def filter(myPileupFile, outFile): fout = open(outFile, 'w') #pileupInfoStIdx = 11 header = 'gene\tchrom\tpos\tref\taltLs\tvariant' with open(myPileupFile) as f: print >> fout, header for line in f: if line[0] != '#': sp = line.strip().split('\t') chrom, pos, rs, ref, altLs = sp[0:5] gene = scoreClinvar.parseGene(sp, 7) callStatus = [] pileupData = [] idxLsLs = [] newAltLs = [] # GCGGCGGAGTGTTGTGCGAGTC # changed to ACGGCGGAGTGTTGTGCGAGTC,G # Need A list of list of idx # and and a list of alternatives # output will be idx1,idx2;idx1 w/ alt1,alt2 for alt in altLs.split(','): newAltLs.append(alt) for newAlt in newAltLs: print >> fout, '\t'.join( (gene, chrom, str(int(pos)), ref, newAlt, chrom + ':' + str(int(pos)) + ref + '>' + altLs, ) ) fout.close()
def convert(myPileupFile, outFile): fout = open(outFile, 'w') #pileupInfoStIdx = 11 header = 'gene\tchrom\tpos\tref\taltLs\tvariant' with open(myPileupFile) as f: print >> fout, header for line in f: sp = line.strip().split('\t') chrom, pos, rs, ref, altLs = sp[0:5] gene = scoreClinvar.parseGene(sp, 7) newAltLs = [] for alt in altLs.split(','): newAltLs.append(alt) for newAlt in newAltLs: print >> fout, '\t'.join( (gene, chrom, str(int(pos)), ref, newAlt, chrom + ':' + str(int(pos)) + ref + '>' + altLs, ) ) fout.close()