7), '-N', str(2), '-k', str(2), htfile, infile]
utils.runscript(script, args) # create a bigcount table
assert os.path.exists(htfile)
data = open(htfile, 'rb').read()
f_out = gzip.open(outfile, 'wb') # compress the created bigcount table
f_out.write(data)
f_out.close()
# load the compressed bigcount table
counting_hash = khmer.load_counting_hash(outfile)
hashsizes = counting_hash.hashsizes()
kmer_size = counting_hash.ksize()
tracking = khmer._Hashbits(kmer_size, hashsizes)
abundances = counting_hash.abundance_distribution(infile, tracking)
# calculate abundance distribution for compressed bigcount table
flag = False
# check if abundance is > 255
# if ok gzipped bigcount was loaded correctly
for _, i in enumerate(abundances):
print _, i
if _ > 255 and i > 0:
flag = True
break
assert flag
def test_split_paired_reads_2_fq():
# test input file
infile = utils.get_test_data('paired.fq')
ex_outfile1 = utils.get_test_data('paired.fq.1')
ex_outfile2 = utils.get_test_data('paired.fq.2')
# actual output files...
outfile1 = utils.get_temp_filename('paired.fq.1')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired.fq.2', in_dir)
script = scriptpath('split-paired-reads.py')
args = [infile]
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
def test_extract_long_sequences():
script = scriptpath('extract-long-sequences.py')
fq_infile = utils.get_temp_filename('test.fq')
fa_infile = utils.get_temp_filename('test.fa')
shutil.copyfile(utils.get_test_data('paired-mixed.fq'), fq_infile)
shutil.copyfile(utils.get_test_data('paired-mixed.fa'), fa_infile)
fq_outfile = fq_infile + '.keep.fq'
fa_outfile = fa_infile + '.keep.fa'
in_dir_fq = os.path.dirname(fq_infile)
in_dir_fa = os.path.dirname(fa_infile)
args = [fq_infile, '-l', '10', '-o', 'fq_outfile']
(status, out, err) = utils.runscript(script, args, in_dir_fa)
countlines = sum(1 for line in open(fq_infile))
assert countlines == 44, countlines
args = [fa_infile, '-l', '10', '-o', 'fa_outfile']
(status, out, err) = utils.runscript(script, args, in_dir_fa)
countlines = sum(1 for line in open(fa_infile))
assert countlines == 22, countlines
def test_partition_graph_nojoin_stoptags():
# test with stoptags
graphbase = _make_graph(utils.get_test_data('random-20-a.fa'))
# add in some stop tags
ht = khmer.load_hashbits(graphbase + '.pt')
ht.add_stop_tag('TTGCATACGTTGAGCCAGCG')
stoptags_file = graphbase + '.stoptags'
ht.save_stop_tags(stoptags_file)
del ht
# run script with stoptags option
script = scriptpath('partition-graph.py')
args = ['--stoptags', stoptags_file, graphbase]
utils.runscript(script, args)
script = scriptpath('merge-partitions.py')
args = [graphbase, '-k', str(20)]
utils.runscript(script, args)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x == (2, 0), x # should be 2 partitions
def test_extract_long_sequences():
script = scriptpath('extract-long-sequences.py')
fq_infile = utils.get_temp_filename('test.fq')
fa_infile = utils.get_temp_filename('test.fa')
shutil.copyfile(utils.get_test_data('paired-mixed.fq'), fq_infile)
shutil.copyfile(utils.get_test_data('paired-mixed.fa'), fa_infile)
fq_outfile = fq_infile + '.keep.fq'
fa_outfile = fa_infile + '.keep.fa'
in_dir_fq = os.path.dirname(fq_infile)
in_dir_fa = os.path.dirname(fa_infile)
args = [fq_infile, '-l', '10', '-o', 'fq_outfile']
(status, out, err) = utils.runscript(script, args, in_dir_fa)
countlines = sum(1 for line in open(fq_infile))
assert countlines == 44, countlines
args = [fa_infile, '-l', '10', '-o', 'fa_outfile']
(status, out, err) = utils.runscript(script, args, in_dir_fa)
countlines = sum(1 for line in open(fa_infile))
assert countlines == 22, countlines
def test_partition_graph_nojoin_stoptags():
# test with stoptags
graphbase = _make_graph(utils.get_test_data('random-20-a.fa'))
# add in some stop tags
ht = khmer.load_hashbits(graphbase + '.pt')
ht.add_stop_tag('TTGCATACGTTGAGCCAGCG')
stoptags_file = graphbase + '.stoptags'
ht.save_stop_tags(stoptags_file)
del ht
# run script with stoptags option
script = scriptpath('partition-graph.py')
args = ['--stoptags', stoptags_file, graphbase]
utils.runscript(script, args)
script = scriptpath('merge-partitions.py')
args = [graphbase, '-k', str(20)]
utils.runscript(script, args)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x == (2, 0), x # should be 2 partitions
def test_make_initial_stoptags():
# gen input files using load-graph.py -t
# should keep test_data directory size down
# or something like that
# this assumes (obv.) load-graph works properly
bzinfile = utils.get_temp_filename('test-reads.fq.bz2')
shutil.copyfile(utils.get_test_data('test-reads.fq.bz2'), bzinfile)
in_dir = os.path.dirname(bzinfile)
genscript = scriptpath('load-graph.py')
genscriptargs = ['-t', 'test-reads', 'test-reads.fq.bz2']
utils.runscript(genscript, genscriptargs, in_dir)
# test input file gen'd by load-graphs
infile = utils.get_temp_filename('test-reads.pt')
infile2 = utils.get_temp_filename('test-reads.tagset', in_dir)
# get file to compare against
ex_outfile = utils.get_test_data('test-reads.stoptags')
# actual output file
outfile1 = utils.get_temp_filename('test-reads.stoptags', in_dir)
script = scriptpath('make-initial-stoptags.py')
# make-initial-stoptags has weird file argument syntax
# read the code before modifying
args = ['test-reads']
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
def test_abund_dist_gz_bigcount():
infile = utils.get_temp_filename('test.fa')
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
outfile = utils.get_temp_filename('test_ct.gz')
script = scriptpath('load-into-counting.py')
htfile = utils.get_temp_filename('test_ct')
args = ['-x', str(1e7), '-N', str(2), '-k', str(2), htfile, infile]
utils.runscript(script, args) # create a bigcount table
assert os.path.exists(htfile)
data = open(htfile, 'rb').read()
f_out = gzip.open(outfile, 'wb') # compress the created bigcount table
f_out.write(data)
f_out.close()
# load the compressed bigcount table
counting_hash = khmer.load_counting_hash(outfile)
hashsizes = counting_hash.hashsizes()
kmer_size = counting_hash.ksize()
tracking = khmer._Hashbits(kmer_size, hashsizes)
abundances = counting_hash.abundance_distribution(infile, tracking)
# calculate abundance distribution for compressed bigcount table
flag = False
# check if abundance is > 255
# if ok gzipped bigcount was loaded correctly
for _, i in enumerate(abundances):
print _, i
if _ > 255 and i > 0:
flag = True
break
assert flag
def test_split_paired_reads_2_fq():
# test input file
infile = utils.get_test_data('paired.fq')
ex_outfile1 = utils.get_test_data('paired.fq.1')
ex_outfile2 = utils.get_test_data('paired.fq.2')
# actual output files...
outfile1 = utils.get_temp_filename('paired.fq.1')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired.fq.2', in_dir)
script = scriptpath('split-paired-reads.py')
args = [infile]
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
def test_feature_extraction_kmer():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('example.mito.fasta.shreded.subset'),
infile)
outfile = infile + '.kmer_vector'
script = scriptpath('feature_extraction_kmer.py')
mmp = os.path.abspath("../scripts/gm_parameters/par_11.modified")
print mmp
tmp = os.path.abspath("./")
print tmp
print in_dir
args = [
"--input", infile, "--outfile", outfile, "--taxid", "12345", "--label",
"taxid"
]
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile), outfile
print outfile
data = [x.strip() for x in open(outfile)]
print len(data)
assert len(data) == 54
assert data[1].startswith("12345\tgi|511782593|ref|NC_021399.1") == True
assert data[0].endswith(
"0.00300180108065\t0.00640384230538\t0.00380228136882") == True
assert data[-1].startswith(
"12345\tgi|511782593|ref|NC_021399.1||pos|304493..309493") == True
assert data[-1].endswith(
"0.00300180108065\t0.00500300180108\t0.00200120072043") == True
utils.cleanup()
def test_filter_stoptags():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
stopfile = utils.get_temp_filename('stoptags', in_dir)
# first, copy test-abund-read-2.fa to 'test.fa' in the temp dir.
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
# now, create a file with some stop tags in it --
K = 18
kh = khmer.new_hashbits(K, 1, 1)
kh.add_stop_tag('GTTGACGGGGCTCAGGGG')
kh.save_stop_tags(stopfile)
del kh
# finally, run filter-stoptags.
script = scriptpath('filter-stoptags.py')
args = ['-k', str(K), stopfile, infile, infile]
utils.runscript(script, args, in_dir)
# verify that the basic output file exists
outfile = infile + '.stopfilt'
assert os.path.exists(outfile), outfile
# it should contain only one unique sequence, because we've trimmed
# off everything after the beginning of the only long sequence in there.
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 1, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs, seqs
def test_extract_paired_reads_1_fa():
# test input file
infile = utils.get_test_data('paired-mixed.fa')
ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe')
ex_outfile2 = utils.get_test_data('paired-mixed.fa.se')
# actual output files...
outfile1 = utils.get_temp_filename('paired-mixed.fa.pe')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired-mixed.fa.se', in_dir)
script = scriptpath('extract-paired-reads.py')
args = [infile]
utils.runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
def test_sample_reads_randomly_S():
infile = utils.get_temp_filename('test.fq')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile)
script = scriptpath('sample-reads-randomly.py')
# fix random number seed for reproducibility
args = ['-N', '10', '-R', '1', '-S', '3']
badargs = list(args)
badargs.extend(['-o', 'test', 'test.fq', 'test.fq'])
(status, out, err) = utils.runscript(script, badargs, in_dir, fail_ok=True)
assert status == -1, (status, out, err)
args.append('test.fq')
utils.runscript(script, args, in_dir)
outfile = infile + '.subset.0'
assert os.path.exists(outfile), outfile
seqs = set([r.name for r in screed.open(outfile)])
print seqs
assert seqs == set([
'895:1:1:1298:13380', '895:1:1:1347:3237', '895:1:1:1295:6189',
'895:1:1:1342:11001', '895:1:1:1252:19493', '895:1:1:1318:10532',
'895:1:1:1314:10430', '895:1:1:1347:8723', '895:1:1:1381:4958',
'895:1:1:1338:6614'
])
outfile = infile + '.subset.1'
assert os.path.exists(outfile), outfile
seqs = set([r.name for r in screed.open(outfile)])
print seqs
assert seqs == set([
'895:1:1:1384:20217', '895:1:1:1347:3237', '895:1:1:1348:18672',
'895:1:1:1290:11501', '895:1:1:1386:7536', '895:1:1:1373:13994',
'895:1:1:1355:13535', '895:1:1:1303:6251', '895:1:1:1381:4958',
'895:1:1:1338:6614'
])
outfile = infile + '.subset.2'
assert os.path.exists(outfile), outfile
seqs = set([r.name for r in screed.open(outfile)])
print seqs
assert seqs == set([
'895:1:1:1326:7273', '895:1:1:1384:20217', '895:1:1:1347:3237',
'895:1:1:1353:6642', '895:1:1:1340:19387', '895:1:1:1252:19493',
'895:1:1:1381:7062', '895:1:1:1383:3089', '895:1:1:1342:20695',
'895:1:1:1303:6251'
])
def test_normalize_by_median_impaired():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-impaired.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-p', '-k', '17', infile]
utils.runscript(script, args, in_dir, fail_ok=True)
def test_normalize_by_median_impaired():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-impaired.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-p', '-k', '17', infile]
utils.runscript(script, args, in_dir, fail_ok=True)
def test_sample_reads_randomly_S():
infile = utils.get_temp_filename('test.fq')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile)
script = scriptpath('sample-reads-randomly.py')
# fix random number seed for reproducibility
args = ['-N', '10', '-R', '1', '-S', '3']
badargs = list(args)
badargs.extend(['-o', 'test', 'test.fq', 'test.fq'])
(status, out, err) = utils.runscript(script, badargs, in_dir, fail_ok=True)
assert status == -1, (status, out, err)
args.append('test.fq')
utils.runscript(script, args, in_dir)
outfile = infile + '.subset.0'
assert os.path.exists(outfile), outfile
seqs = set([r.name for r in screed.open(outfile)])
print seqs
assert seqs == set(['895:1:1:1298:13380', '895:1:1:1347:3237',
'895:1:1:1295:6189', '895:1:1:1342:11001',
'895:1:1:1252:19493', '895:1:1:1318:10532',
'895:1:1:1314:10430', '895:1:1:1347:8723',
'895:1:1:1381:4958', '895:1:1:1338:6614'])
outfile = infile + '.subset.1'
assert os.path.exists(outfile), outfile
seqs = set([r.name for r in screed.open(outfile)])
print seqs
assert seqs == set(['895:1:1:1384:20217', '895:1:1:1347:3237',
'895:1:1:1348:18672', '895:1:1:1290:11501',
'895:1:1:1386:7536', '895:1:1:1373:13994',
'895:1:1:1355:13535', '895:1:1:1303:6251',
'895:1:1:1381:4958', '895:1:1:1338:6614'])
outfile = infile + '.subset.2'
assert os.path.exists(outfile), outfile
seqs = set([r.name for r in screed.open(outfile)])
print seqs
assert seqs == set(['895:1:1:1326:7273', '895:1:1:1384:20217',
'895:1:1:1347:3237', '895:1:1:1353:6642',
'895:1:1:1340:19387', '895:1:1:1252:19493',
'895:1:1:1381:7062', '895:1:1:1383:3089',
'895:1:1:1342:20695', '895:1:1:1303:6251'])
def test_trim_low_abund_1_duplicate_filename_err():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
args = ["-k", "17", "-x", "1e7", "-N", "2", '-C', '1', infile, infile]
try:
utils.runscript('trim-low-abund.py', args, in_dir, sandbox=True)
raise Exception("should not reach this")
except AssertionError:
# an error should be raised by passing 'infile' twice.
pass
def test_trim_low_abund_1_duplicate_filename_err():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
args = ["-k", "17", "-x", "1e7", "-N", "2", '-C', '1', infile, infile]
try:
utils.runscript('trim-low-abund.py', args, in_dir, sandbox=True)
raise Exception("should not reach this")
except AssertionError:
# an error should be raised by passing 'infile' twice.
pass
def test_normalize_by_median_empty():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-empty.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-k', '17', infile]
utils.runscript(script, args, in_dir)
outfile = infile + '.keep'
assert os.path.exists(outfile), outfile
def test_normalize_by_median_empty():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-empty.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-k', '17', infile]
utils.runscript(script, args, in_dir)
outfile = infile + '.keep'
assert os.path.exists(outfile), outfile
def test_trim_low_abund_4_retain_low_abund():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
args = ["-k", "17", "-x", "1e7", "-N", "2", '-V', infile]
utils.runscript('trim-low-abund.py', args, in_dir, sandbox=True)
outfile = infile + '.abundtrim'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 2, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def test_trim_low_abund_4_retain_low_abund():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
args = ["-k", "17", "-x", "1e7", "-N", "2", '-V', infile]
utils.runscript('trim-low-abund.py', args, in_dir, sandbox=True)
outfile = infile + '.abundtrim'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 2, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def _make_counting(infilename, SIZE=1e7, N=2, K=20, BIGCOUNT=True):
script = scriptpath('load-into-counting.py')
args = ['-x', str(SIZE), '-N', str(N), '-k', str(K)]
if not BIGCOUNT:
args.append('-b')
outfile = utils.get_temp_filename('out.kh')
args.extend([outfile, infilename])
utils.runscript(script, args)
assert os.path.exists(outfile)
return outfile
def _make_counting(infilename, SIZE=1e7, N=2, K=20, BIGCOUNT=True):
script = scriptpath('load-into-counting.py')
args = ['-x', str(SIZE), '-N', str(N), '-k', str(K)]
if not BIGCOUNT:
args.append('-b')
outfile = utils.get_temp_filename('out.kh')
args.extend([outfile, infilename])
utils.runscript(script, args)
assert os.path.exists(outfile)
return outfile
def test_sweep_reads_3():
infile = utils.get_temp_filename('seqs.fa')
shutil.copyfile(utils.get_test_data('random-20-a.fa'), infile)
wdir = os.path.dirname(infile)
script = scriptpath('sweep-reads.py')
args = ['-m', '75', '-k', '20', '-l', '1', '--prefix',
'test', '--label-by-group', '10', infile, infile]
status, out, err = utils.runscript(script, args, wdir, sandbox=True)
for i in xrange(10):
p = os.path.join(wdir, 'test_{i}.fa'.format(i=i))
print p, err, out
assert os.path.exists(p)
os.remove(p)
counts_fn = os.path.join(wdir, 'test.counts.csv')
with open(counts_fn) as cfp:
for line in cfp:
_, _, c = line.partition(',')
assert int(c) in [9, 10]
assert os.path.exists(counts_fn)
assert os.path.exists(os.path.join(wdir, 'test.dist.txt'))
assert not os.path.exists(os.path.join(wdir, 'test_multi.fa'))
def test_load_graph():
script = scriptpath('load-graph.py')
args = ['-x', '1e7', '-N', '2', '-k', '20', '-t']
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
(status, out, err) = utils.runscript(script, args)
assert 'Total number of k-mers: 3959' in err, err
ht_file = outfile + '.pt'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert os.path.exists(tagset_file), tagset_file
ht = khmer.load_hashbits(ht_file)
ht.load_tagset(tagset_file)
# check to make sure we get the expected result for this data set
# upon partitioning (all in one partition). This is kind of a
# roundabout way of checking that load-graph worked :)
subset = ht.do_subset_partition(0, 0)
x = ht.subset_count_partitions(subset)
assert x == (1, 0), x
def test_normalize_by_median_dumpfrequency():
CUTOFF = '1'
infiles = [utils.get_temp_filename('test-0.fq')]
in_dir = os.path.dirname(infiles[0])
for x in range(1, 5):
infiles.append(
utils.get_temp_filename('test-{x}.fq'.format(x=x), tempdir=in_dir))
for infile in infiles:
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-d', '2', '-C', CUTOFF, '-k', '17']
args.extend(infiles)
(status, out, err) = utils.runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(os.path.join(in_dir, 'backup.ct'))
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(os.path.join(in_dir, 'backup.ct'))
assert out.count('Backup: Saving') == 2
assert 'Nothing' in out
def test_do_partition():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = utils.get_temp_filename('out')
in_dir = os.path.dirname(graphbase)
script = scriptpath('do-partition.py')
args = ["-k", "20", graphbase, seqfile]
utils.runscript(script, args, in_dir)
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
parts = set(parts)
assert '2' in parts
assert len(parts) == 1
def test_count_overlap():
seqfile1 = utils.get_temp_filename('test-overlap1.fa')
in_dir = os.path.dirname(seqfile1)
seqfile2 = utils.get_temp_filename('test-overlap2.fa', in_dir)
outfile = utils.get_temp_filename('overlap.out', in_dir)
curvefile = utils.get_temp_filename('overlap.out.curve', in_dir)
shutil.copy(utils.get_test_data('test-overlap1.fa'), seqfile1)
shutil.copy(utils.get_test_data('test-overlap2.fa'), seqfile2)
htfile = _make_graph(seqfile1, ksize=20)
script = scriptpath('count-overlap.py')
args = ['--ksize', '20', '--n_tables', '2', '--min-tablesize', '10000000',
htfile + '.pt', seqfile2, outfile]
(status, out, err) = utils.runscript(script, args, in_dir)
assert status == 0
assert os.path.exists(outfile), outfile
data = [x.strip() for x in open(outfile)]
data = set(data)
assert '# of unique k-mers in dataset2: 759047' in data
assert '# of overlap unique k-mers: 245621' in data
assert os.path.exists(curvefile), curvefile
data = [x.strip() for x in open(curvefile)]
data = set(data)
assert '178633 1155' in data
assert '496285 2970' in data
assert '752053 238627' in data
def test_normalize_by_median_force():
CUTOFF = '1'
corrupt_infile = utils.get_temp_filename('test-corrupt.fq')
good_infile = utils.get_temp_filename(
'test-good.fq', tempdir=os.path.dirname(corrupt_infile))
in_dir = os.path.dirname(good_infile)
shutil.copyfile(utils.get_test_data('test-error-reads.fq'), corrupt_infile)
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), good_infile)
script = scriptpath('normalize-by-median.py')
args = ['-f', '-C', CUTOFF, '-k', '17', corrupt_infile, good_infile]
(status, out, err) = utils.runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(corrupt_infile + '.ct.failed')
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(corrupt_infile + '.ct.failed')
assert '*** Skipping' in err
assert '** IOErrors' in err
def test_count_overlap():
seqfile1 = utils.get_temp_filename('test-overlap1.fa')
in_dir = os.path.dirname(seqfile1)
seqfile2 = utils.get_temp_filename('test-overlap2.fa', in_dir)
outfile = utils.get_temp_filename('overlap.out', in_dir)
curvefile = utils.get_temp_filename('overlap.out.curve', in_dir)
shutil.copy(utils.get_test_data('test-overlap1.fa'), seqfile1)
shutil.copy(utils.get_test_data('test-overlap2.fa'), seqfile2)
htfile = _make_graph(seqfile1, ksize=20)
script = scriptpath('count-overlap.py')
args = [
'--ksize', '20', '--n_tables', '2', '--min-tablesize', '10000000',
htfile + '.pt', seqfile2, outfile
]
(status, out, err) = utils.runscript(script, args, in_dir)
assert status == 0
assert os.path.exists(outfile), outfile
data = [x.strip() for x in open(outfile)]
data = set(data)
assert '# of unique k-mers in dataset2: 759047' in data
assert '# of overlap unique k-mers: 245621' in data
assert os.path.exists(curvefile), curvefile
data = [x.strip() for x in open(curvefile)]
data = set(data)
assert '178633 1155' in data
assert '496285 2970' in data
assert '752053 238627' in data
def test_normalize_by_median_force():
CUTOFF = '1'
corrupt_infile = utils.get_temp_filename('test-corrupt.fq')
good_infile = utils.get_temp_filename('test-good.fq',
tempdir=os.path.dirname(
corrupt_infile))
in_dir = os.path.dirname(good_infile)
shutil.copyfile(utils.get_test_data('test-error-reads.fq'), corrupt_infile)
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), good_infile)
script = scriptpath('normalize-by-median.py')
args = ['-f', '-C', CUTOFF, '-k', '17', corrupt_infile, good_infile]
(status, out, err) = utils.runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(corrupt_infile + '.ct.failed')
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(corrupt_infile + '.ct.failed')
assert '*** Skipping' in err
assert '** IOErrors' in err
def test_load_graph():
script = scriptpath('load-graph.py')
args = ['-x', '1e7', '-N', '2', '-k', '20', '-t']
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
(status, out, err) = utils.runscript(script, args)
assert 'Total number of k-mers: 3959' in err, err
ht_file = outfile + '.pt'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert os.path.exists(tagset_file), tagset_file
ht = khmer.load_hashbits(ht_file)
ht.load_tagset(tagset_file)
# check to make sure we get the expected result for this data set
# upon partitioning (all in one partition). This is kind of a
# roundabout way of checking that load-graph worked :)
subset = ht.do_subset_partition(0, 0)
x = ht.subset_count_partitions(subset)
assert x == (1, 0), x
def test_normalize_by_median_dumpfrequency():
CUTOFF = '1'
infiles = [utils.get_temp_filename('test-0.fq')]
in_dir = os.path.dirname(infiles[0])
for x in range(1, 5):
infiles.append(utils.get_temp_filename('test-{x}.fq'.format(x=x),
tempdir=in_dir))
for infile in infiles:
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-d', '2', '-C', CUTOFF, '-k', '17']
args.extend(infiles)
(status, out, err) = utils.runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(os.path.join(in_dir, 'backup.ct'))
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(os.path.join(in_dir, 'backup.ct'))
assert out.count('Backup: Saving') == 2
assert 'Nothing' in out
def test_sweep_reads_3():
infile = utils.get_temp_filename('seqs.fa')
shutil.copyfile(utils.get_test_data('random-20-a.fa'), infile)
wdir = os.path.dirname(infile)
script = scriptpath('sweep-reads.py')
args = ['-m', '75', '-k', '20', '-l', '1', '--prefix',
'test', '--label-by-group', '10', infile, infile]
status, out, err = utils.runscript(script, args, wdir, sandbox=True)
for i in xrange(10):
p = os.path.join(wdir, 'test_{i}.fa'.format(i=i))
print p, err, out
assert os.path.exists(p)
os.remove(p)
counts_fn = os.path.join(wdir, 'test.counts.csv')
with open(counts_fn) as cfp:
for line in cfp:
_, _, c = line.partition(',')
assert int(c) in [9, 10]
assert os.path.exists(counts_fn)
assert os.path.exists(os.path.join(wdir, 'test.dist.txt'))
assert not os.path.exists(os.path.join(wdir, 'test_multi.fa'))
def test_do_partition():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = utils.get_temp_filename('out')
in_dir = os.path.dirname(graphbase)
script = scriptpath('do-partition.py')
args = ["-k", "20", graphbase, seqfile]
utils.runscript(script, args, in_dir)
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
parts = set(parts)
assert '2' in parts
assert len(parts) == 1
def test_abundance_dist_single_nobigcount():
infile = utils.get_temp_filename('test.fa')
outfile = utils.get_temp_filename('test.dist')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
script = scriptpath('abundance-dist-single.py')
args = ['-x', '1e7', '-N', '2', '-k', '17', '-z', '-b', infile, outfile]
utils.runscript(script, args, in_dir)
fp = iter(open(outfile))
line = fp.next().strip()
assert line == '1 96 96 0.98', line
line = fp.next().strip()
assert line == '255 2 98 1.0', line
def test_normalize_by_median_indent():
infile = utils.get_test_data('paired-mixed.fa.pe')
hashfile = utils.get_test_data('normC20k20.kh')
script = scriptpath('normalize-by-median.py')
args = ['--loadtable', hashfile, infile]
(status, out, err) = utils.runscript(script, args)
assert status == 0, (out, err)
print(out, err)
def test_extract_partitions_no_groups():
empty_file = utils.get_temp_filename('empty-file')
basefile = utils.get_test_data('empty-file')
shutil.copyfile(basefile, empty_file)
in_dir = os.path.dirname(empty_file)
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['extracted', empty_file]
utils.runscript(script, args, in_dir, fail_ok=True)
# No group files should be created
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
assert not os.path.exists(groupfile)
def test_filter_abund_2():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
counting_ht = _make_counting(infile, K=17)
script = scriptpath('filter-abund.py')
args = ['-C', '1', counting_ht, infile, infile]
utils.runscript(script, args, in_dir)
outfile = infile + '.abundfilt'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 2, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def test_load_graph_multithread():
script = scriptpath('load-graph.py')
outfile = utils.get_temp_filename('test')
infile = utils.get_test_data('test-reads.fa')
args = ['-N', '4', '-x', '1e9', '-T', '8', outfile, infile]
(status, out, err) = utils.runscript(script, args)
def test_count_median():
infile = utils.get_temp_filename('test.fa')
outfile = infile + '.counts'
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
counting_ht = _make_counting(infile, K=8)
script = scriptpath('count-median.py')
args = [counting_ht, infile, outfile]
utils.runscript(script, args)
assert os.path.exists(outfile), outfile
data = [x.strip() for x in open(outfile)]
data = set(data)
assert len(data) == 2, data
assert 'seq 1001 1001.0 0.0 18' in data
assert '895:1:37:17593:9954/1 1 103.803741455 303.702941895 114' in data
def test_abundance_dist_nobigcount():
infile = utils.get_temp_filename('test.fa')
outfile = utils.get_temp_filename('test.dist')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
htfile = _make_counting(infile, K=17, BIGCOUNT=False)
script = scriptpath('abundance-dist.py')
args = ['-z', htfile, infile, outfile]
utils.runscript(script, args, in_dir)
fp = iter(open(outfile))
line = fp.next().strip()
assert line == '1 96 96 0.98', line
line = fp.next().strip()
assert line == '255 2 98 1.0', line
def test_load_graph_no_tags():
script = scriptpath('load-graph.py')
args = ['-x', '1e7', '-N', '2', '-k', '20', '-n']
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
utils.runscript(script, args)
ht_file = outfile + '.pt'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert not os.path.exists(tagset_file), tagset_file
assert khmer.load_hashbits(ht_file)