def test_cigar(self):
"""testing cigar correction function"""
cigar = [[0, 14], [1, 1], [0, 5]]
from mirtop.mirna.realign import cigar_correction
fixed = cigar_correction(cigar, "AAAAGCTGGGTTGAGGAGGA",
"AAAAGCTGGGTTGAGAGGA")
print "\n testing cigar correction"
print fixed[0]
print fixed[1]
def test_cigar(self):
"""testing cigar correction function"""
cigar = [[0, 14], [1, 1], [0, 5]]
from mirtop.mirna.realign import cigar_correction, make_cigar
fixed = cigar_correction(cigar, "AAAAGCTGGGTTGAGGAGGA",
"AAAAGCTGGGTTGAGAGGA")
if not fixed[0] == "AAAAGCTGGGTTGAGGAGGA":
raise ValueError("Sequence 1 is not right.")
if not fixed[1] == "AAAAGCTGGGTTGA-GAGGA":
raise ValueError("Sequence 2 is not right.")
if not make_cigar("AAA-AAATAAA", "AGACAAA-AAA") == "MGMD3MI3M":
raise ValueError("Cigar not eq to MAMDMMMIMMM: %s" %
make_cigar("AAA-AAATAAA", "AGACAAA-AAA"))
def tune(seq, precursor, start, cigar):
"""
The actual fn that will realign the sequence
"""
if cigar:
seq, mature = cigar_correction(cigar, seq, precursor[start:])
else:
seq, mature, score, p, size = align(seq,
precursor[start:start + len(seq)])
cigar = make_cigar(seq, mature)
if seq.startswith("-"):
seq = seq[1:]
if seq.endswith("-"):
seq = seq[:-1]
logger.debug("TUNE:: %s %s %s" % (cigar, seq, mature))
error = set()
pattern_addition = [[1, 1, 0], [1, 0, 1], [0, 1, 0], [0, 1, 1], [0, 0, 1],
[1, 1, 1]]
for pos in range(0, len(seq)):
if seq[pos] != mature[pos]:
error.add(pos)
subs, add = [], []
for e in error:
if e < len(seq) - 3:
subs.append([e, seq[e], mature[e]])
pattern, error_add = [], []
for e in range(len(seq) - 3, len(seq)):
if e in error:
pattern.append(1)
error_add.append(e)
else:
pattern.append(0)
for p in pattern_addition:
if pattern == p:
add = seq[error_add[0]:].replace("-", "")
break
if not add and error_add:
for e in error_add:
subs.append([e, seq[e], mature[e]])
return subs, add, make_cigar(seq, mature)
def test_cigar(self):
"""testing cigar correction function"""
cigar = [[0, 14], [1, 1], [0, 5]]
from mirtop.mirna.realign import cigar_correction, make_cigar, \
cigar2snp, expand_cigar
fixed = cigar_correction(cigar, "AAAAGCTGGGTTGAGGAGGA",
"AAAAGCTGGGTTGAGAGGA")
if not fixed[0] == "AAAAGCTGGGTTGAGGAGGA":
raise ValueError("Sequence 1 is not right.")
if not fixed[1] == "AAAAGCTGGGTTGA-GAGGA":
raise ValueError("Sequence 2 is not right.")
if not make_cigar("AAA-AAATAAA", "AGACAAA-AAA") == "MAMD3MI3M":
raise ValueError("Cigar not eq to MAMD3MI3M: %s" %
make_cigar("AAA-AAATAAA", "AGACAAA-AAA"))
# test expand cigar
if not expand_cigar("3MA3M") == "MMMAMMM":
raise ValueError("Cigar 3MA3M not eqaul to MMMAMMM but to %s" %
expand_cigar("3MA3M"))
# test cigar to snp
if not cigar2snp("3MA3M", "AAATCCC")[0] == [3, "A", "T"]:
raise ValueError("3MA3M not equal AAATCCC but %s" %
cigar2snp("3MA3M", "AAATCCC"))
def test_cigar(self):
"""testing cigar correction function"""
cigar = [[0, 14], [1, 1], [0, 5]]
from mirtop.mirna.realign import cigar_correction, make_cigar, \
cigar2snp, expand_cigar
fixed = cigar_correction(cigar, "AAAAGCTGGGTTGAGGAGGA",
"AAAAGCTGGGTTGAGAGGA")
if not fixed[0] == "AAAAGCTGGGTTGAGGAGGA":
raise ValueError("Sequence 1 is not right.")
if not fixed[1] == "AAAAGCTGGGTTGA-GAGGA":
raise ValueError("Sequence 2 is not right.")
if not make_cigar("AAA-AAATAAA", "AGACAAA-AAA") == "MAMD3MI3M":
raise ValueError("Cigar not eq to MAMD3MI3M: %s" %
make_cigar("AAA-AAATAAA", "AGACAAA-AAA"))
# test expand cigar
if not expand_cigar("3MA3M") == "MMMAMMM":
raise ValueError("Cigar 3MA3M not eqaul to MMMAMMM but to %s" %
expand_cigar("3MA3M"))
# test cigar to snp
if not cigar2snp("3MA3M", "AAATCCC")[0] == [3, "A", "T"]:
raise ValueError("3MA3M not equal AAATCCC but %s" %
cigar2snp("3MA3M", "AAATCCC"))
def tune(seq, precursor, start, cigar):
"""
The actual fn that will realign the sequence to find the nt changes
at 5', 3' sequence and nt variations.
Args:
*seq (str)*: sequence of the read.
*precursor (str)*: sequence of the precursor.
*start (int)*: start position of sequence on the precursor, +1.
*cigar (str)*: similar to SAM CIGAR attribute.
Returns:
*list* with:
subs (list): substitutions
add (list): nt added to the end
cigar (str): updated cigar
"""
end = len(seq)
if start < 0:
end = end + start
start = 0
if cigar:
seq, mature = cigar_correction(cigar, seq, precursor[start:])
else:
seq, mature, score, p, size = align(seq, precursor[start:start + end])
cigar = make_cigar(seq, mature)
if seq.startswith("-"):
seq = seq[1:]
if seq.endswith("-"):
seq = seq[:-1]
logger.debug("TUNE:: %s %s %s" % (cigar, seq, mature))
error = set()
for pos in range(0, len(seq)):
if seq[pos] != mature[pos]:
error.add(pos)
subs, add = [], []
prob = 0
add_position = []
for e in range(len(seq) - 1, len(seq) - 6, -1):
if e in error:
prob = 1
if prob == 1:
add.append(seq[e])
add_position.append(e)
if e not in error and prob == 0 and seq[e] in ["A", "T"]:
add.append(seq[e])
add_position.append(e)
continue
if e not in error:
if add:
add.pop()
add_position.pop()
if prob == 0:
add = []
add_position = []
break
for e in error:
if e not in add_position:
subs.append([e, seq[e], mature[e]])
logger.debug("TUNE:: %s %s" % (subs, add))
return subs, "".join(add), make_cigar(seq, mature)