def index(filename, format, alphabet=None, key_function=None):
    """Indexes a sequence file and returns a dictionary like object.

     - filename - string giving name of file to be indexed
     - format   - lower case string describing the file format
     - alphabet - optional Alphabet object, useful when the sequence type
                  cannot be automatically inferred from the file itself
                  (e.g. format="fasta" or "tab")
     - key_function - Optional callback function which when given a
                  SeqRecord identifier string should return a unique
                  key for the dictionary.
    
    This indexing function will return a dictionary like object, giving the
    SeqRecord objects as values:

    >>> from Bio import SeqIO
    >>> records = SeqIO.index("Quality/example.fastq", "fastq")
    >>> len(records)
    3
    >>> sorted(records)
    ['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_443_348', 'EAS54_6_R1_2_1_540_792']
    >>> print records["EAS54_6_R1_2_1_540_792"].format("fasta")
    >EAS54_6_R1_2_1_540_792
    TTGGCAGGCCAAGGCCGATGGATCA
    <BLANKLINE>
    >>> "EAS54_6_R1_2_1_540_792" in records
    True
    >>> print records.get("Missing", None)
    None

    Note that this psuedo dictionary will not support all the methods of a
    true Python dictionary, for example values() is not defined since this
    would require loading all of the records into memory at once.

    When you call the index function, it will scan through the file, noting
    the location of each record. When you access a particular record via the
    dictionary methods, the code will jump to the appropriate part of the
    file and then parse that section into a SeqRecord.

    Note that not all the input formats supported by Bio.SeqIO can be used
    with this index function. It is designed to work only with sequential
    file formats (e.g. "fasta", "gb", "fastq") and is not suitable for any
    interlaced file format (e.g. alignment formats such as "clustal").

    For small files, it may be more efficient to use an in memory Python
    dictionary, e.g.

    >>> from Bio import SeqIO
    >>> records = SeqIO.to_dict(SeqIO.parse(open("Quality/example.fastq"), "fastq"))
    >>> len(records)
    3
    >>> sorted(records)
    ['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_443_348', 'EAS54_6_R1_2_1_540_792']
    >>> print records["EAS54_6_R1_2_1_540_792"].format("fasta")
    >EAS54_6_R1_2_1_540_792
    TTGGCAGGCCAAGGCCGATGGATCA
    <BLANKLINE>

    As with the to_dict() function, by default the id string of each record
    is used as the key. You can specify a callback function to transform
    this (the record identifier string) into your prefered key. For example:

    >>> from Bio import SeqIO
    >>> def make_tuple(identifier):
    ...     parts = identifier.split("_")
    ...     return int(parts[-2]), int(parts[-1])
    >>> records = SeqIO.index("Quality/example.fastq", "fastq",
    ...                       key_function=make_tuple)
    >>> len(records)
    3
    >>> sorted(records)
    [(413, 324), (443, 348), (540, 792)]
    >>> print records[(540, 792)].format("fasta")
    >EAS54_6_R1_2_1_540_792
    TTGGCAGGCCAAGGCCGATGGATCA
    <BLANKLINE>
    >>> (540, 792) in records
    True
    >>> "EAS54_6_R1_2_1_540_792" in records
    False
    >>> print records.get("Missing", None)
    None

    Another common use case would be indexing an NCBI style FASTA file,
    where you might want to extract the GI number from the FASTA identifer
    to use as the dictionary key.

    Notice that unlike the to_dict() function, here the key_function does
    not get given the full SeqRecord to use to generate the key. Doing so
    would impose a severe performance penalty as it would require the file
    to be completely parsed while building the index. Right now this is
    usually avoided.
    
    See also: Bio.SeqIO.index_db() and Bio.SeqIO.to_dict()
    """
    #Try and give helpful error messages:
    if not isinstance(filename, basestring):
        raise TypeError("Need a filename (not a handle)")
    if not isinstance(format, basestring):
        raise TypeError("Need a string for the file format (lower case)")
    if not format:
        raise ValueError("Format required (lower case string)")
    if format != format.lower():
        raise ValueError("Format string '%s' should be lower case" % format)
    if alphabet is not None and not (isinstance(alphabet, Alphabet) or \
                                     isinstance(alphabet, AlphabetEncoder)):
        raise ValueError("Invalid alphabet, %s" % repr(alphabet))

    #Map the file format to a sequence iterator:
    import _index  #Lazy import
    return _index._IndexedSeqFileDict(filename, format, alphabet, key_function)
def index(filename, format, alphabet=None, key_function=None):
    """Indexes a sequence file and returns a dictionary like object.

     - filename - string giving name of file to be indexed
     - format   - lower case string describing the file format
     - alphabet - optional Alphabet object, useful when the sequence type
                  cannot be automatically inferred from the file itself
                  (e.g. format="fasta" or "tab")
     - key_function - Optional callback function which when given a
                  SeqRecord identifier string should return a unique
                  key for the dictionary.
    
    This indexing function will return a dictionary like object, giving the
    SeqRecord objects as values:

    >>> from Bio import SeqIO
    >>> records = SeqIO.index("Quality/example.fastq", "fastq")
    >>> len(records)
    3
    >>> sorted(records)
    ['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_443_348', 'EAS54_6_R1_2_1_540_792']
    >>> print records["EAS54_6_R1_2_1_540_792"].format("fasta")
    >EAS54_6_R1_2_1_540_792
    TTGGCAGGCCAAGGCCGATGGATCA
    <BLANKLINE>
    >>> "EAS54_6_R1_2_1_540_792" in records
    True
    >>> print records.get("Missing", None)
    None

    Note that this psuedo dictionary will not support all the methods of a
    true Python dictionary, for example values() is not defined since this
    would require loading all of the records into memory at once.

    When you call the index function, it will scan through the file, noting
    the location of each record. When you access a particular record via the
    dictionary methods, the code will jump to the appropriate part of the
    file and then parse that section into a SeqRecord.

    Note that not all the input formats supported by Bio.SeqIO can be used
    with this index function. It is designed to work only with sequential
    file formats (e.g. "fasta", "gb", "fastq") and is not suitable for any
    interlaced file format (e.g. alignment formats such as "clustal").

    For small files, it may be more efficient to use an in memory Python
    dictionary, e.g.

    >>> from Bio import SeqIO
    >>> records = SeqIO.to_dict(SeqIO.parse(open("Quality/example.fastq"), "fastq"))
    >>> len(records)
    3
    >>> sorted(records)
    ['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_443_348', 'EAS54_6_R1_2_1_540_792']
    >>> print records["EAS54_6_R1_2_1_540_792"].format("fasta")
    >EAS54_6_R1_2_1_540_792
    TTGGCAGGCCAAGGCCGATGGATCA
    <BLANKLINE>

    As with the to_dict() function, by default the id string of each record
    is used as the key. You can specify a callback function to transform
    this (the record identifier string) into your prefered key. For example:

    >>> from Bio import SeqIO
    >>> def make_tuple(identifier):
    ...     parts = identifier.split("_")
    ...     return int(parts[-2]), int(parts[-1])
    >>> records = SeqIO.index("Quality/example.fastq", "fastq",
    ...                       key_function=make_tuple)
    >>> len(records)
    3
    >>> sorted(records)
    [(413, 324), (443, 348), (540, 792)]
    >>> print records[(540, 792)].format("fasta")
    >EAS54_6_R1_2_1_540_792
    TTGGCAGGCCAAGGCCGATGGATCA
    <BLANKLINE>
    >>> (540, 792) in records
    True
    >>> "EAS54_6_R1_2_1_540_792" in records
    False
    >>> print records.get("Missing", None)
    None

    Another common use case would be indexing an NCBI style FASTA file,
    where you might want to extract the GI number from the FASTA identifer
    to use as the dictionary key.

    Notice that unlike the to_dict() function, here the key_function does
    not get given the full SeqRecord to use to generate the key. Doing so
    would impose a severe performance penalty as it would require the file
    to be completely parsed while building the index. Right now this is
    usually avoided.
    
    See also: Bio.SeqIO.index_db() and Bio.SeqIO.to_dict()
    """
    #Try and give helpful error messages:
    if not isinstance(filename, basestring):
        raise TypeError("Need a filename (not a handle)")
    if not isinstance(format, basestring):
        raise TypeError("Need a string for the file format (lower case)")
    if not format:
        raise ValueError("Format required (lower case string)")
    if format != format.lower():
        raise ValueError("Format string '%s' should be lower case" % format)
    if alphabet is not None and not (isinstance(alphabet, Alphabet) or \
                                     isinstance(alphabet, AlphabetEncoder)):
        raise ValueError("Invalid alphabet, %s" % repr(alphabet))

    #Map the file format to a sequence iterator:    
    import _index #Lazy import
    return _index._IndexedSeqFileDict(filename, format, alphabet, key_function)