Example #1
0
def update():

	dbConn = DatabaseConn()
	db = dbConn.databaseConnect()
	
	cursor = db.cursor()
	hostname = dbConn.getHostname()

	form = cgi.FieldStorage(keep_blank_values="True")
	
	print "Content-type:text/html"		# REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
	print					# DITTO
	#print `form`

	# Aug 29/07
	uHandler = UserHandler(db, cursor)
	
	if form.has_key("curr_username"):
		# store the user ID for use throughout the session; add to other views in addition to create in PHP
		currUname = form.getvalue("curr_username")
		currUser = uHandler.getUserByDescription(currUname)
		
		Session.setUser(currUser)
		
	#else:	# debug
		#currUname = 'Administrator'
		#currUser = uHandler.getUserByDescription(currUname)
		
		#Session.setUser(currUser)
		
	if form.has_key("cloning_method"):
		cloning_method = form.getvalue("cloning_method")
	
	#else:	# debug
		#cloning_method = '1'
		
	# Handlers and mappers
	rHandler = ReagentHandler(db, cursor)
	#sHandler = SystemSetHandler(db, cursor)
	pHandler = ReagentPropertyHandler(db, cursor)
	raHandler = ReagentAssociationHandler(db, cursor)
	aHandler = AssociationHandler(db, cursor)

	dnaHandler = DNAHandler(db, cursor)
	commHandler = CommentHandler(db, cursor)
	protHandler = ProteinHandler(db, cursor)	
	
	propMapper = ReagentPropertyMapper(db, cursor)
	assocMapper = ReagentAssociationMapper(db, cursor)

	# August 29/07: Restrict creation by user and project access
	packetHandler = ProjectDatabaseHandler(db, cursor)

	########################################################
	# Various maps
	########################################################

	prop_Alias_ID_Map = propMapper.mapPropAliasID()		# (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
	prop_Name_Alias_Map = propMapper.mapPropNameAlias()	# (propName, propAlias)
	prop_Name_ID_Map = propMapper.mapPropNameID()		# (prop name, prop id)

	
	# Restriction sites
	fpcs_prop_id = pHandler.findPropID("5' cloning site")
	tpcs_prop_id = pHandler.findPropID("3' cloning site")

	newFivePrime = form.getvalue("fpcs")
	newThreePrime = form.getvalue("tpcs")

	gatewaySites = ['attb', 'attl', 'attp', 'attr']		# nov. 16/07
	
	# resulting sequence
	newSeq = ""

	# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
	currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader')
	currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer')
	publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
	
	# list of Packet OBJECTS
	currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj)
	
	uPackets = []
	
	for p in currUserWriteProjects:
		uPackets.append(p.getNumber())

	# Get project IDs of parents
	packetPropID = pHandler.findPropID("packet id")

		
	# August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
	newSeq = ""
	
	# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
	currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader')
	currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer')
	publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
	
	# list of Packet OBJECTS
	currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj)
	
	uPackets = []
	
	for p in currUserWriteProjects:
		uPackets.append(p.getNumber())
	
	# Get project IDs of parents
	packetPropID = pHandler.findPropID("packet id")
	
	if form.has_key("PV"):
		pvVal = form.getvalue("PV")
	
		if len(pvVal) > 0:
			pvID = rHandler.convertReagentToDatabaseID(pvVal)
	
			try:
				pvProjectID = int(rHandler.findSimplePropertyValue(pvID, packetPropID))
				pvSeqID = rHandler.findDNASequenceKey(pvID)	# get sequence for reconstitution later
			except TypeError:
				#pvProjectID = 0
				e = PVProjectAccessException("You are not authorized to use this Parent Vector, since you do not have Read access to its project.")
				print `e.err_code()`
		else:
			e = UnknownPVIDException("Unknown Parent Vector value")
			print `e.err_code()`
			return
			
	# else don't do anything, maybe want to delete parents!!!
	#else:
		#e = MissingPVException("No Parent Vector provided")
		#print `e.err_code()`
	
	
	if pvProjectID > 0 and currUser.getCategory() != 'Admin' and pvProjectID not in uPackets:
		e = PVProjectAccessException("Not authorized to access parent")
		print `e.err_code()`
		return
	
	if cloning_method == '1':
		
		# Non-recombination vector - Get the Insert
		if form.has_key("I"):
			insertVal = form.getvalue("I")
			
			if len(insertVal) > 0:
				insertID = rHandler.convertReagentToDatabaseID(insertVal)
				insertSeqID = rHandler.findDNASequenceKey(insertID)	# fetch Insert sequence for reconstitution later
				
				try:
					insertProjectID = int(rHandler.findSimplePropertyValue(insertID, packetPropID))
					
				except TypeError:
					#insertProjectID = 0
					e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.")
					print `e.err_code()`
			else:
				#insertID = -1
				#insertProjectID = 0
				#print "Invalid Insert value"
				e = UnknownInsertIDException("Unknown Insert value")
				print `e.err_code()`
				return
				
		#else:	# NO!!!!!!!!
			#e = MissingInsertException("No Insert provided")
			#print `e.err_code()`
	
		if insertProjectID > 0 and currUser.getCategory() != 'Admin' and insertProjectID not in uPackets:
			e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.")
			print `e.err_code()`
			return
	
		if  pvID > 0 and insertID > 0 :
			
			# try to reconstruct sequence and issue warning if unable
			if pvSeqID > 0 and insertSeqID > 0:
				
				# fetch insert cloning sites
				insertCloningSites = []
	
				fpcs_prop_id = pHandler.findPropID("5' cloning site")
				tpcs_prop_id = pHandler.findPropID("3' cloning site")
		
				fp_insert_cs = rHandler.findSimplePropertyValue(insertID, fpcs_prop_id)
				tp_insert_cs = rHandler.findSimplePropertyValue(insertID, tpcs_prop_id)
				
				# Determine if this is a Gateway clone from sites
				gwSites = False;
		
				if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower() == 'attl' and tp_insert_cs.lower() == 'attl':
					gwSites = True
				elif not fp_insert_cs or not tp_insert_cs:
					gwSites = True
				# nov. 16/07: added this for check
				elif fp_insert_cs.lower() in gatewaySites or tp_insert_cs.lower() in gatewaySites:
					gwSites = True
				else:
					gwSites = False;
		
				if gwSites:
					# this is a gateway clone
					# if sites were changed to something other than gateway, clear sequence	
					if newFivePrime.lower() != 'attl' or newThreePrime.lower() != 'attl':
						e = InsertSitesNotFoundOnParentSequenceException()
						print `e.err_code()`
						return
					else:
						pvSeqKey = rHandler.findDNASequenceKey(pvID)
						
						# For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
						insertLinkers = []
			
						# Find Sense and Antisense Oligos for this Insert
						# (not using antisense just yet - verify with Karen)
						iHandler = InsertHandler(db, cursor)
			
						senseOligoID = iHandler.findSenseOligoID(insertID)
						#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
			
						# Find Oligo sequences
						seqPropID = pHandler.findPropID("sequence")
						senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID)
						senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID)
			
						# Fetch Insert sequence and find linkers from Oligo and Insert sequences
						insertSequence = dnaHandler.findSequenceByID(insertSeqID)
			
						attB_const = "ggggacaactttgtacaaaaaagttggc"
						fwd_primer_seq = senseOligoSequence[len(attB_const):]
			
						# First, find linkers from Oligos
						fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq)
						#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
						rev_linker = ""
			
						# Now see if the Insert had its own linkers stored and append them to the Oligo linker
						fpLinkerPropID = pHandler.findPropID("5' linker")
						tpLinkerPropID = pHandler.findPropID("3' linker")
			
						fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID)
						tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID)
			
						if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
							fp_insert_linker = fwd_linker + fp_insert_linker
						else:
							fp_insert_linker = fwd_linker
			
						tp_insert_linker = rev_linker
			
						insertLinkers.append(fp_insert_linker)
						insertLinkers.append(tp_insert_linker)
			
						try:
							newSeq = dnaHandler.entryVectorSequence(pvSeqKey, insertSeqID, insertLinkers)
							print newSeq
							
						except MultipleSiteOccurrenceException:
							e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence")
							print `e.err_code()`
							
						except FivePrimeAfterThreePrimeException:
							e = FivePrimeAfterThreePrimeException("5' after 3'")
							print `e.err_code()`

						except InsertSitesNotFoundOnParentSequenceException:
							e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence")
							print `e.err_code()`
						
				else:
					# Non-Gateway non-recombination Vector
					fp_insert_cs = newFivePrime
					tp_insert_cs = newThreePrime
					
					if  fp_insert_cs:
						insertCloningSites.append(fp_insert_cs)
					else:
						insertCloningSites.append("")
	
					if  tp_insert_cs:
						insertCloningSites.append(tp_insert_cs)
					else:
						insertCloningSites.append("")
					
					# get linkers if there are any
					insertLinkers = []
	
					fpLinkerPropID = pHandler.findPropID("5' linker")
					tpLinkerPropID = pHandler.findPropID("3' linker")
					
					fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID)
					tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID)
	
					# sept. 3/07
					fwd_linker = ""
	
					if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
						fp_insert_linker = fwd_linker + fp_insert_linker
					else:
						fp_insert_linker = fwd_linker
						
					insertLinkers.append(fp_insert_linker)
					insertLinkers.append(tp_insert_linker)
					
					try:
						newSeq = dnaHandler.constructNonRecombSequence(pvSeqID, insertSeqID, insertCloningSites, insertLinkers)
						print newSeq
					
					except (InsertSitesException):
						e = InsertSitesException("Could not reconstitute sequence: Unknown sites on Insert.")
						print e.err_code()
						
					except (InsertSitesNotFoundOnParentSequenceException):
						e = InsertSitesNotFoundOnParentSequenceException("Could not reconstitute sequence: Parent vector sequence does not contain restriction sites.")
						print e.err_code()
						
					except (MultipleSiteOccurrenceException):
						e = MultipleSiteOccurrenceException("Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence")
						print e.err_code()
						
					except (HybridizationException):
						e = HybridizationException("Could not reconstitute sequence: Restriction sites cannot be hybridized.")
						print e.err_code()
						
					except (FivePrimeAfterThreePrimeException):
						e = FivePrimeAfterThreePrimeException("Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence.")
						print e.err_code()
			else:
				e = InvalidSequenceException("Invalid parent sequence")
				print `e.err_code()`
		else:
			e = UnknownPVIDException("Unknown PV ID")
			print `e.err_code()`
	
	elif cloning_method == '2':

		# Recombination vector - check IPV
		ipvVal = form.getvalue("IPV")
	
		if len(ipvVal) > 0:
			ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
			ipvProjectID = int(rHandler.findSimplePropertyValue(ipvID, packetPropID))
		else:
			e = UnknownIPVIDException("Unknown IPV ID")
			print `e.err_code()`
	
		if ipvProjectID > 0 and currUser.getCategory() != 'Admin' and ipvProjectID not in uPackets:
			e = IPVProjectAccessException("Not authorized to view IPV")
			print `e.err_code()`
		
		if ipvID > 0 and pvID > 0:
			
			# If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
			if not (newFivePrime == newThreePrime and (newFivePrime.lower() == 'loxp' and newThreePrime.lower() == 'loxp') or (newFivePrime.lower() == 'attb' and newThreePrime.lower() == 'attb')):
				e = InsertSitesNotFoundOnParentSequenceException("Invalid restriction sites for Non-Recombination Clone - must be LoxP only")
				print `e.err_code()`
			else:
				# get internal db IDs
				pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
				ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)
		
				# Get the Insert that belongs to the donor vector
				ipvInsertAssocID = raHandler.findReagentAssociationID(ipv_db_id)
				insertAssocPropID = aHandler.findAssocPropID("insert id")
				insert_db_id = aHandler.findAssocPropValue(ipvInsertAssocID, insertAssocPropID)
		
				# Construct a sequence for the new vector from the sequences of its parents
				pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
				#print "pv seq " + `pvSeqKey`
				ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
				#print "ipv seq " + `ipvSeqKey`
				insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
				#print "i seq " + `insertSeqKey`
		
				if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:
	
					# See if there are linkers, although there most likely aren't any
					insertLinkers = []
			
					fpLinkerPropID = pHandler.findPropID("5' linker")
					tpLinkerPropID = pHandler.findPropID("3' linker")
			
					fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID)
					tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID)
			
					# sept. 3/07
					fwd_linker = ""
			
					if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
						fp_insert_linker = fwd_linker + fp_insert_linker
					else:
						fp_insert_linker = fwd_linker
			
					insertLinkers.append(fp_insert_linker)
					insertLinkers.append(tp_insert_linker)
			
					# Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
					if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
						# recombination
						try:
							newSeq = dnaHandler.constructRecombSequence(pvSeqKey, ipvSeqKey, insertSeqKey, insertLinkers)
							newSeqID = dnaHandler.matchSequence(newSeq)
							print newSeq
						
						except InsertSitesNotFoundOnParentSequenceException:
							e = InsertSitesNotFoundOnParentSequenceException("LOXP sites not found on parent vector sequence")
							print `e.err_code()`

						except MultipleSiteOccurrenceException:

							e = MultipleSiteOccurrenceException("LOXP found more than once on parent vector sequence")
							print `e.err_code()`

					elif newFivePrime == 'attB' and newThreePrime == 'attB':
						
						# Gateway Expression
						iHandler = InsertHandler(db, cursor)
						
						senseOligoID = iHandler.findSenseOligoID(insert_db_id)
						#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
			
						# Find Oligo sequences
						seqPropID = pHandler.findPropID("sequence")
						senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID)
						senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID)
			
						# Fetch Insert sequence and find linkers from Oligo and Insert sequences
						insertSequence = dnaHandler.findSequenceByID(insertSeqKey)
			
						attB_const = "ggggacaactttgtacaaaaaagttggc"
						fwd_primer_seq = senseOligoSequence[len(attB_const):]
			
						# First, find linkers from Oligos
						fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq)
						#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
						rev_linker = ""
			
						# Now see if the Insert had its own linkers stored and append them to the Oligo linker
						fpLinkerPropID = pHandler.findPropID("5' linker")
						tpLinkerPropID = pHandler.findPropID("3' linker")
			
						fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID)
						tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID)
			
						if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
							fp_insert_linker = fwd_linker + fp_insert_linker
						else:
							fp_insert_linker = fwd_linker
			
						tp_insert_linker = rev_linker
			
						insertLinkers.append(fp_insert_linker)
						insertLinkers.append(tp_insert_linker)
						
						try:
							newSeq = dnaHandler.expressionVectorSequence(pvSeqKey, insertSeqKey, insertLinkers)
							print newSeq
						
						except MultipleSiteOccurrenceException:
							e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence")
							print `e.err_code()`
							
						except FivePrimeAfterThreePrimeException:
							e = FivePrimeAfterThreePrimeException("5' after 3'")
							print `e.err_code()`

						except InsertSitesNotFoundOnParentSequenceException:
							e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence")
							print `e.err_code()`

				else:
					e = InvalidSequenceException("Invalid parent sequence")
					print `e.err_code()`
		else:
			e = ReagentDoesNotExistException("Unknown parent values")
			print `e.err_code()`
Example #2
0
propMapper = ReagentPropertyMapper(db, cursor)
aMapper = ReagentAssociationMapper(db, cursor)
rMapper = ReagentTypeMapper(db, cursor)

# Various maps
reagentType_Name_ID_Map =  rMapper.mapTypeNameID()
reagentType_ID_Name_Map = rMapper.mapTypeIDName()

assoc_Type_Name_Map = aMapper.mapAssocTypeNameID()
assoc_Name_Alias_Map = aMapper.mapAssocNameAlias()
assoc_Name_Type_Map = aMapper.mapAssocTypeNameID()

prop_Name_ID_Map = propMapper.mapPropNameID()		# (prop name, prop id)
prop_ID_Name_Map = propMapper.mapPropIDName()		# (prop id, prop name)
prop_Name_Alias_Map = propMapper.mapPropNameAlias()	# (propName, propAlias)
prop_Alias_Name_Map = propMapper.mapPropAliasName()	# (propAlias, propName)
prop_Alias_ID_Map = propMapper.mapPropAliasID()		# (propAlias, propID) - e.g. ('insert_type', '48')

prop_Category_Name_ID_Map = propMapper.mapPropCategoryNameID()

featureNameColorMap = propMapper.mapFeatureNameColor()

#print `featureNameColorMap`

# Get enzymes list for mapping sequence features
enzDict = utils.join(sHandler.sitesDict, sHandler.gatewayDict)
enzDict = utils.join(enzDict, sHandler.recombDict)	# add LoxP
enzDict['None'] = ""					# add 'None'

# currUser is an INT user ID
Example #3
0
def update():

    dbConn = DatabaseConn()
    db = dbConn.databaseConnect()

    cursor = db.cursor()
    hostname = dbConn.getHostname()

    form = cgi.FieldStorage(keep_blank_values="True")

    print "Content-type:text/html"  # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
    print  # DITTO
    #print `form`

    # Aug 29/07
    uHandler = UserHandler(db, cursor)

    if form.has_key("curr_username"):
        # store the user ID for use throughout the session; add to other views in addition to create in PHP
        currUname = form.getvalue("curr_username")
        currUser = uHandler.getUserByDescription(currUname)

        Session.setUser(currUser)

    #else:	# debug
    #currUname = 'Administrator'
    #currUser = uHandler.getUserByDescription(currUname)

    #Session.setUser(currUser)

    if form.has_key("cloning_method"):
        cloning_method = form.getvalue("cloning_method")

    #else:	# debug
    #cloning_method = '1'

    # Handlers and mappers
    rHandler = ReagentHandler(db, cursor)
    #sHandler = SystemSetHandler(db, cursor)
    pHandler = ReagentPropertyHandler(db, cursor)
    raHandler = ReagentAssociationHandler(db, cursor)
    aHandler = AssociationHandler(db, cursor)

    dnaHandler = DNAHandler(db, cursor)
    commHandler = CommentHandler(db, cursor)
    protHandler = ProteinHandler(db, cursor)

    propMapper = ReagentPropertyMapper(db, cursor)
    assocMapper = ReagentAssociationMapper(db, cursor)

    # August 29/07: Restrict creation by user and project access
    packetHandler = ProjectDatabaseHandler(db, cursor)

    ########################################################
    # Various maps
    ########################################################

    prop_Alias_ID_Map = propMapper.mapPropAliasID(
    )  # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
    prop_Name_Alias_Map = propMapper.mapPropNameAlias(
    )  # (propName, propAlias)
    prop_Name_ID_Map = propMapper.mapPropNameID()  # (prop name, prop id)

    # Restriction sites
    fpcs_prop_id = pHandler.findPropID("5' cloning site")
    tpcs_prop_id = pHandler.findPropID("3' cloning site")

    newFivePrime = form.getvalue("fpcs")
    newThreePrime = form.getvalue("tpcs")

    gatewaySites = ['attb', 'attl', 'attp', 'attr']  # nov. 16/07

    # resulting sequence
    newSeq = ""

    # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
    currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                    'Reader')
    currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                     'Writer')
    publicProj = packetHandler.findAllProjects(isPrivate="FALSE")

    # list of Packet OBJECTS
    currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
                                         publicProj)

    uPackets = []

    for p in currUserWriteProjects:
        uPackets.append(p.getNumber())

    # Get project IDs of parents
    packetPropID = pHandler.findPropID("packet id")

    # August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
    newSeq = ""

    # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
    currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                    'Reader')
    currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                     'Writer')
    publicProj = packetHandler.findAllProjects(isPrivate="FALSE")

    # list of Packet OBJECTS
    currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
                                         publicProj)

    uPackets = []

    for p in currUserWriteProjects:
        uPackets.append(p.getNumber())

    # Get project IDs of parents
    packetPropID = pHandler.findPropID("packet id")

    if form.has_key("PV"):
        pvVal = form.getvalue("PV")

        if len(pvVal) > 0:
            pvID = rHandler.convertReagentToDatabaseID(pvVal)

            try:
                pvProjectID = int(
                    rHandler.findSimplePropertyValue(pvID, packetPropID))
                pvSeqID = rHandler.findDNASequenceKey(
                    pvID)  # get sequence for reconstitution later
            except TypeError:
                #pvProjectID = 0
                e = PVProjectAccessException(
                    "You are not authorized to use this Parent Vector, since you do not have Read access to its project."
                )
                print ` e.err_code() `
        else:
            e = UnknownPVIDException("Unknown Parent Vector value")
            print ` e.err_code() `
            return

    # else don't do anything, maybe want to delete parents!!!
    #else:
    #e = MissingPVException("No Parent Vector provided")
    #print `e.err_code()`

    if pvProjectID > 0 and currUser.getCategory(
    ) != 'Admin' and pvProjectID not in uPackets:
        e = PVProjectAccessException("Not authorized to access parent")
        print ` e.err_code() `
        return

    if cloning_method == '1':

        # Non-recombination vector - Get the Insert
        if form.has_key("I"):
            insertVal = form.getvalue("I")

            if len(insertVal) > 0:
                insertID = rHandler.convertReagentToDatabaseID(insertVal)
                insertSeqID = rHandler.findDNASequenceKey(
                    insertID)  # fetch Insert sequence for reconstitution later

                try:
                    insertProjectID = int(
                        rHandler.findSimplePropertyValue(
                            insertID, packetPropID))

                except TypeError:
                    #insertProjectID = 0
                    e = InsertProjectAccessException(
                        "You are not authorized to use this Insert, since you do not have Read access to its project."
                    )
                    print ` e.err_code() `
            else:
                #insertID = -1
                #insertProjectID = 0
                #print "Invalid Insert value"
                e = UnknownInsertIDException("Unknown Insert value")
                print ` e.err_code() `
                return

        #else:	# NO!!!!!!!!
        #e = MissingInsertException("No Insert provided")
        #print `e.err_code()`

        if insertProjectID > 0 and currUser.getCategory(
        ) != 'Admin' and insertProjectID not in uPackets:
            e = InsertProjectAccessException(
                "You are not authorized to use this Insert, since you do not have Read access to its project."
            )
            print ` e.err_code() `
            return

        if pvID > 0 and insertID > 0:

            # try to reconstruct sequence and issue warning if unable
            if pvSeqID > 0 and insertSeqID > 0:

                # fetch insert cloning sites
                insertCloningSites = []

                fpcs_prop_id = pHandler.findPropID("5' cloning site")
                tpcs_prop_id = pHandler.findPropID("3' cloning site")

                fp_insert_cs = rHandler.findSimplePropertyValue(
                    insertID, fpcs_prop_id)
                tp_insert_cs = rHandler.findSimplePropertyValue(
                    insertID, tpcs_prop_id)

                # Determine if this is a Gateway clone from sites
                gwSites = False

                if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower(
                ) == 'attl' and tp_insert_cs.lower() == 'attl':
                    gwSites = True
                elif not fp_insert_cs or not tp_insert_cs:
                    gwSites = True
                # nov. 16/07: added this for check
                elif fp_insert_cs.lower(
                ) in gatewaySites or tp_insert_cs.lower() in gatewaySites:
                    gwSites = True
                else:
                    gwSites = False

                if gwSites:
                    # this is a gateway clone
                    # if sites were changed to something other than gateway, clear sequence
                    if newFivePrime.lower() != 'attl' or newThreePrime.lower(
                    ) != 'attl':
                        e = InsertSitesNotFoundOnParentSequenceException()
                        print ` e.err_code() `
                        return
                    else:
                        pvSeqKey = rHandler.findDNASequenceKey(pvID)

                        # For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
                        insertLinkers = []

                        # Find Sense and Antisense Oligos for this Insert
                        # (not using antisense just yet - verify with Karen)
                        iHandler = InsertHandler(db, cursor)

                        senseOligoID = iHandler.findSenseOligoID(insertID)
                        #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)

                        # Find Oligo sequences
                        seqPropID = pHandler.findPropID("sequence")
                        senseOligoSeqID = rHandler.findIndexPropertyValue(
                            senseOligoID, seqPropID)
                        senseOligoSequence = dnaHandler.findSequenceByID(
                            senseOligoSeqID)

                        # Fetch Insert sequence and find linkers from Oligo and Insert sequences
                        insertSequence = dnaHandler.findSequenceByID(
                            insertSeqID)

                        attB_const = "ggggacaactttgtacaaaaaagttggc"
                        fwd_primer_seq = senseOligoSequence[len(attB_const):]

                        # First, find linkers from Oligos
                        fwd_linker = dnaHandler.linker_from_oligo(
                            insertSequence, fwd_primer_seq)
                        #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
                        rev_linker = ""

                        # Now see if the Insert had its own linkers stored and append them to the Oligo linker
                        fpLinkerPropID = pHandler.findPropID("5' linker")
                        tpLinkerPropID = pHandler.findPropID("3' linker")

                        fp_insert_linker = rHandler.findSimplePropertyValue(
                            insertID, fpLinkerPropID)
                        tp_insert_linker = rHandler.findSimplePropertyValue(
                            insertID, tpLinkerPropID)

                        if fp_insert_linker and len(
                                fp_insert_linker
                        ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                            fp_insert_linker = fwd_linker + fp_insert_linker
                        else:
                            fp_insert_linker = fwd_linker

                        tp_insert_linker = rev_linker

                        insertLinkers.append(fp_insert_linker)
                        insertLinkers.append(tp_insert_linker)

                        try:
                            newSeq = dnaHandler.entryVectorSequence(
                                pvSeqKey, insertSeqID, insertLinkers)
                            print newSeq

                        except MultipleSiteOccurrenceException:
                            e = MultipleSiteOccurrenceException(
                                "Sites found more than once on parent vector sequence"
                            )
                            print ` e.err_code() `

                        except FivePrimeAfterThreePrimeException:
                            e = FivePrimeAfterThreePrimeException(
                                "5' after 3'")
                            print ` e.err_code() `

                        except InsertSitesNotFoundOnParentSequenceException:
                            e = InsertSitesNotFoundOnParentSequenceException(
                                "Gateway sites not found on parent vector sequence"
                            )
                            print ` e.err_code() `

                else:
                    # Non-Gateway non-recombination Vector
                    fp_insert_cs = newFivePrime
                    tp_insert_cs = newThreePrime

                    if fp_insert_cs:
                        insertCloningSites.append(fp_insert_cs)
                    else:
                        insertCloningSites.append("")

                    if tp_insert_cs:
                        insertCloningSites.append(tp_insert_cs)
                    else:
                        insertCloningSites.append("")

                    # get linkers if there are any
                    insertLinkers = []

                    fpLinkerPropID = pHandler.findPropID("5' linker")
                    tpLinkerPropID = pHandler.findPropID("3' linker")

                    fp_insert_linker = rHandler.findSimplePropertyValue(
                        insertID, fpLinkerPropID)
                    tp_insert_linker = rHandler.findSimplePropertyValue(
                        insertID, tpLinkerPropID)

                    # sept. 3/07
                    fwd_linker = ""

                    if fp_insert_linker and len(
                            fp_insert_linker
                    ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                        fp_insert_linker = fwd_linker + fp_insert_linker
                    else:
                        fp_insert_linker = fwd_linker

                    insertLinkers.append(fp_insert_linker)
                    insertLinkers.append(tp_insert_linker)

                    try:
                        newSeq = dnaHandler.constructNonRecombSequence(
                            pvSeqID, insertSeqID, insertCloningSites,
                            insertLinkers)
                        print newSeq

                    except (InsertSitesException):
                        e = InsertSitesException(
                            "Could not reconstitute sequence: Unknown sites on Insert."
                        )
                        print e.err_code()

                    except (InsertSitesNotFoundOnParentSequenceException):
                        e = InsertSitesNotFoundOnParentSequenceException(
                            "Could not reconstitute sequence: Parent vector sequence does not contain restriction sites."
                        )
                        print e.err_code()

                    except (MultipleSiteOccurrenceException):
                        e = MultipleSiteOccurrenceException(
                            "Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence"
                        )
                        print e.err_code()

                    except (HybridizationException):
                        e = HybridizationException(
                            "Could not reconstitute sequence: Restriction sites cannot be hybridized."
                        )
                        print e.err_code()

                    except (FivePrimeAfterThreePrimeException):
                        e = FivePrimeAfterThreePrimeException(
                            "Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence."
                        )
                        print e.err_code()
            else:
                e = InvalidSequenceException("Invalid parent sequence")
                print ` e.err_code() `
        else:
            e = UnknownPVIDException("Unknown PV ID")
            print ` e.err_code() `

    elif cloning_method == '2':

        # Recombination vector - check IPV
        ipvVal = form.getvalue("IPV")

        if len(ipvVal) > 0:
            ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
            ipvProjectID = int(
                rHandler.findSimplePropertyValue(ipvID, packetPropID))
        else:
            e = UnknownIPVIDException("Unknown IPV ID")
            print ` e.err_code() `

        if ipvProjectID > 0 and currUser.getCategory(
        ) != 'Admin' and ipvProjectID not in uPackets:
            e = IPVProjectAccessException("Not authorized to view IPV")
            print ` e.err_code() `

        if ipvID > 0 and pvID > 0:

            # If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
            if not (newFivePrime == newThreePrime and
                    (newFivePrime.lower() == 'loxp'
                     and newThreePrime.lower() == 'loxp') or
                    (newFivePrime.lower() == 'attb'
                     and newThreePrime.lower() == 'attb')):
                e = InsertSitesNotFoundOnParentSequenceException(
                    "Invalid restriction sites for Non-Recombination Clone - must be LoxP only"
                )
                print ` e.err_code() `
            else:
                # get internal db IDs
                pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
                ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)

                # Get the Insert that belongs to the donor vector
                ipvInsertAssocID = raHandler.findReagentAssociationID(
                    ipv_db_id)
                insertAssocPropID = aHandler.findAssocPropID("insert id")
                insert_db_id = aHandler.findAssocPropValue(
                    ipvInsertAssocID, insertAssocPropID)

                # Construct a sequence for the new vector from the sequences of its parents
                pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
                #print "pv seq " + `pvSeqKey`
                ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
                #print "ipv seq " + `ipvSeqKey`
                insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
                #print "i seq " + `insertSeqKey`

                if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:

                    # See if there are linkers, although there most likely aren't any
                    insertLinkers = []

                    fpLinkerPropID = pHandler.findPropID("5' linker")
                    tpLinkerPropID = pHandler.findPropID("3' linker")

                    fp_insert_linker = rHandler.findSimplePropertyValue(
                        insert_db_id, fpLinkerPropID)
                    tp_insert_linker = rHandler.findSimplePropertyValue(
                        insert_db_id, tpLinkerPropID)

                    # sept. 3/07
                    fwd_linker = ""

                    if fp_insert_linker and len(
                            fp_insert_linker
                    ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                        fp_insert_linker = fwd_linker + fp_insert_linker
                    else:
                        fp_insert_linker = fwd_linker

                    insertLinkers.append(fp_insert_linker)
                    insertLinkers.append(tp_insert_linker)

                    # Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
                    if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
                        # recombination
                        try:
                            newSeq = dnaHandler.constructRecombSequence(
                                pvSeqKey, ipvSeqKey, insertSeqKey,
                                insertLinkers)
                            newSeqID = dnaHandler.matchSequence(newSeq)
                            print newSeq

                        except InsertSitesNotFoundOnParentSequenceException:
                            e = InsertSitesNotFoundOnParentSequenceException(
                                "LOXP sites not found on parent vector sequence"
                            )
                            print ` e.err_code() `

                        except MultipleSiteOccurrenceException:

                            e = MultipleSiteOccurrenceException(
                                "LOXP found more than once on parent vector sequence"
                            )
                            print ` e.err_code() `

                    elif newFivePrime == 'attB' and newThreePrime == 'attB':

                        # Gateway Expression
                        iHandler = InsertHandler(db, cursor)

                        senseOligoID = iHandler.findSenseOligoID(insert_db_id)
                        #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)

                        # Find Oligo sequences
                        seqPropID = pHandler.findPropID("sequence")
                        senseOligoSeqID = rHandler.findIndexPropertyValue(
                            senseOligoID, seqPropID)
                        senseOligoSequence = dnaHandler.findSequenceByID(
                            senseOligoSeqID)

                        # Fetch Insert sequence and find linkers from Oligo and Insert sequences
                        insertSequence = dnaHandler.findSequenceByID(
                            insertSeqKey)

                        attB_const = "ggggacaactttgtacaaaaaagttggc"
                        fwd_primer_seq = senseOligoSequence[len(attB_const):]

                        # First, find linkers from Oligos
                        fwd_linker = dnaHandler.linker_from_oligo(
                            insertSequence, fwd_primer_seq)
                        #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
                        rev_linker = ""

                        # Now see if the Insert had its own linkers stored and append them to the Oligo linker
                        fpLinkerPropID = pHandler.findPropID("5' linker")
                        tpLinkerPropID = pHandler.findPropID("3' linker")

                        fp_insert_linker = rHandler.findSimplePropertyValue(
                            insert_db_id, fpLinkerPropID)
                        tp_insert_linker = rHandler.findSimplePropertyValue(
                            insert_db_id, tpLinkerPropID)

                        if fp_insert_linker and len(
                                fp_insert_linker
                        ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                            fp_insert_linker = fwd_linker + fp_insert_linker
                        else:
                            fp_insert_linker = fwd_linker

                        tp_insert_linker = rev_linker

                        insertLinkers.append(fp_insert_linker)
                        insertLinkers.append(tp_insert_linker)

                        try:
                            newSeq = dnaHandler.expressionVectorSequence(
                                pvSeqKey, insertSeqKey, insertLinkers)
                            print newSeq

                        except MultipleSiteOccurrenceException:
                            e = MultipleSiteOccurrenceException(
                                "Sites found more than once on parent vector sequence"
                            )
                            print ` e.err_code() `

                        except FivePrimeAfterThreePrimeException:
                            e = FivePrimeAfterThreePrimeException(
                                "5' after 3'")
                            print ` e.err_code() `

                        except InsertSitesNotFoundOnParentSequenceException:
                            e = InsertSitesNotFoundOnParentSequenceException(
                                "Gateway sites not found on parent vector sequence"
                            )
                            print ` e.err_code() `

                else:
                    e = InvalidSequenceException("Invalid parent sequence")
                    print ` e.err_code() `
        else:
            e = ReagentDoesNotExistException("Unknown parent values")
            print ` e.err_code() `