def test_default_args_starargs_and_keyonly(self):
spec = [('x', int32), ('y', int32), ('z', int32),
('args', types.UniTuple(int32, 2)), ('a', int32)]
with self.assertRaises(errors.UnsupportedError) as raises:
jitclass(spec)(TestClass2)
msg = "VAR_POSITIONAL argument type unsupported"
self.assertIn(msg, str(raises.exception))
def test_default_args_starargs_and_keyonly(self):
spec = [('x', int32),
('y', int32),
('z', int32),
('args', types.UniTuple(int32, 2)),
('a', int32)]
with self.assertRaises(errors.UnsupportedError) as raises:
jitclass(spec)(TestClass2)
msg = "VAR_POSITIONAL argument type unsupported"
self.assertIn(msg, str(raises.exception))
def test_globals(self):
class Mine(object):
constant = 123
def __init__(self):
pass
with self.assertRaises(TypeError) as raises:
jitclass(())(Mine)
self.assertEqual(str(raises.exception),
"class members are not yet supported: constant")
def test_import_warnings(self):
class Test:
def __init__(self):
pass
with warnings.catch_warnings(record=True) as ws:
numba.experimental.jitclass([])(Test)
self.assertEqual(len(ws), 0)
numba.jitclass([])(Test)
self.assertEqual(len(ws), 1)
self.assertIs(ws[0].category, errors.NumbaDeprecationWarning)
self.assertIn("numba.experimental.jitclass", ws[0].message.msg)
def test_globals(self):
class Mine(object):
constant = 123
def __init__(self):
pass
with self.assertRaises(TypeError) as raises:
jitclass(())(Mine)
self.assertEqual(str(raises.exception),
"class members are not yet supported: constant")
def make_jitclass_element(self):
spec = [
('many', types.float64[:]),
('scalar', types.float64),
]
JCItem = jitclass(spec)(Item)
return JCItem
def test_default_args_keyonly(self):
spec = [('x', int32), ('y', int32), ('z', int32), ('a', int32)]
TestClass = jitclass(spec)(TestClass1)
tc = TestClass(2, 3)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 3)
self.assertEqual(tc.z, 1)
self.assertEqual(tc.a, 5)
tc = TestClass(y=4, x=2, a=42, z=100)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 4)
self.assertEqual(tc.z, 100)
self.assertEqual(tc.a, 42)
tc = TestClass(y=4, x=2, a=42)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 4)
self.assertEqual(tc.z, 1)
self.assertEqual(tc.a, 42)
tc = TestClass(y=4, x=2)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 4)
self.assertEqual(tc.z, 1)
self.assertEqual(tc.a, 5)
def test_spec_errors(self):
spec1 = [('x', int), ('y', float32[:])]
spec2 = [(1, int32), ('y', float32[:])]
class Test(object):
def __init__(self):
pass
with self.assertRaises(TypeError) as raises:
jitclass(spec1)(Test)
self.assertIn("spec values should be Numba type instances",
str(raises.exception))
with self.assertRaises(TypeError) as raises:
jitclass(spec2)(Test)
self.assertEqual(str(raises.exception),
"spec keys should be strings, got 1")
def fjit(fun):
'just-in-time compile a function by wrapping it in a singleton class'
from numba import jitclass
import time
# the function is jitted first
jitted_fun = njit(fun)
# Generate a random class name like 'Singleton_Sat_Jan__2_18_08_32_2016'
classname = 'Singleton_' + time.asctime().replace(' ','_').replace(':','_')
# programmatically create a class equivalent to :
# class Singleton_Sat_Jan__2_18_08_32_2016:
# def __init__(self): pass
# def value(self, x): return fj(x)
def __init__(self): pass
def value(self, x): return jitted_fun(x)
SingletonClass = type(classname, (object,), {'__init__': __init__, 'value': value})
# jit compile the class
# spec is [] since we don't store attributes
spec = []
sc = jitclass(spec)(SingletonClass)
# return a unique instance of the class
return sc()
def make_jitclass_element(self):
spec = [
('many', types.float64[:]),
('scalar', types.float64),
]
JCItem = jitclass(spec)(Item)
return JCItem
def test_default_args_keyonly(self):
spec = [('x', int32),
('y', int32),
('z', int32),
('a', int32)]
TestClass = jitclass(spec)(TestClass1)
tc = TestClass(2, 3)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 3)
self.assertEqual(tc.z, 1)
self.assertEqual(tc.a, 5)
tc = TestClass(y=4, x=2, a=42, z=100)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 4)
self.assertEqual(tc.z, 100)
self.assertEqual(tc.a, 42)
tc = TestClass(y=4, x=2, a=42)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 4)
self.assertEqual(tc.z, 1)
self.assertEqual(tc.a, 42)
tc = TestClass(y=4, x=2)
self.assertEqual(tc.x, 2)
self.assertEqual(tc.y, 4)
self.assertEqual(tc.z, 1)
self.assertEqual(tc.a, 5)
def test_spec_errors(self):
spec1 = [('x', int), ('y', float32[:])]
spec2 = [(1, int32), ('y', float32[:])]
class Test(object):
def __init__(self):
pass
with self.assertRaises(TypeError) as raises:
jitclass(spec1)(Test)
self.assertIn("spec values should be Numba type instances",
str(raises.exception))
with self.assertRaises(TypeError) as raises:
jitclass(spec2)(Test)
self.assertEqual(str(raises.exception),
"spec keys should be strings, got 1")
def test_user_deleter_error(self):
class Foo(object):
def __init__(self):
pass
@property
def value(self):
return 1
@value.deleter
def value(self):
pass
with self.assertRaises(TypeError) as raises:
jitclass([])(Foo)
self.assertEqual(str(raises.exception),
"deleter is not supported: value")
def test_user_deleter_error(self):
class Foo(object):
def __init__(self):
pass
@property
def value(self):
return 1
@value.deleter
def value(self):
pass
with self.assertRaises(TypeError) as raises:
jitclass([])(Foo)
self.assertEqual(str(raises.exception),
"deleter is not supported: value")
def test_name_shadowing_error(self):
class Foo(object):
def __init__(self):
pass
@property
def my_property(self):
pass
def my_method(self):
pass
with self.assertRaises(NameError) as raises:
jitclass([('my_property', int32)])(Foo)
self.assertEqual(str(raises.exception), 'name shadowing: my_property')
with self.assertRaises(NameError) as raises:
jitclass([('my_method', int32)])(Foo)
self.assertEqual(str(raises.exception), 'name shadowing: my_method')
def test_jitclass(self):
with override_config('DISABLE_JIT', True):
with forbid_codegen():
SimpleJITClass = jitclass(simple_class_spec)(SimpleClass)
obj = SimpleJITClass()
self.assertPreciseEqual(obj.h, 5)
cfunc = jit(nopython=True)(simple_class_user)
self.assertPreciseEqual(cfunc(obj), 5)
def test_name_shadowing_error(self):
class Foo(object):
def __init__(self):
pass
@property
def my_property(self):
pass
def my_method(self):
pass
with self.assertRaises(NameError) as raises:
jitclass([('my_property', int32)])(Foo)
self.assertEqual(str(raises.exception), 'name shadowing: my_property')
with self.assertRaises(NameError) as raises:
jitclass([('my_method', int32)])(Foo)
self.assertEqual(str(raises.exception), 'name shadowing: my_method')
def test_jitclass(self):
with override_config('DISABLE_JIT', True):
with forbid_codegen():
SimpleJITClass = jitclass(simple_class_spec)(SimpleClass)
obj = SimpleJITClass()
self.assertPreciseEqual(obj.h, 5)
cfunc = jit(nopython=True)(simple_class_user)
self.assertPreciseEqual(cfunc(obj), 5)
def test_annotations(self):
"""
Methods with annotations should compile fine (issue #1911).
"""
from .annotation_usecases import AnnotatedClass
spec = {'x': int32}
cls = jitclass(spec)(AnnotatedClass)
obj = cls(5)
self.assertEqual(obj.x, 5)
self.assertEqual(obj.add(2), 7)
def test_annotations(self):
"""
Methods with annotations should compile fine (issue #1911).
"""
from .annotation_usecases import AnnotatedClass
spec = {'x': int32}
cls = jitclass(spec)(AnnotatedClass)
obj = cls(5)
self.assertEqual(obj.x, 5)
self.assertEqual(obj.add(2), 7)
def _make_jitclass_for_type(base, nbtype):
"""
Apply jitclass to one of the base classes with the signature for the given
array data type.
"""
spec = [
('array', nbtype[:]),
('arraysize', nb.intp),
('size', nb.intp),
('upper', nb.boolean),
('diag_val', nbtype)
]
return nb.jitclass(spec)(base)
def create_tree(self, subpattern, i, j, k, parent, plen):
pNode = numba.jitclass(spec)(ParallelNode)
pNode.start = i
pNode.end = j
left = math.ceil((k + 1) / 2.0)
pNode.parent = parent
pNode.error = k
pNode.pattern = subpattern
if k == 0:
self.leaves.append(pNode)
else:
lk = math.floor((left * k) / (k + 1))
self.create_tree(subpattern[:left * plen], i, i + left * plen - 1,
lk, pNode, plen)
rk = math.floor(((k + 1 - left) * k) / (k + 1))
self.create_tree(subpattern[left * plen:], i + left * plen, j, rk,
pNode, plen)
def get_shuffle_meta_class(arr_t):
count_arr_typ = types.Array(types.int32, 1, 'C')
if isinstance(arr_t, types.Array):
spec = [
('send_counts', count_arr_typ),
('recv_counts', count_arr_typ),
('send_buff', arr_t),
('out_arr', arr_t),
('n_send', types.intp),
('n_out', types.intp),
('send_disp', count_arr_typ),
('recv_disp', count_arr_typ),
('tmp_offset', count_arr_typ),
('send_counts_char', types.none),
('recv_counts_char', types.none),
('send_arr_lens', types.none),
('send_arr_chars', types.none),
('send_disp_char', types.none),
('recv_disp_char', types.none),
('tmp_offset_char', types.none),
('send_arr_chars_arr', types.none),
]
else:
spec = [
('send_counts', count_arr_typ),
('recv_counts', count_arr_typ),
('send_buff', types.none),
('out_arr', arr_t),
('n_send', types.intp),
('n_out', types.intp),
('send_disp', count_arr_typ),
('recv_disp', count_arr_typ),
('tmp_offset', count_arr_typ),
('send_counts_char', count_arr_typ),
('recv_counts_char', count_arr_typ),
('send_arr_lens', types.Array(types.uint32, 1, 'C')),
('send_arr_chars', types.voidptr),
('send_disp_char', count_arr_typ),
('recv_disp_char', count_arr_typ),
('tmp_offset_char', count_arr_typ),
('send_arr_chars_arr', types.Array(types.uint8, 1, 'C')),
]
ShuffleMetaCL = numba.jitclass(spec)(ShuffleMeta)
return ShuffleMetaCL
def new_numba(N):
import numba
spec = [
('N', numba.int32),
('D', numba.float64),
('vz', numba.float64),
('k', numba.float64),
('Cf', numba.float64),
('z0', numba.float64),
('zf', numba.float64),
('h', numba.float64),
]
Numba_PFR = numba.jitclass(spec)(pfr)
jitted_pfr_model = numba.jit(model_pfr_shared_direct, nopython=True)
numba_pfr = Numba_PFR(N)
numba_args = setup_base(N)
numba_args[3] = numba_pfr
dasslcy.solve(jitted_pfr_model, *numba_args, share_res=1)
return [jitted_pfr_model] + numba_args
def test(): # pragma: no cover
import time
#SortStateCL = SortState #numba.jitclass(spec)(SortState)
# warm up
t1 = time.time()
T = np.ones(3)
data = (
np.arange(3),
np.ones(3),
)
spec = [
('key_arrs', numba.types.Tuple((numba.float64[::1], ))),
('aLength', numba.intp),
('minGallop', numba.intp),
('tmpLength', numba.intp),
('tmp', numba.types.Tuple((numba.float64[::1], ))),
('stackSize', numba.intp),
('runBase', numba.int64[:]),
('runLen', numba.int64[:]),
('data', numba.typeof(data)),
('tmp_data', numba.typeof(data)),
]
SortStateCL = numba.jitclass(spec)(SortState)
sortState = SortStateCL((T, ), 3, data)
sort(sortState, (T, ), 0, 3, data)
print("compile time", time.time() - t1)
n = 210000
np.random.seed(2)
data = (np.arange(n), np.random.ranf(n))
A = np.random.ranf(n)
df = pd.DataFrame({'A': A, 'B': data[0], 'C': data[1]})
t1 = time.time()
#B = np.sort(A)
df2 = df.sort_values('A', inplace=False)
t2 = time.time()
sortState = SortStateCL((A, ), n, data)
sort(sortState, (A, ), 0, n, data)
print("HPAT", time.time() - t2, "Numpy", t2 - t1)
# print(df2.B)
# print(data)
np.testing.assert_almost_equal(data[0], df2.B.values)
np.testing.assert_almost_equal(data[1], df2.C.values)
def get_local_sort_func(key_typ, data_tup_typ):
sort_state_spec = [
('key_arrs', to_string_list_typ(key_typ)),
('aLength', numba.intp),
('minGallop', numba.intp),
('tmpLength', numba.intp),
('tmp', to_string_list_typ(key_typ)),
('stackSize', numba.intp),
('runBase', numba.int64[:]),
('runLen', numba.int64[:]),
('data', to_string_list_typ(data_tup_typ)),
('tmp_data', to_string_list_typ(data_tup_typ)),
]
SortStateCL = numba.jitclass(sort_state_spec)(hpat.timsort.SortState)
# XXX: make sure function is not using old SortState
local_sort.__globals__['SortState'] = SortStateCL
_local_sort_f = numba.njit(local_sort)
_local_sort_f.compile(signature(types.none, key_typ, data_tup_typ))
return _local_sort_f
def make_jitclass_container(self):
spec = {
'data': types.List(dtype=types.List(types.float64[::1])),
}
JCContainer = jitclass(spec)(Container)
return JCContainer
from numba import jitclass, float32
# 2D point class with constructor
class Point2D(object):
def __init__(self, x, y):
self.x = x
self.y = y
def __str__(self):
return '(x=' + str(self.x) + ', y=' + str(self.y) + ')\n'
# Here we are creating the instance of the class Point2D
p1 = Point2D(10.0, 10.0)
print(p1) # Printing invokes __str__
# Here we are creating the instance of Point2D which is compiled by Numba
compiled_class = jitclass([('x', float32),
('y', float32)])(Point2D) # Compiling in this line
p2 = compiled_class(10.0, 10.0) # Creating the instance of compiled class
print(p2) # Invocation of __str__ is not implemented in Numba
print('(x=' + str(p2.x) + ', y=' + str(p2.y) +
')') # Workaround to print representation of the object
def Vector(numba_type):
"""Generates an instance of a dynamically resized vector numba jitclass."""
if numba_type in Vector._saved_type:
return Vector._saved_type[numba_type]
class _Vector:
"""Dynamically sized arrays in nopython mode."""
def __init__(self, n):
"""Initialize with space enough to hold n garbage values."""
self.n = n
self.m = n
self.full_arr = np.empty(self.n, dtype=numba_type)
@property
def size(self):
"""The number of valid values."""
return self.n
@property
def arr(self):
"""Return the subarray."""
return self.full_arr[:self.n]
@property
def last(self):
"""The last element in the array."""
if self.n:
return self.full_arr[self.n-1]
else:
raise IndexError(
"This numbavec has no elements: cannot return 'last'.")
@property
def first(self):
"""The first element in the array."""
if self.n:
return self.full_arr[0]
else:
raise IndexError(
"This numbavec has no elements: cannot return 'first'.")
def clear(self):
"""Remove all elements from the array."""
self.n = 0
return self
def extend(self, other):
"""Add the contents of a numpy array to the end of this Vector.
Arguments
---------
other : 1d array
The values to add to the end.
"""
n_required = self.size + other.size
self.reserve(n_required)
self.full_arr[self.size:n_required] = other
self.n = n_required
return self
def append(self, val):
"""Add a value to the end of the Vector, expanding it if necessary."""
if self.n == self.m:
self._expand()
self.full_arr[self.n] = val
self.n += 1
return self
def reserve(self, n):
"""Reserve a n elements in the underlying array.
Arguments
---------
n : int
The number of elements to reserve
Reserving n elements ensures no resize overhead when appending up
to size n-1 .
"""
if n > self.m: # Only change size if we are
temp = np.empty(int(n), dtype=numba_type)
temp[:self.n] = self.arr
self.full_arr = temp
self.m = n
return self
def consolidate(self):
"""Remove unused memory from the array."""
if self.n < self.m:
self.full_arr = self.arr.copy()
self.m = self.n
return self
def __array__(self):
"""Array inteface for Numpy compatibility."""
return self.full_arr[:self.n]
def _expand(self):
"""Internal function that handles the resizing of the array."""
self.m = int(self.m * _EXPANSION_CONSTANT_) + 1
temp = np.empty(self.m, dtype=numba_type)
temp[:self.n] = self.full_arr[:self.n]
self.full_arr = temp
def set_to(self, arr):
"""Make this vector point to another array of values.
Arguments
---------
arr : 1d array
Array to set this vector to. After this operation, self.arr
will be equal to arr. The dtype of this array must be the
same dtype as used to create the vector. Cannot be a readonly
vector.
"""
self.full_arr = arr
self.n = self.m = arr.size
def set_to_copy(self, arr):
"""Set this vector to an array, copying the underlying input.
Arguments
---------
arr : 1d array
Array to set this vector to. After this operation, self.arr
will be equal to arr. The dtype of this array must be the
same dtype as used to create the vector.
"""
self.full_arr = arr.copy()
self.n = self.m = arr.size
if numba_type not in Vector._saved_type:
spec = [("n", numba.uint64),
("m", numba.uint64),
("full_arr", numba_type[:])]
Vector._saved_type[numba_type] = numba.jitclass(spec)(_Vector)
return Vector._saved_type[numba_type]
def entry_point(argv):
args = {'-i': '', '-k': '50', '-n': '1000000', '-r': '', '-d': ''}
N = len(argv)
for i in xrange(1, N):
k = argv[i]
if k in args:
v = argv[i + 1]
args[k] = v
elif k[:2] in args and len(k) > 2:
args[k[:2]] = k[2:]
else:
continue
# bkt, the breakpoint
qry, kmer, Ns, bkt, dbs = args['-i'], int(args['-k']), int(eval(
args['-n'])), args['-r'], args['-d']
if not qry:
seq = 'ACCCATCGGGCTAAACCCCCCCCCCGATCGATCGAC'
#seq = 'AAAAAAAAAAGAAAAAAAAAATAAAAAAAAAACAAAAAAAAAA'
seq = 'AAAACCCCAATACCCCATAACCCC'
kmer = 4
a0 = [(k2n_(seq[elem:elem + kmer]), seq[elem - 1:elem],
seq[elem + kmer:elem + kmer + 1])
for elem in xrange(len(seq) - kmer + 1)]
a1 = [elem[:] for elem in seq2ns_(seq, kmer)]
print(a0 == a1)
print(a0[-105:])
print(a1[-105:])
# test
try:
N = int(eval(sys.argv[1]))
except:
N = 10**7
mkey = 5
print('test', N)
# the spec for jitclass
spec = {}
spec['capacity'] = nb.int64
spec['load'] = nb.float32
spec['size'] = nb.int64
spec['ksize'] = nb.int64
spec['ktype'] = nb.uint64
spec['keys'] = spec['ktype'][:]
spec['vtype'] = nb.uint32
spec['values'] = spec['vtype'][:]
spec['counts'] = nb.uint8[:]
oakht_jit = jitclass(spec)(oakht)
clf = oakht_jit(capacity=N,
ksize=mkey,
ktype=spec['ktype'],
vtype=spec['vtype'])
#clf = oakht_jit(capacity=int(N * 1.75), ksize=mkey, ktype=spec['ktype'], vtype=spec['vtype'])
print('initial finish')
@njit
def oa_test(N, k, clf):
x = np.random.randint(0, N, N)
for i in range(N - k + 1):
clf.push(x[i:i + k], i)
#clf.push(np.random.randint(0, N, k), i)
flag = 0
for i in range(N - k + 1):
#clf.push(x[i:i+k], i)
#clf.push(np.random.randint(0, N, k), i)
if not clf.has_key(x[i:i + k]):
flag += 1
print('x err', flag)
# check random generated array
flag = 0
y = np.random.randint(0, N, N)
for i in range(N - k + 1):
if clf.has_key(y[i:i + k]):
flag += 1
print('y err', flag)
#for key in clf.iterkeys():
# print('key is', key)
print('numba version')
oa_test(N, mkey, clf)
raise SystemExit()
if dbs:
#print('recover from', bkt)
# convert sequence to path and build the graph
dct = seq2graph(qry,
kmer=kmer,
bits=5,
Ns=Ns,
saved=dbs,
hashfunc=oamkht)
else:
# build the rdbg, convert sequence to path, and build the graph
#dct = seq2dbg(qry, kmer, 5, Ns, rec=bkt)
kmer_dict = seq2rdbg(qry, kmer, 5, Ns, rec=bkt)
#for i in kmer_dict:
# print('kmer dict size', qry, len(kmer_dict), kmer, n2k_(i, kmer, 5))
# if bkt:
# print('bkt is', bkt)
dct = seq2graph(qry,
kmer=kmer,
bits=5,
Ns=Ns,
kmer_dict=kmer_dict,
hashfunc=oamkht)
return 0
def init(self, inputset, parameters):
# base class 'init (...)' method
Model.init(self, inputset, parameters)
# get initial time and make sure it is a float
self.t = numpy.float64(inputset)
# store inputset and parameters
self.parameters = parameters
# create a precipitation instance
if self.numbify:
self.h = numba.jitclass(Precipitation_numba_spec)(Precipitation)(
*self.precipitation_coefficients)
else:
self.h = Precipitation(*self.precipitation_coefficients)
# generate random initial values for \xi and y using the observed (uncertain) initial values and the associated error model
initial = self.initial.draw(self.rng)
if self.verbosity >= 2:
print('Drawing initial values:')
print(initial)
# generate a random initial value for \xi with observed value as the mean and parameter r'\sigma_\xi' as the spread
xi0 = initial[r'$\xi$']
# determine tau
if self.tau is not None:
tau = self.tau
else:
tau = numpy.float64(self.parameters[r'$\tau$'])
# create and initialize OU process
if self.numbify:
self.ou = numba.jitclass(OrnsteinUhlenbeck_numba_spec)(
OrnsteinUhlenbeck)(tau)
else:
self.ou = OrnsteinUhlenbeck(tau)
self.ou.init(self.t, numpy.float64(xi0))
# initialize wastewater process
zeta = numpy.array(
[-self.parameters[r'$-\zeta_1$'], -self.parameters[r'$-\zeta_2$']],
dtype=numpy.float64)
chi = numpy.array(
[-self.parameters[r'$-\chi_1$'], self.parameters[r'$\chi_2$']],
dtype=numpy.float64)
if self.numbify:
self.w = numba.jitclass(Wastewater_numba_spec)(Wastewater)(zeta,
chi)
else:
self.w = Wastewater(zeta, chi)
# generate a random initial value for y with observed value as the mean and parameter r'\sigma_y' as the spread
y0 = initial['y']
if self.verbosity >= 2:
print('y0: ', y0)
# compute initial S from initial discharge
self.S = numpy.float64(self.parameters['K'] *
(y0 - self.w.evaluate(self.t)))
# initialize the the right hand side 'dS' of the ODE and its args
if self.numbify:
self.dS = numba.njit(dS)
else:
self.dS = dS
self.dS_args = (self.parameters['A'], self.h, self.ou,
self.parameters[r'$x_{gw}$'], self.parameters['K'])
# set integrator
integrate = None
if self.integrator == 'FE':
integrate = integrate_FE
if self.integrator == 'RKSSP':
integrate = integrate_RKSSP
assert integrate, ' :: ERROR: The requested integrator is not implemented.'
if self.numbify:
self.integrate = numba.njit(integrate)
else:
self.integrate = integrate
def create_my_class(value):
cls = jitclass([('value', typeof(value))])(MyClass)
return cls(value)
import numpy as np
from numba import jit, njit, jitclass
import gate
spec = [
('representation',
@jitclass(spec)
class TensorGate(gate.Gate):
'''Implements Gate using numpy tensors under the hood.'''
def __init__(self, gate_matrix, sites, N, name=None):
if any([x >= N for x in sites]):
raise ValueError('Acts on site outside qubit range')
self.dim = int(len(gate_matrix.shape)/2)
gate.Gate.__init__(self, gate_matrix, sites, N, name)
@njit()
def compose_with(self, other):
'''Uses np.tensordot to multiply with another tensor.
This multiplication process involves summing over the correct indices to match how matrix
multiplication should work. Furthermore, the process requires reordering the tensor
components afterwards so the tensor continues to act on the proper sites.'''
sums1 = []
sums2 = []
sites1 = self.sites.copy()
sites2 = other.sites.copy()
index = {}
def make_jitclass_container(self):
spec = {
'data': types.List(dtype=types.List(types.float64[::1])),
}
JCContainer = jitclass(spec)(Container)
return JCContainer
def data_alloc_shuffle_metadata_overload(data_t, n_pes_t, is_contig_t):
count = data_t.count
spec_null = [
('send_counts', types.none),
('recv_counts', types.none),
('send_buff', types.none),
('out_arr', types.none),
('n_send', types.none),
('n_out', types.none),
('send_disp', types.none),
('recv_disp', types.none),
('tmp_offset', types.none),
('send_counts_char', types.none),
('recv_counts_char', types.none),
('send_arr_lens', types.none),
('send_arr_chars', types.none),
('send_disp_char', types.none),
('recv_disp_char', types.none),
('tmp_offset_char', types.none),
('send_arr_chars_arr', types.none),
]
count_arr_typ = types.Array(types.int32, 1, 'C')
spec_str = [
('send_counts', types.none),
('recv_counts', types.none),
('send_buff', types.none),
('out_arr', string_array_type),
('n_send', types.none),
('n_out', types.none),
('send_disp', types.none),
('recv_disp', types.none),
('tmp_offset', types.none),
('send_counts_char', count_arr_typ),
('recv_counts_char', count_arr_typ),
('send_arr_lens', types.Array(types.uint32, 1, 'C')),
('send_arr_chars', types.voidptr),
('send_disp_char', count_arr_typ),
('recv_disp_char', count_arr_typ),
('tmp_offset_char', count_arr_typ),
('send_arr_chars_arr', types.Array(types.uint8, 1, 'C')),
]
ShuffleMetaStr = numba.jitclass(spec_str)(ShuffleMeta)
glbls = {
'ShuffleMetaStr': ShuffleMetaStr,
'np': np,
'get_data_ptr': get_data_ptr,
'num_total_chars': num_total_chars,
'get_ctypes_ptr': get_ctypes_ptr
}
for i, typ in enumerate(data_t.types):
if isinstance(typ, types.Array):
spec_null[2] = ('send_buff', typ)
spec_null[3] = ('out_arr', typ)
ShuffleMetaCL = numba.jitclass(spec_null.copy())(ShuffleMeta)
glbls['ShuffleMeta_{}'.format(i)] = ShuffleMetaCL
func_text = "def f(data, n_pes, is_contig):\n"
for i in range(count):
typ = data_t.types[i]
func_text += " arr = data[{}]\n".format(i)
if isinstance(typ, types.Array):
func_text += " send_buff = arr\n"
func_text += (
" meta_{} = ShuffleMeta_{}(None, None, send_buff, arr, None, None, None,"
" None, None, None, None, None, None, None, None, None, None)\n"
).format(i, i)
else:
assert typ == string_array_type
func_text += " send_counts_char = np.zeros(n_pes, np.int32)\n"
func_text += " recv_counts_char = np.empty(n_pes, np.int32)\n"
func_text += " send_arr_lens = np.empty(1, np.uint32)\n"
func_text += " if is_contig:\n"
func_text += " send_arr_lens = np.empty(len(arr), np.uint32)\n"
func_text += " send_arr_chars = get_ctypes_ptr(get_data_ptr(arr))\n"
func_text += " tmp_offset_char = send_counts_char\n"
func_text += " send_arr_chars_arr = np.empty(1, np.uint8)\n"
func_text += " if not is_contig:\n"
func_text += " tmp_offset_char = np.zeros(n_pes, np.int32)\n"
func_text += (
" meta_{} = ShuffleMetaStr(None, None, None, arr, None, None,"
"None, None, None, send_counts_char, recv_counts_char, send_arr_lens,"
" send_arr_chars, send_counts_char, recv_counts_char, tmp_offset_char, send_arr_chars_arr)\n"
).format(i)
func_text += " return ({}{})\n".format(
','.join(['meta_{}'.format(i) for i in range(count)]),
"," if count == 1 else "")
loc_vars = {}
exec(func_text, glbls, loc_vars)
alloc_impl = loc_vars['f']
return alloc_impl
def write_many(self, b, count):
self.data[self.loc:self.loc + count] = b
self.loc += count
def tell(self):
return self.loc
def so_far(self):
""" In write mode, the data we have gathered until now
"""
return self.data[:self.loc]
spec8 = [('data', numba.uint8[:]), ('loc', numba.int64), ('len', numba.int64)]
Numpy8 = numba.jitclass(spec8)(NumpyIO)
spec32 = [('data', numba.uint32[:]), ('loc', numba.int64),
('len', numba.int64)]
Numpy32 = numba.jitclass(spec32)(NumpyIO)
def _assemble_objects(assign, defi, rep, val, dic, d, null, null_val,
max_defi):
"""Dremel-assembly of arrays of values into lists
Parameters
----------
assign: array dtype O
To insert lists into
defi: int array
Definition levels, max 3
def create_my_class(value):
cls = jitclass([('value', typeof(value))])(MyClass)
return cls(value)
def write_many(self, b, count):
self.data[self.loc:self.loc + count] = b
self.loc += count
def tell(self):
return self.loc
def so_far(self):
""" In write mode, the data we have gathered until now
"""
return self.data[:self.loc]
spec8 = [('data', numba.uint8[:]), ('loc', numba.int64), ('len', numba.int64)]
Numpy8 = jitclass(spec8)(NumpyIO)
spec32 = [('data', numba.uint32[:]), ('loc', numba.int64),
('len', numba.int64)]
Numpy32 = jitclass(spec32)(NumpyIO)
def _assemble_objects(assign, defi, rep, val, dic, d, null, null_val, max_defi,
prev_i):
"""Dremel-assembly of arrays of values into lists
Parameters
----------
assign: array dtype O
To insert lists into
defi: int array
Definition levels, max 3
else:
return self.values[sp:ep]
def rowinds(self):
ris = np.zeros(self.nnz, np.intc)
for i in range(self.nrows):
sp, ep = self.row_extent(i)
ris[sp:ep] = i
return ris
_CSR64 = type('_CSR64', _CSR.__bases__, dict(_CSR.__dict__))
_CSR = jitclass({
'nrows': n.intc,
'ncols': n.intc,
'nnz': n.intc,
'rowptrs': n.intc[::1],
'colinds': n.intc[::1],
'values': n.float64[::1]
})(_CSR)
_CSR64 = jitclass({
'nrows': n.intc,
'ncols': n.intc,
'nnz': n.int64,
'rowptrs': n.int64[::1],
'colinds': n.intc[::1],
'values': n.float64[::1]
})(_CSR64)
class CSR:
"""
import numba
import bampy.bam as bam
import bampy.bam.packed_cigar as packed_cigar
import bampy.bam.packed_sequence as packed_sequence
import bampy.bam.tag as tag
import bampy.reference as reference
Tag = numba.jitclass({
'_header': tag.TagHeader,
'_buffer': memoryview,
})(bam.Tag)
"""Reference = numba.jitclass({
'name' : str,
'length' : int,
'index' : int,
'_optional' : dict,
})(reference.Reference)"""
PackedCIGAR = numba.jitclass({
'buffer': memoryview,
})(packed_cigar.PackedCIGAR)
PackedSequence = numba.jitclass({
'buffer': memoryview,
'_length': int,
})(packed_sequence.PackedSequence)
Record = numba.jitclass({
'_header': bam.record.RecordHeader,
self.loc += 1
def write_many(self, b, count):
self.data[self.loc:self.loc+count] = b
self.loc += count
def tell(self):
return self.loc
def so_far(self):
""" In write mode, the data we have gathered until now
"""
return self.data[:self.loc]
spec8 = [('data', numba.uint8[:]), ('loc', numba.int64), ('len', numba.int64)]
Numpy8 = numba.jitclass(spec8)(NumpyIO)
spec32 = [('data', numba.uint32[:]), ('loc', numba.int64), ('len', numba.int64)]
Numpy32 = numba.jitclass(spec32)(NumpyIO)
def _assemble_objects(assign, defi, rep, val, dic, d, null, null_val, max_defi, prev_i):
"""Dremel-assembly of arrays of values into lists
Parameters
----------
assign: array dtype O
To insert lists into
defi: int array
Definition levels, max 3
rep: int array
Repetition levels, max 1
import numba
import bampy.bgzf as bgzf
SubField = numba.jitclass({
'header': bgzf.block.SubFieldHeader,
'data': bytearray,
})(bgzf.block.SubField)
Block = numba.jitclass({
'_header': bgzf.block.Header,
'_trailer': bgzf.block.Trailer,
'extra_fields': SubField[:],
'size': int,
'flags': bgzf.block.BlockFlags,
})(bgzf.Block)