def test_normalize_by_median_force():
CUTOFF = '1'
corrupt_infile = utils.get_temp_filename('test-corrupt.fq')
good_infile = utils.get_temp_filename('test-good.fq',
tempdir=os.path.dirname(
corrupt_infile))
in_dir = os.path.dirname(good_infile)
shutil.copyfile(utils.get_test_data('test-error-reads.fq'), corrupt_infile)
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), good_infile)
script = scriptpath('normalize-by-median.py')
args = ['-f', '-C', CUTOFF, '-k', '17', corrupt_infile, good_infile]
(status, out, err) = runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(corrupt_infile + '.ct.failed')
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(corrupt_infile + '.ct.failed')
assert '*** Skipping' in err
assert '** IOErrors' in err
def test_split_paired_reads_2_fq():
# test input file
infile = utils.get_test_data('paired.fq')
ex_outfile1 = utils.get_test_data('paired.fq.1')
ex_outfile2 = utils.get_test_data('paired.fq.2')
# actual output files...
outfile1 = utils.get_temp_filename('paired.fq.1')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired.fq.2', in_dir)
script = scriptpath('split-paired-reads.py')
args = [infile]
runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
def test_extract_paired_reads_1_fa():
# test input file
infile = utils.get_test_data('paired-mixed.fa')
ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe')
ex_outfile2 = utils.get_test_data('paired-mixed.fa.se')
# actual output files...
outfile1 = utils.get_temp_filename('paired-mixed.fa.pe')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired-mixed.fa.se', in_dir)
script = scriptpath('extract-paired-reads.py')
args = [infile]
runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
def test_normalize_by_median_force():
CUTOFF = '1'
corrupt_infile = utils.get_temp_filename('test-corrupt.fq')
good_infile = utils.get_temp_filename(
'test-good.fq', tempdir=os.path.dirname(corrupt_infile))
in_dir = os.path.dirname(good_infile)
shutil.copyfile(utils.get_test_data('test-error-reads.fq'), corrupt_infile)
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), good_infile)
script = scriptpath('normalize-by-median.py')
args = ['-f', '-C', CUTOFF, '-k', '17', corrupt_infile, good_infile]
(status, out, err) = runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(corrupt_infile + '.ct.failed')
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(corrupt_infile + '.ct.failed')
assert '*** Skipping' in err
assert '** IOErrors' in err
def test_count_overlap():
seqfile1 = utils.get_temp_filename('test-overlap1.fa')
in_dir = os.path.dirname(seqfile1)
seqfile2 = utils.get_temp_filename('test-overlap2.fa', in_dir)
outfile = utils.get_temp_filename('overlap.out', in_dir)
curvefile = utils.get_temp_filename('overlap.out.curve', in_dir)
shutil.copy(utils.get_test_data('test-overlap1.fa'), seqfile1)
shutil.copy(utils.get_test_data('test-overlap2.fa'), seqfile2)
htfile = _make_graph(seqfile1, ksize=20)
script = scriptpath('count-overlap.py')
args = [
'--ksize', '20', '--n_tables', '2', '--min-tablesize', '10000000',
htfile + '.pt', seqfile2, outfile
]
(status, out, err) = runscript(script, args, in_dir)
assert status == 0
assert os.path.exists(outfile), outfile
data = [x.strip() for x in open(outfile)]
data = set(data)
assert '# of unique k-mers in dataset2: 759047' in data
assert '# of overlap unique k-mers: 245621' in data
assert os.path.exists(curvefile), curvefile
data = [x.strip() for x in open(curvefile)]
data = set(data)
assert '178633 1155' in data
assert '496285 2970' in data
assert '752053 238627' in data
def test_split_paired_reads_2_fq():
# test input file
infile = utils.get_test_data('paired.fq')
ex_outfile1 = utils.get_test_data('paired.fq.1')
ex_outfile2 = utils.get_test_data('paired.fq.2')
# actual output files...
outfile1 = utils.get_temp_filename('paired.fq.1')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired.fq.2', in_dir)
script = scriptpath('split-paired-reads.py')
args = [infile]
runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert r.accuracy == q.accuracy
assert n > 0
def test_extract_paired_reads_1_fa():
# test input file
infile = utils.get_test_data('paired-mixed.fa')
ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe')
ex_outfile2 = utils.get_test_data('paired-mixed.fa.se')
# actual output files...
outfile1 = utils.get_temp_filename('paired-mixed.fa.pe')
in_dir = os.path.dirname(outfile1)
outfile2 = utils.get_temp_filename('paired-mixed.fa.se', in_dir)
script = scriptpath('extract-paired-reads.py')
args = [infile]
runscript(script, args, in_dir)
assert os.path.exists(outfile1), outfile1
assert os.path.exists(outfile2), outfile2
n = 0
for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
n = 0
for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
def test_count_overlap():
seqfile1 = utils.get_temp_filename('test-overlap1.fa')
in_dir = os.path.dirname(seqfile1)
seqfile2 = utils.get_temp_filename('test-overlap2.fa', in_dir)
outfile = utils.get_temp_filename('overlap.out', in_dir)
curvefile = utils.get_temp_filename('overlap.out.curve', in_dir)
shutil.copy(utils.get_test_data('test-overlap1.fa'), seqfile1)
shutil.copy(utils.get_test_data('test-overlap2.fa'), seqfile2)
htfile = _make_graph(seqfile1, ksize=20)
script = scriptpath('count-overlap.py')
args = ['--ksize', '20', '--n_tables', '2', '--min-tablesize', '10000000',
htfile + '.pt', seqfile2, outfile]
(status, out, err) = runscript(script, args, in_dir)
assert status == 0
assert os.path.exists(outfile), outfile
data = [x.strip() for x in open(outfile)]
data = set(data)
assert '# of unique k-mers in dataset2: 759047' in data
assert '# of overlap unique k-mers: 245621' in data
assert os.path.exists(curvefile), curvefile
data = [x.strip() for x in open(curvefile)]
data = set(data)
assert '178633 1155' in data
assert '496285 2970' in data
assert '752053 238627' in data
def test_sweep_reads_buffered():
readfile = utils.get_temp_filename('reads.fa')
contigfile = utils.get_temp_filename('contigs.fp')
in_dir = os.path.dirname(contigfile)
shutil.copyfile(utils.get_test_data('test-sweep-reads.fa'), readfile)
shutil.copyfile(utils.get_test_data('test-sweep-contigs.fp'), contigfile)
script = scriptpath('sweep-reads-buffered.py')
args = [
'-k', '25', '--prefix', 'test', '--label-by-pid', contigfile, readfile,
'junkfile.fa'
]
status, out, err = runscript(script, args, in_dir, fail_ok=True)
# check if the bad file was skipped without issue
assert 'ERROR' in err, err
assert 'skipping' in err, err
out1 = os.path.join(in_dir, 'test_0.fa')
out2 = os.path.join(in_dir, 'test_1.fa')
mout = os.path.join(in_dir, 'test_multi.fa')
oout = os.path.join(in_dir, 'test_orphaned.fa')
print os.listdir(in_dir)
seqs1 = set([r.name for r in screed.open(out1)])
seqs2 = set([r.name for r in screed.open(out2)])
seqsm = set([r.name for r in screed.open(mout)])
seqso = set([r.name for r in screed.open(oout)])
print seqs1
print seqs2
print seqsm
print seqso
assert seqs1 == set(['read1_p0\t0', 'read2_p0\t0'])
assert seqs2 == set(['read3_p1\t1'])
assert (seqsm == set(['read4_multi\t0\t1'])
or seqsm == set(['read4_multi\t1\t0']))
assert seqso == set(['read5_orphan'])
try:
os.remove(out1)
os.remove(out2)
os.remove(mout)
os.remove(oout)
except (IOError, OSError) as e:
print >> sys.stderr, 'error removing test outputs'
def test_filter_stoptags():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
stopfile = utils.get_temp_filename('stoptags', in_dir)
# first, copy test-abund-read-2.fa to 'test.fa' in the temp dir.
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
# now, create a file with some stop tags in it --
K = 18
kh = khmer.new_hashbits(K, 1, 1)
kh.add_stop_tag('GTTGACGGGGCTCAGGGG')
kh.save_stop_tags(stopfile)
del kh
# finally, run filter-stoptags.
script = scriptpath('filter-stoptags.py')
args = ['-k', str(K), stopfile, infile, infile]
runscript(script, args, in_dir)
# verify that the basic output file exists
outfile = infile + '.stopfilt'
assert os.path.exists(outfile), outfile
# it should contain only one unique sequence, because we've trimmed
# off everything after the beginning of the only long sequence in there.
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 1, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs, seqs
def test_normalize_by_median_dumpfrequency():
CUTOFF = '1'
infiles = [utils.get_temp_filename('test-0.fq')]
in_dir = os.path.dirname(infiles[0])
for x in range(1, 5):
infiles.append(utils.get_temp_filename('test-{x}.fq'.format(x=x),
tempdir=in_dir))
for infile in infiles:
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-d', '2', '-C', CUTOFF, '-k', '17']
args.extend(infiles)
(status, out, err) = runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(os.path.join(in_dir, 'backup.ct'))
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(os.path.join(in_dir, 'backup.ct'))
assert out.count('Backup: Saving') == 2
assert 'Nothing' in out
def test_load_graph():
script = scriptpath('load-graph.py')
args = ['-x', '1e7', '-N', '2', '-k', '20']
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
runscript(script, args)
ht_file = outfile + '.pt'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert os.path.exists(tagset_file), tagset_file
ht = khmer.load_hashbits(ht_file)
ht.load_tagset(tagset_file)
# check to make sure we get the expected result for this data set
# upon partitioning (all in one partition). This is kind of a
# roundabout way of checking that load-graph worked :)
subset = ht.do_subset_partition(0, 0)
x = ht.subset_count_partitions(subset)
assert x == (1, 0), x
def test_partition_graph_nojoin_stoptags():
# test with stoptags
graphbase = _make_graph(utils.get_test_data('random-20-a.fa'))
# add in some stop tags
ht = khmer.load_hashbits(graphbase + '.pt')
ht.add_stop_tag('TTGCATACGTTGAGCCAGCG')
stoptags_file = graphbase + '.stoptags'
ht.save_stop_tags(stoptags_file)
del ht
# run script with stoptags option
script = scriptpath('partition-graph.py')
args = ['--stoptags', stoptags_file, graphbase]
runscript(script, args)
script = scriptpath('merge-partitions.py')
args = [graphbase, '-k', str(20)]
runscript(script, args)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x == (2, 0), x # should be 2 partitions
def test_partition_graph_nojoin_stoptags():
# test with stoptags
graphbase = _make_graph(utils.get_test_data('random-20-a.fa'))
# add in some stop tags
ht = khmer.load_hashbits(graphbase + '.pt')
ht.add_stop_tag('TTGCATACGTTGAGCCAGCG')
stoptags_file = graphbase + '.stoptags'
ht.save_stop_tags(stoptags_file)
del ht
# run script with stoptags option
script = scriptpath('partition-graph.py')
args = ['--stoptags', stoptags_file, graphbase]
runscript(script, args)
script = scriptpath('merge-partitions.py')
args = [graphbase, '-k', str(20)]
runscript(script, args)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x == (2, 0), x # should be 2 partitions
def test_extract_partitions_output_unassigned():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = _make_graph(seqfile,
do_partition=True,
annotate_partitions=True)
in_dir = os.path.dirname(graphbase)
# get the final part file
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['-U', 'extracted', partfile]
runscript(script, args, in_dir)
distfile = os.path.join(in_dir, 'extracted.dist')
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
unassigned_file = os.path.join(in_dir, 'extracted.unassigned.fa')
assert os.path.exists(distfile)
assert os.path.exists(groupfile)
assert os.path.exists(unassigned_file)
dist = open(distfile).readline()
assert dist.strip() == '99 1 1 99'
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
assert len(parts) == 99, len(parts)
parts = set(parts)
assert len(parts) == 1, len(parts)
def test_extract_partitions_output_unassigned():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = _make_graph(
seqfile, do_partition=True, annotate_partitions=True)
in_dir = os.path.dirname(graphbase)
# get the final part file
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['-U', 'extracted', partfile]
runscript(script, args, in_dir)
distfile = os.path.join(in_dir, 'extracted.dist')
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
unassigned_file = os.path.join(in_dir, 'extracted.unassigned.fa')
assert os.path.exists(distfile)
assert os.path.exists(groupfile)
assert os.path.exists(unassigned_file)
dist = open(distfile).readline()
assert dist.strip() == '99 1 1 99'
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
assert len(parts) == 99, len(parts)
parts = set(parts)
assert len(parts) == 1, len(parts)
def test_load_graph():
script = scriptpath('load-graph.py')
args = ['-x', '1e7', '-N', '2', '-k', '20']
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
runscript(script, args)
ht_file = outfile + '.pt'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert os.path.exists(tagset_file), tagset_file
ht = khmer.load_hashbits(ht_file)
ht.load_tagset(tagset_file)
# check to make sure we get the expected result for this data set
# upon partitioning (all in one partition). This is kind of a
# roundabout way of checking that load-graph worked :)
subset = ht.do_subset_partition(0, 0)
x = ht.subset_count_partitions(subset)
assert x == (1, 0), x
def test_normalize_by_median_dumpfrequency():
CUTOFF = '1'
infiles = [utils.get_temp_filename('test-0.fq')]
in_dir = os.path.dirname(infiles[0])
for x in range(1, 5):
infiles.append(
utils.get_temp_filename('test-{x}.fq'.format(x=x), tempdir=in_dir))
for infile in infiles:
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-d', '2', '-C', CUTOFF, '-k', '17']
args.extend(infiles)
(status, out, err) = runscript(script, args, in_dir)
test_ht = khmer.load_counting_hash(os.path.join(in_dir, 'backup.ct'))
test_good_read = 'CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'
test_good_read2 = 'TAGTATCATCAAGGTTCAAGATGTTAATGAATAACAATTGCGCAGCAA'
assert test_ht.count(test_good_read[:17]) > 0
assert test_ht.count(test_good_read2[:17]) > 0
assert os.path.exists(os.path.join(in_dir, 'backup.ct'))
assert out.count('Backup: Saving') == 2
assert 'Nothing' in out
def test_sweep_reads_buffered_3():
infile = utils.get_temp_filename('seqs.fa')
shutil.copyfile(utils.get_test_data('random-20-a.fa'), infile)
wdir = os.path.dirname(infile)
script = scriptpath('sweep-reads-buffered.py')
args = ['-m', '75', '-k', '20', '-l', '1', '--prefix',
'test', '--label-by-group', '10', infile, infile]
status, out, err = runscript(script, args, wdir)
for i in xrange(10):
p = os.path.join(wdir, 'test_{i}.fa'.format(i=i))
print p, err, out
assert os.path.exists(p)
os.remove(p)
counts_fn = os.path.join(wdir, 'test.counts.csv')
with open(counts_fn) as cfp:
for line in cfp:
_, _, c = line.partition(',')
assert int(c) in [9, 10]
assert os.path.exists(counts_fn)
assert os.path.exists(os.path.join(wdir, 'test.dist.txt'))
assert not os.path.exists(os.path.join(wdir, 'test_multi.fa'))
def test_filter_stoptags():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
stopfile = utils.get_temp_filename('stoptags', in_dir)
# first, copy test-abund-read-2.fa to 'test.fa' in the temp dir.
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
# now, create a file with some stop tags in it --
K = 18
kh = khmer.new_hashbits(K, 1, 1)
kh.add_stop_tag('GTTGACGGGGCTCAGGGG')
kh.save_stop_tags(stopfile)
del kh
# finally, run filter-stoptags.
script = scriptpath('filter-stoptags.py')
args = ['-k', str(K), stopfile, infile, infile]
runscript(script, args, in_dir)
# verify that the basic output file exists
outfile = infile + '.stopfilt'
assert os.path.exists(outfile), outfile
# it should contain only one unique sequence, because we've trimmed
# off everything after the beginning of the only long sequence in there.
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 1, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs, seqs
def test_sweep_reads_buffered_3():
infile = utils.get_temp_filename('seqs.fa')
shutil.copyfile(utils.get_test_data('random-20-a.fa'), infile)
wdir = os.path.dirname(infile)
script = scriptpath('sweep-reads-buffered.py')
args = [
'-m', '75', '-k', '20', '-l', '1', '--prefix', 'test',
'--label-by-group', '10', infile, infile
]
status, out, err = runscript(script, args, wdir)
for i in xrange(10):
p = os.path.join(wdir, 'test_{i}.fa'.format(i=i))
print p, err, out
assert os.path.exists(p)
os.remove(p)
counts_fn = os.path.join(wdir, 'test.counts.csv')
with open(counts_fn) as cfp:
for line in cfp:
_, _, c = line.partition(',')
assert int(c) in [9, 10]
assert os.path.exists(counts_fn)
assert os.path.exists(os.path.join(wdir, 'test.dist.txt'))
assert not os.path.exists(os.path.join(wdir, 'test_multi.fa'))
def test_sweep_reads_buffered():
readfile = utils.get_temp_filename('reads.fa')
contigfile = utils.get_temp_filename('contigs.fp')
in_dir = os.path.dirname(contigfile)
shutil.copyfile(utils.get_test_data('test-sweep-reads.fa'), readfile)
shutil.copyfile(utils.get_test_data('test-sweep-contigs.fp'), contigfile)
script = scriptpath('sweep-reads-buffered.py')
args = ['-k', '25', '--prefix', 'test', '--label-by-pid',
contigfile, readfile, 'junkfile.fa']
status, out, err = runscript(script, args, in_dir, fail_ok=True)
# check if the bad file was skipped without issue
assert 'ERROR' in err, err
assert 'skipping' in err, err
out1 = os.path.join(in_dir, 'test_0.fa')
out2 = os.path.join(in_dir, 'test_1.fa')
mout = os.path.join(in_dir, 'test_multi.fa')
oout = os.path.join(in_dir, 'test_orphaned.fa')
print os.listdir(in_dir)
seqs1 = set([r.name for r in screed.open(out1)])
seqs2 = set([r.name for r in screed.open(out2)])
seqsm = set([r.name for r in screed.open(mout)])
seqso = set([r.name for r in screed.open(oout)])
print seqs1
print seqs2
print seqsm
print seqso
assert seqs1 == set(['read1_p0\t0', 'read2_p0\t0'])
assert seqs2 == set(['read3_p1\t1'])
assert (seqsm == set(['read4_multi\t0\t1']) or
seqsm == set(['read4_multi\t1\t0']))
assert seqso == set(['read5_orphan'])
try:
os.remove(out1)
os.remove(out2)
os.remove(mout)
os.remove(oout)
except (IOError, OSError) as e:
print >>sys.stderr, 'error removing test outputs'
def test_count_A(self):
A_filename = utils.get_test_data('all-A.fa')
tracking = khmer.new_hashbits(4, 4 ** 4, 1)
dist = self.kh.abundance_distribution(A_filename, tracking)
assert sum(dist) == 1
assert dist[10] == 1
def test_count_A(self):
A_filename = utils.get_test_data('all-A.fa')
tracking = khmer.new_hashbits(4, 4**4, 1)
dist = self.kh.abundance_distribution(A_filename, tracking)
assert sum(dist) == 1
assert dist[10] == 1
def test_fastq_to_fasta():
script = scriptpath('fastq-to-fasta.py')
clean_infile = utils.get_temp_filename('test-clean.fq')
n_infile = utils.get_temp_filename('test-n.fq')
shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), clean_infile)
shutil.copyfile(utils.get_test_data('test-fastq-n-reads.fq'), n_infile)
clean_outfile = clean_infile + '.keep.fa'
n_outfile = n_infile + '.keep.fa'
in_dir = os.path.dirname(clean_infile)
in_dir_n = os.path.dirname(n_infile)
args = [clean_infile, '-n', '-o', clean_outfile]
(status, out, err) = runscript(script, args, in_dir)
assert len(out.splitlines()) == 2
assert "No lines dropped" in err
args = [n_infile, '-n', '-o', n_outfile]
(status, out, err) = runscript(script, args, in_dir_n)
assert len(out.splitlines()) == 2
assert "No lines dropped" in err
args = [clean_infile, '-o', clean_outfile]
(status, out, err) = runscript(script, args, in_dir)
assert len(out.splitlines()) == 2
assert "0 lines dropped" in err
args = [n_infile, '-o', n_outfile]
(status, out, err) = runscript(script, args, in_dir_n)
assert len(out.splitlines()) == 2, out
assert "4 lines dropped" in err, err
args = [clean_infile]
(status, out, err) = runscript(script, args, in_dir)
assert len(out.splitlines()) > 2
assert "0 lines dropped" in err
args = [n_infile]
(status, out, err) = runscript(script, args, in_dir_n)
assert len(out.splitlines()) > 2
assert "4 lines dropped" in err
def test_very_short_read():
short_filename = utils.get_test_data('test-short.fa')
kh = khmer.new_hashtable(9, 4 ** 4 + 1)
n_reads, n_kmers = kh.consume_fasta(short_filename)
assert n_reads == 1
assert n_kmers == 0
kh = khmer.new_hashtable(8, 4 ** 4 + 1)
n_reads, n_kmers = kh.consume_fasta(short_filename)
assert n_reads == 1
assert n_kmers == 1
def test_interleave_reads_1_fq():
# test input files
infile1 = utils.get_test_data('paired.fq.1')
infile2 = utils.get_test_data('paired.fq.2')
# correct output
ex_outfile = utils.get_test_data('paired.fq')
# actual output file
outfile = utils.get_temp_filename('out.fq')
script = scriptpath('interleave-reads.py')
args = [infile1, infile2, '-o', outfile]
runscript(script, args)
r = open(ex_outfile).read()
q = open(outfile).read()
assert r == q, (r, q)
def test_normalize_by_median_impaired():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-impaired.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-p', '-k', '17', infile]
runscript(script, args, in_dir, fail_ok=True)
def test_load_into_counting():
script = scriptpath('load-into-counting.py')
args = ['-x', '1e7', '-N', '2', '-k', '20']
outfile = utils.get_temp_filename('out.kh')
infile = utils.get_test_data('test-abund-read-2.fa')
args.extend([outfile, infile])
runscript(script, args)
assert os.path.exists(outfile)
def test_very_short_read():
short_filename = utils.get_test_data('test-short.fa')
kh = khmer.new_hashtable(9, 4**4 + 1)
n_reads, n_kmers = kh.consume_fasta(short_filename)
assert n_reads == 1
assert n_kmers == 0
kh = khmer.new_hashtable(8, 4**4 + 1)
n_reads, n_kmers = kh.consume_fasta(short_filename)
assert n_reads == 1
assert n_kmers == 1
def test_load_into_counting():
script = scriptpath('load-into-counting.py')
args = ['-x', '1e7', '-N', '2', '-k', '20']
outfile = utils.get_temp_filename('out.kh')
infile = utils.get_test_data('test-abund-read-2.fa')
args.extend([outfile, infile])
runscript(script, args)
assert os.path.exists(outfile)
def test_interleave_reads_1_fq():
# test input files
infile1 = utils.get_test_data('paired.fq.1')
infile2 = utils.get_test_data('paired.fq.2')
# correct output
ex_outfile = utils.get_test_data('paired.fq')
# actual output file
outfile = utils.get_temp_filename('out.fq')
script = scriptpath('interleave-reads.py')
args = [infile1, infile2, '-o', outfile]
runscript(script, args)
r = open(ex_outfile).read()
q = open(outfile).read()
assert r == q, (r, q)
def test_sweep_reads_buffered_2():
infile = utils.get_temp_filename('seqs.fa')
inref = utils.get_temp_filename('ref.fa')
shutil.copyfile(utils.get_test_data('random-20-X2.fa'), infile)
shutil.copyfile(utils.get_test_data('random-20-a.fa'), inref)
wdir = os.path.dirname(inref)
script = scriptpath('sweep-reads-buffered.py')
args = ['-m', '50', '-k', '20', '-l', '9', '-b', '60', '--prefix',
'test', '--label-by-seq', inref, infile]
status, out, err = runscript(script, args, wdir)
for i in xrange(99):
p = os.path.join(wdir, 'test_{i}.fa'.format(i=i))
print p, err, out
assert os.path.exists(p)
os.remove(p)
assert os.path.exists(os.path.join(wdir, 'test.counts.csv'))
assert os.path.exists(os.path.join(wdir, 'test.dist.txt'))
assert not os.path.exists(os.path.join(wdir, 'test_multi.fa'))
def test_normalize_by_median_impaired():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-impaired.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-p', '-k', '17', infile]
runscript(script, args, in_dir, fail_ok=True)
def test_load_graph_fail():
script = scriptpath('load-graph.py')
args = ['-x', '1e3', '-N', '2', '-k', '20'] # use small HT
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
(status, out, err) = runscript(script, args, fail_ok=True)
assert status == 1, status
assert "ERROR:" in err
def test_load_graph_fail():
script = scriptpath('load-graph.py')
args = ['-x', '1e3', '-N', '2', '-k', '20'] # use small HT
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
(status, out, err) = runscript(script, args, fail_ok=True)
assert status == 1, status
assert "ERROR:" in err
def test_load_into_counting_fail():
script = scriptpath('load-into-counting.py')
args = ['-x', '1e2', '-N', '2', '-k', '20'] # use small HT
outfile = utils.get_temp_filename('out.kh')
infile = utils.get_test_data('test-abund-read-2.fa')
args.extend([outfile, infile])
(status, out, err) = runscript(script, args, fail_ok=True)
assert status == 1, status
assert "ERROR:" in err
def test_load_into_counting_fail():
script = scriptpath('load-into-counting.py')
args = ['-x', '1e2', '-N', '2', '-k', '20'] # use small HT
outfile = utils.get_temp_filename('out.kh')
infile = utils.get_test_data('test-abund-read-2.fa')
args.extend([outfile, infile])
(status, out, err) = runscript(script, args, fail_ok=True)
assert status == 1, status
assert "ERROR:" in err
def test_sweep_reads_buffered_2():
infile = utils.get_temp_filename('seqs.fa')
inref = utils.get_temp_filename('ref.fa')
shutil.copyfile(utils.get_test_data('random-20-X2.fa'), infile)
shutil.copyfile(utils.get_test_data('random-20-a.fa'), inref)
wdir = os.path.dirname(inref)
script = scriptpath('sweep-reads-buffered.py')
args = [
'-m', '50', '-k', '20', '-l', '9', '-b', '60', '--prefix', 'test',
'--label-by-seq', inref, infile
]
status, out, err = runscript(script, args, wdir)
for i in xrange(99):
p = os.path.join(wdir, 'test_{i}.fa'.format(i=i))
print p, err, out
assert os.path.exists(p)
os.remove(p)
assert os.path.exists(os.path.join(wdir, 'test.counts.csv'))
assert os.path.exists(os.path.join(wdir, 'test.dist.txt'))
assert not os.path.exists(os.path.join(wdir, 'test_multi.fa'))
def test_interleave_reads_2_fa():
# test input files
infile1 = utils.get_test_data('paired.fa.1')
infile2 = utils.get_test_data('paired.fa.2')
# correct output
ex_outfile = utils.get_test_data('paired.fa')
# actual output file
outfile = utils.get_temp_filename('out.fa')
script = scriptpath('interleave-reads.py')
args = [infile1, infile2, '-o', outfile]
runscript(script, args)
n = 0
for r, q in zip(screed.open(ex_outfile), screed.open(outfile)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
def test_partition_graph_big_traverse():
graphbase = _make_graph(utils.get_test_data('biglump-random-20-a.fa'),
do_partition=True, stop_big_traverse=False)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x == (1, 0), x # should be exactly one partition.
def test_interleave_reads_2_fa():
# test input files
infile1 = utils.get_test_data('paired.fa.1')
infile2 = utils.get_test_data('paired.fa.2')
# correct output
ex_outfile = utils.get_test_data('paired.fa')
# actual output file
outfile = utils.get_temp_filename('out.fa')
script = scriptpath('interleave-reads.py')
args = [infile1, infile2, '-o', outfile]
runscript(script, args)
n = 0
for r, q in zip(screed.open(ex_outfile), screed.open(outfile)):
n += 1
assert r.name == q.name
assert r.sequence == q.sequence
assert n > 0
def _DEBUG_make_graph(infilename,
min_hashsize=1e7,
n_hashes=2,
ksize=20,
do_partition=False,
annotate_partitions=False,
stop_big_traverse=False):
script = scriptpath('load-graph.py')
args = ['-x', str(min_hashsize), '-N', str(n_hashes), '-k', str(ksize)]
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data(infilename)
args.extend([outfile, infile])
DEBUG_runscript(script, args)
ht_file = outfile + '.ct'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert os.path.exists(tagset_file), tagset_file
if do_partition:
print ">>>> DEBUG: Partitioning <<<"
script = scriptpath('partition-graph.py')
args = [outfile]
if stop_big_traverse:
args.insert(0, '--no-big-traverse')
DEBUG_runscript(script, args)
print ">>>> DEBUG: Merging Partitions <<<"
script = scriptpath('merge-partitions.py')
args = [outfile, '-k', str(ksize)]
DEBUG_runscript(script, args)
final_pmap_file = outfile + '.pmap.merged'
assert os.path.exists(final_pmap_file)
if annotate_partitions:
print ">>>> DEBUG: Annotating Partitions <<<"
script = scriptpath('annotate-partitions.py')
args = ["-k", str(ksize), outfile, infilename]
in_dir = os.path.dirname(outfile)
DEBUG_runscript(script, args, in_dir)
baseinfile = os.path.basename(infilename)
assert os.path.exists(os.path.join(in_dir, baseinfile + '.part'))
return outfile
def test_partition_graph_big_traverse():
graphbase = _make_graph(utils.get_test_data('biglump-random-20-a.fa'),
do_partition=True,
stop_big_traverse=False)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x == (1, 0), x # should be exactly one partition.
def test_partition_graph_no_big_traverse():
# do NOT exhaustively traverse
graphbase = _make_graph(utils.get_test_data('biglump-random-20-a.fa'),
do_partition=True, stop_big_traverse=True)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x[0] == 4, x # should be four partitions, broken at knot.
def test_normalize_by_median_empty():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-empty.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-k', '17', infile]
runscript(script, args, in_dir)
outfile = infile + '.keep'
assert os.path.exists(outfile), outfile
def test_normalize_by_median_empty():
CUTOFF = '1'
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-empty.fa'), infile)
script = scriptpath('normalize-by-median.py')
args = ['-C', CUTOFF, '-k', '17', infile]
runscript(script, args, in_dir)
outfile = infile + '.keep'
assert os.path.exists(outfile), outfile
def test_partition_graph_no_big_traverse():
# do NOT exhaustively traverse
graphbase = _make_graph(utils.get_test_data('biglump-random-20-a.fa'),
do_partition=True,
stop_big_traverse=True)
final_pmap_file = graphbase + '.pmap.merged'
assert os.path.exists(final_pmap_file)
ht = khmer.load_hashbits(graphbase + '.pt')
ht.load_tagset(graphbase + '.tagset')
ht.load_partitionmap(final_pmap_file)
x = ht.count_partitions()
assert x[0] == 4, x # should be four partitions, broken at knot.
def _DEBUG_make_graph(infilename, min_hashsize=1e7, n_hashes=2, ksize=20,
do_partition=False,
annotate_partitions=False,
stop_big_traverse=False):
script = scriptpath('load-graph.py')
args = ['-x', str(min_hashsize), '-N', str(n_hashes), '-k', str(ksize)]
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data(infilename)
args.extend([outfile, infile])
DEBUG_runscript(script, args)
ht_file = outfile + '.ct'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert os.path.exists(tagset_file), tagset_file
if do_partition:
print ">>>> DEBUG: Partitioning <<<"
script = scriptpath('partition-graph.py')
args = [outfile]
if stop_big_traverse:
args.insert(0, '--no-big-traverse')
DEBUG_runscript(script, args)
print ">>>> DEBUG: Merging Partitions <<<"
script = scriptpath('merge-partitions.py')
args = [outfile, '-k', str(ksize)]
DEBUG_runscript(script, args)
final_pmap_file = outfile + '.pmap.merged'
assert os.path.exists(final_pmap_file)
if annotate_partitions:
print ">>>> DEBUG: Annotating Partitions <<<"
script = scriptpath('annotate-partitions.py')
args = ["-k", str(ksize), outfile, infilename]
in_dir = os.path.dirname(outfile)
DEBUG_runscript(script, args, in_dir)
baseinfile = os.path.basename(infilename)
assert os.path.exists(os.path.join(in_dir, baseinfile + '.part'))
return outfile
def test_filter_abund_1_singlefile():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
script = scriptpath('filter-abund-single.py')
args = ['-x', '1e7', '-N', '2', '-k', '17', infile]
runscript(script, args, in_dir)
outfile = infile + '.abundfilt'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 1, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def test_abundance_dist_single_nobigcount():
infile = utils.get_temp_filename('test.fa')
outfile = utils.get_temp_filename('test.dist')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
script = scriptpath('abundance-dist-single.py')
args = ['-x', '1e7', '-N', '2', '-k', '17', '-z', '-b', infile, outfile]
runscript(script, args, in_dir)
fp = iter(open(outfile))
line = fp.next().strip()
assert line == '1 96 96 0.98', line
line = fp.next().strip()
assert line == '255 2 98 1.0', line
def test_abundance_dist_single_nobigcount():
infile = utils.get_temp_filename('test.fa')
outfile = utils.get_temp_filename('test.dist')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
script = scriptpath('abundance-dist-single.py')
args = ['-x', '1e7', '-N', '2', '-k', '17', '-z', '-b', infile, outfile]
runscript(script, args, in_dir)
fp = iter(open(outfile))
line = fp.next().strip()
assert line == '1 96 96 0.98', line
line = fp.next().strip()
assert line == '255 2 98 1.0', line
def test_do_partition():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = utils.get_temp_filename('out')
in_dir = os.path.dirname(graphbase)
script = scriptpath('do-partition.py')
args = ["-k", "20", graphbase, seqfile]
runscript(script, args, in_dir)
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
parts = set(parts)
assert '2' in parts
assert len(parts) == 1
def test_do_partition():
seqfile = utils.get_test_data('random-20-a.fa')
graphbase = utils.get_temp_filename('out')
in_dir = os.path.dirname(graphbase)
script = scriptpath('do-partition.py')
args = ["-k", "20", graphbase, seqfile]
runscript(script, args, in_dir)
partfile = os.path.join(in_dir, 'random-20-a.fa.part')
parts = [r.name.split('\t')[1] for r in screed.open(partfile)]
parts = set(parts)
assert '2' in parts
assert len(parts) == 1
def test_filter_abund_1_singlefile():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
script = scriptpath('filter-abund-single.py')
args = ['-x', '1e7', '-N', '2', '-k', '17', infile]
runscript(script, args, in_dir)
outfile = infile + '.abundfilt'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 1, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def test_extract_partitions_no_groups():
empty_file = utils.get_temp_filename('empty-file')
basefile = utils.get_test_data('empty-file')
shutil.copyfile(basefile, empty_file)
in_dir = os.path.dirname(empty_file)
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['extracted', empty_file]
runscript(script, args, in_dir, fail_ok=True)
# No group files should be created
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
assert not os.path.exists(groupfile)
def test_extract_partitions_no_groups():
empty_file = utils.get_temp_filename('empty-file')
basefile = utils.get_test_data('empty-file')
shutil.copyfile(basefile, empty_file)
in_dir = os.path.dirname(empty_file)
# ok, now run extract-partitions.
script = scriptpath('extract-partitions.py')
args = ['extracted', empty_file]
runscript(script, args, in_dir, fail_ok=True)
# No group files should be created
groupfile = os.path.join(in_dir, 'extracted.group0000.fa')
assert not os.path.exists(groupfile)
def test_filter_abund_4_retain_low_abund():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
counting_ht = _make_counting(infile, K=17)
script = scriptpath('filter-abund.py')
args = ['-V', counting_ht, infile]
runscript(script, args, in_dir)
outfile = infile + '.abundfilt'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 2, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def test_filter_abund_4_retain_low_abund():
infile = utils.get_temp_filename('test.fa')
in_dir = os.path.dirname(infile)
shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile)
counting_ht = _make_counting(infile, K=17)
script = scriptpath('filter-abund.py')
args = ['-V', counting_ht, infile]
runscript(script, args, in_dir)
outfile = infile + '.abundfilt'
assert os.path.exists(outfile), outfile
seqs = set([r.sequence for r in screed.open(outfile)])
assert len(seqs) == 2, seqs
assert 'GGTTGACGGGGCTCAGGG' in seqs
def test_load_graph_no_tags():
script = scriptpath('load-graph.py')
args = ['-x', '1e7', '-N', '2', '-k', '20', '-n']
outfile = utils.get_temp_filename('out')
infile = utils.get_test_data('random-20-a.fa')
args.extend([outfile, infile])
runscript(script, args)
ht_file = outfile + '.pt'
assert os.path.exists(ht_file), ht_file
tagset_file = outfile + '.tagset'
assert not os.path.exists(tagset_file), tagset_file
assert khmer.load_hashbits(ht_file)
