def test_min_tm():
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
# Test forward priming
# Tm should be ~40 C
seq = DNA('CTTCTATCGAACAA')
primer = Primer(seq, seq.tm())
matches = analysis.anneal(template, primer, min_tm=60.0)
assert_true(len(matches[0]) == 0)
matches = analysis.anneal(template, primer, min_tm=30.0)
assert_true(len(matches[0]) > 0)
def test_min_tm():
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
# Test forward priming
# Tm should be ~40 C
seq = DNA('CTTCTATCGAACAA')
primer = Primer(seq, seq.tm())
matches = analysis.anneal(template, primer, min_tm=60.0)
assert_true(len(matches[0]) == 0)
matches = analysis.anneal(template, primer, min_tm=30.0)
assert_true(len(matches[0]) > 0)
def test_near_index():
'''Test binding near index for circular templates.'''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
template = template.circularize()
seq = DNA('aggccctttcgtctcgcgcgttt')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
print fwd_matches
print loc[0]
print loc[1]
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
for match in loc[0]:
expected = match + len(seq)
if expected > len(template):
expected -= len(template)
assert_true(expected in fwd_indices)
for match in loc[1]:
expected = match + len(seq)
if expected > len(template):
expected -= len(template)
assert_true(expected in rev_indices)
def test_multiple_priming():
''' test multiple binding sites '''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
template = template.circularize()
seq = DNA('cgccagggttttcccagtcacgac')
template = template.linearize()
template = template + seq + DNA("AGGCGTATGC") + seq
template = (template + DNA("GGGGGGG") + seq.reverse_complement() +
DNA("GGAAAG"))
template = template.circularize()
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
def test_near_index():
'''Test binding near index for circular templates.'''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
template = template.circularize()
seq = DNA('aggccctttcgtctcgcgcgttt')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
print fwd_matches
print loc[0]
print loc[1]
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
for match in loc[0]:
expected = match + len(seq)
if expected > len(template):
expected -= len(template)
assert_true(expected in fwd_indices)
for match in loc[1]:
expected = match + len(seq)
if expected > len(template):
expected -= len(template)
assert_true(expected in rev_indices)
def test_multiple_priming():
''' test multiple binding sites '''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
template = template.circularize()
seq = DNA('cgccagggttttcccagtcacgac')
template = template.linearize()
template = template + seq + DNA("AGGCGTATGC") + seq
template = (template + DNA("GGGGGGG") + seq.reverse_complement() +
DNA("GGAAAG"))
template = template.circularize()
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
def test_overhang():
''' test forward priming '''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
seq = DNA('cgccagggttttcccagtcacgac')
overhang = DNA('ggggggg')
seq2 = overhang + seq
primer = Primer(seq2, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_indices) == len(loc[0]))
assert_true(len(rev_indices) == len(loc[1]))
# FIXME: Add match length check for all these cases.
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
# Test forward priming.
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
seq = DNA('ACAAGAGAGATTGGGAAGGAAAGGATCA')
overhang = DNA('ggggggg')
seq2 = overhang + seq
primer = Primer(seq2, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_indices) == len(loc[0]))
assert_true(len(rev_indices) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
def test_overhang():
''' test forward priming '''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
seq = DNA('cgccagggttttcccagtcacgac')
overhang = DNA('ggggggg')
seq2 = overhang + seq
primer = Primer(seq2, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_indices) == len(loc[0]))
assert_true(len(rev_indices) == len(loc[1]))
# FIXME: Add match length check for all these cases.
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
# Test forward priming.
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
seq = DNA('ACAAGAGAGATTGGGAAGGAAAGGATCA')
overhang = DNA('ggggggg')
seq2 = overhang + seq
primer = Primer(seq2, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_indices) == len(loc[0]))
assert_true(len(rev_indices) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
def test_basic():
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
# Test forward priming.
seq = DNA('cgccagggttttcccagtcacgac')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
# fwd_lens = [match[1] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
# rev_lens = [match[1] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
# Top strand matches
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
# Top strand matches
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
# Test reverse priming
seq = DNA('ACAAGAGAGATTGGGAAGGAAAGGATCA')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_indices) == len(loc[0]))
assert_true(len(rev_indices) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
def test_basic():
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
# Test forward priming.
seq = DNA('cgccagggttttcccagtcacgac')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
# fwd_lens = [match[1] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
# rev_lens = [match[1] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
# Top strand matches
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
# Top strand matches
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
# Test reverse priming
seq = DNA('ACAAGAGAGATTGGGAAGGAAAGGATCA')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
fwd_indices = [match[0] for match in fwd_matches]
rev_indices = [match[0] for match in rev_matches]
loc = template.locate(seq)
assert_true(len(fwd_indices) == len(loc[0]))
assert_true(len(rev_indices) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_indices)
for match in loc[1]:
assert_true(match + len(seq) in rev_indices)
def test_no_priming():
''' test no priming '''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(os.path.join(current_path,
"pMODKan-HO-pACT1GEV.ape"))
seq = DNA('ggaggagggcggcgaggcgagcgacggaggggga')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
loc = template.locate(seq)
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_matches)
for match in loc[1]:
assert_true(match + len(seq) in rev_matches)
def test_no_priming():
''' test no priming '''
current_path = os.path.dirname(__file__)
template = seqio.read_dna(
os.path.join(current_path, "pMODKan-HO-pACT1GEV.ape"))
seq = DNA('ggaggagggcggcgaggcgagcgacggaggggga')
primer = Primer(seq, 50.6)
matches = analysis.anneal(template, primer)
fwd_matches, rev_matches = matches
loc = template.locate(seq)
assert_true(len(fwd_matches) == len(loc[0]))
assert_true(len(rev_matches) == len(loc[1]))
for match in loc[0]:
assert_true(match + len(seq) in fwd_matches)
for match in loc[1]:
assert_true(match + len(seq) in rev_matches)
