def post(self, study_id): method = self.get_argument('remote-request-type') url = self.get_argument('inputURL') ssh_key = self.request.files['ssh-key'][0]['body'] status = 'success' message = '' try: study = Study(int(study_id)) except QiitaDBUnknownIDError: raise HTTPError(404, reason="Study %s does not exist" % study_id) check_access(self.current_user, study, no_public=True, raise_error=True) _, upload_folder = get_mountpoint("uploads")[0] upload_folder = join(upload_folder, study_id) ssh_key_fp = join(upload_folder, '.key.txt') create_nested_path(upload_folder) with open(ssh_key_fp, 'wb') as f: f.write(ssh_key) chmod(ssh_key_fp, 0o600) qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') if method == 'list': cmd = qiita_plugin.get_command('list_remote_files') params = Parameters.load(cmd, values_dict={ 'url': url, 'private_key': ssh_key_fp, 'study_id': study_id }) elif method == 'transfer': cmd = qiita_plugin.get_command('download_remote_files') params = Parameters.load(cmd, values_dict={ 'url': url, 'private_key': ssh_key_fp, 'destination': upload_folder }) else: status = 'error' message = 'Not a valid method' if status == 'success': job = ProcessingJob.create(self.current_user, params, True) job.submit() r_client.set(UPLOAD_STUDY_FORMAT % study_id, dumps({'job_id': job.id})) self.write({'status': status, 'message': message})
def post(self, preprocessed_data_id): user = self.current_user # make sure user is admin and can therefore actually submit to VAMPS if user.level != 'admin': raise HTTPError(403, "User %s cannot submit to VAMPS!" % user.id) msg = '' msg_level = 'success' plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = plugin.get_command('submit_to_VAMPS') artifact = Artifact(preprocessed_data_id) # Check if the artifact is already being submitted to VAMPS is_being_submitted = any( [j.status in ('queued', 'running') for j in artifact.jobs(cmd=cmd)]) if is_being_submitted == 'submitting': msg = "Cannot resubmit! Data is already being submitted" msg_level = 'danger' self.display_template(preprocessed_data_id, msg, msg_level) else: params = Parameters.load( cmd, values_dict={'artifact': preprocessed_data_id}) job = ProcessingJob.create(user, params, True) job.submit() self.redirect('/study/description/%s' % artifact.study.study_id)
def artifact_post_req(user, artifact_id): """Deletes the artifact Parameters ---------- user : qiita_db.user.User The user requesting the action artifact_id : int Id of the artifact being deleted """ artifact_id = int(artifact_id) artifact = Artifact(artifact_id) check_artifact_access(user, artifact) analysis = artifact.analysis if analysis: # Do something when deleting in the analysis part to keep track of it redis_key = "analysis_%s" % analysis.id else: pt_id = artifact.prep_templates[0].id redis_key = PREP_TEMPLATE_KEY_FORMAT % pt_id qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_artifact') params = Parameters.load(cmd, values_dict={'artifact': artifact_id}) job = ProcessingJob.create(user, params) r_client.set(redis_key, dumps({'job_id': job.id, 'is_qiita_job': True})) job.submit()
def post(self, preprocessed_data_id): user = self.current_user # make sure user is admin and can therefore actually submit to EBI if user.level != 'admin': raise HTTPError(403, reason="User %s cannot submit to EBI!" % user.id) submission_type = self.get_argument('submission_type') if submission_type not in ['ADD', 'MODIFY']: raise HTTPError(403, reason="User: %s, %s is not a recognized " "submission type" % (user.id, submission_type)) study = Artifact(preprocessed_data_id).study state = study.ebi_submission_status if state == 'submitting': message = "Cannot resubmit! Current state is: %s" % state self.display_template(preprocessed_data_id, message, 'danger') else: qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('submit_to_EBI') params = Parameters.load( cmd, values_dict={'artifact': preprocessed_data_id, 'submission_type': submission_type}) job = ProcessingJob.create(user, params, True) r_client.set('ebi_submission_%s' % preprocessed_data_id, dumps({'job_id': job.id, 'is_qiita_job': True})) job.submit() level = 'success' message = 'EBI submission started. Job id: %s' % job.id self.redirect("%s/study/description/%d?level=%s&message=%s" % ( qiita_config.portal_dir, study.id, level, url_escape(message)))
def write_demux_files(self, prep_template, generate_hdf5=True): """Writes a demux test file to avoid duplication of code""" fna_fp = join(self.temp_dir, 'seqs.fna') demux_fp = join(self.temp_dir, 'demux.seqs') if generate_hdf5: with open(fna_fp, 'w') as f: f.write(FASTA_EXAMPLE) with File(demux_fp, "w") as f: to_hdf5(fna_fp, f) else: with open(demux_fp, 'w') as f: f.write('') if prep_template.artifact is None: ppd = Artifact.create([(demux_fp, 6)], "Demultiplexed", prep_template=prep_template) else: params = Parameters.from_default_params( DefaultParameters(1), {'input_data': prep_template.artifact.id}) ppd = Artifact.create([(demux_fp, 6)], "Demultiplexed", parents=[prep_template.artifact], processing_parameters=params) return ppd
def study_delete_req(study_id, user_id): """Delete a given study Parameters ---------- study_id : int Study id to delete user_id : str User requesting the deletion Returns ------- dict Status of deletion, in the format {status: status, message: message} """ access_error = check_access(study_id, user_id) if access_error: return access_error qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_study') params = Parameters.load(cmd, values_dict={'study': study_id}) job = ProcessingJob.create(User(user_id), params, True) # Store the job id attaching it to the sample template id r_client.set(STUDY_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'status': 'success', 'message': ''}
def setUp(self): uploads_path = get_mountpoint('uploads')[0][1] # Create prep test file to point at self.update_fp = join(uploads_path, '1', 'update.txt') with open(self.update_fp, 'w') as f: f.write("""sample_name\tnew_col\n1.SKD6.640190\tnew_value\n""") self._files_to_remove = [self.update_fp] self._files_to_remove = [] # creating temporal files and artifact # NOTE: we don't need to remove the artifact created cause it's # used to test the delete functionality fd, fp = mkstemp(suffix='_seqs.fna') close(fd) with open(fp, 'w') as f: f.write(">1.sid_r4_0 M02034:17:000000000-A5U18:1:1101:15370:1394 " "1:N:0:1 orig_bc=CATGAGCT new_bc=CATGAGCT bc_diffs=0\n" "GTGTGCCAGCAGCCGCGGTAATACGTAGGG\n") # 4 Demultiplexed filepaths_processed = [(fp, 4)] # 1 for default parameters and input data exp_params = Parameters.from_default_params(DefaultParameters(1), {'input_data': 1}) self.artifact = Artifact.create(filepaths_processed, "Demultiplexed", parents=[Artifact(1)], processing_parameters=exp_params)
def artifact_post_req(user, artifact_id): """Deletes the artifact Parameters ---------- user : qiita_db.user.User The user requesting the action artifact_id : int Id of the artifact being deleted """ artifact_id = int(artifact_id) artifact = Artifact(artifact_id) check_artifact_access(user, artifact) analysis = artifact.analysis if analysis: # Do something when deleting in the analysis part to keep track of it redis_key = "analysis_%s" % analysis.id else: pt_id = artifact.prep_templates[0].id redis_key = PREP_TEMPLATE_KEY_FORMAT % pt_id qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_artifact') params = Parameters.load(cmd, values_dict={'artifact': artifact_id}) job = ProcessingJob.create(user, params, True) r_client.set(redis_key, dumps({'job_id': job.id, 'is_qiita_job': True})) job.submit() return {'job': job.id}
def write_demux_files(self, prep_template, generate_hdf5=True): """Writes a demux test file to avoid duplication of code""" fna_fp = join(self.temp_dir, 'seqs.fna') demux_fp = join(self.temp_dir, 'demux.seqs') if generate_hdf5: with open(fna_fp, 'w') as f: f.write(FASTA_EXAMPLE) with File(demux_fp, "w") as f: to_hdf5(fna_fp, f) else: with open(demux_fp, 'w') as f: f.write('') if prep_template.artifact is None: ppd = Artifact.create( [(demux_fp, 6)], "Demultiplexed", prep_template=prep_template, can_be_submitted_to_ebi=True, can_be_submitted_to_vamps=True) else: params = Parameters.from_default_params( DefaultParameters(1), {'input_data': prep_template.artifact.id}) ppd = Artifact.create( [(demux_fp, 6)], "Demultiplexed", parents=[prep_template.artifact], processing_parameters=params, can_be_submitted_to_ebi=True, can_be_submitted_to_vamps=True) return ppd
def post(self, preprocessed_data_id): user = self.current_user # make sure user is admin and can therefore actually submit to VAMPS if user.level != 'admin': raise HTTPError(403, "User %s cannot submit to VAMPS!" % user.id) msg = '' msg_level = 'success' plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = plugin.get_command('submit_to_VAMPS') artifact = Artifact(preprocessed_data_id) # Check if the artifact is already being submitted to VAMPS is_being_submitted = any([ j.status in ('queued', 'running') for j in artifact.jobs(cmd=cmd) ]) if is_being_submitted == 'submitting': msg = "Cannot resubmit! Data is already being submitted" msg_level = 'danger' self.display_template(preprocessed_data_id, msg, msg_level) else: params = Parameters.load( cmd, values_dict={'artifact': preprocessed_data_id}) job = ProcessingJob.create(user, params) job.submit() self.redirect('/study/description/%s' % artifact.study.study_id)
def _create_job(self, cmd_name, values_dict): self.user = User('*****@*****.**') qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command(cmd_name) params = Parameters.load(cmd, values_dict=values_dict) job = ProcessingJob.create(self.user, params, True) job._set_status('queued') return job
def sample_template_handler_post_request(study_id, user, filepath, data_type=None): """Creates a new sample template Parameters ---------- study_id: int The study to add the sample information user: qiita_db.user import User The user performing the request filepath: str The path to the sample template file data_type: str, optional If filepath is a QIIME mapping file, the data type of the prep information file Returns ------- dict of {'job': str} job: the id of the job adding the sample information to the study Raises ------ HTTPError 404 if the filepath doesn't exist """ # Check if the current user has access to the study sample_template_checks(study_id, user) # Check if the file exists fp_rsp = check_fp(study_id, filepath) if fp_rsp['status'] != 'success': raise HTTPError(404, 'Filepath not found') filepath = fp_rsp['file'] is_mapping_file = looks_like_qiime_mapping_file(filepath) if is_mapping_file and not data_type: raise HTTPError( 400, 'Please, choose a data type if uploading a ' 'QIIME mapping file') qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('create_sample_template') params = Parameters.load(cmd, values_dict={ 'fp': filepath, 'study_id': study_id, 'is_mapping_file': is_mapping_file, 'data_type': data_type }) job = ProcessingJob.create(user, params, True) r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id}
def sample_template_put_req(study_id, user_id, sample_template): """Updates a sample template using the given file Parameters ---------- study_id : int The current study object id user_id : str The current user object id sample_template : str filename to use for updating Returns ------- dict results dictonary in the format {'status': status, 'message': msg, 'file': sample_template} status can be success, warning, or error depending on result message has the warnings or errors file has the file name """ exists = _check_sample_template_exists(int(study_id)) if exists['status'] != 'success': return exists access_error = check_access(int(study_id), user_id) if access_error: return access_error fp_rsp = check_fp(study_id, sample_template) if fp_rsp['status'] != 'success': # Unknown filepath, so return the error message return fp_rsp fp_rsp = fp_rsp['file'] msg = '' status = 'success' # Offload the update of the sample template to the cluster qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('update_sample_template') params = Parameters.load(cmd, values_dict={ 'study': int(study_id), 'template_fp': fp_rsp }) job = ProcessingJob.create(User(user_id), params) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'status': status, 'message': msg, 'file': sample_template}
def post(self, study_id): method = self.get_argument('remote-request-type') url = self.get_argument('inputURL') ssh_key = self.request.files['ssh-key'][0]['body'] status = 'success' message = '' try: study = Study(int(study_id)) except QiitaDBUnknownIDError: raise HTTPError(404, reason="Study %s does not exist" % study_id) check_access( self.current_user, study, no_public=True, raise_error=True) _, upload_folder = get_mountpoint("uploads")[0] upload_folder = join(upload_folder, study_id) ssh_key_fp = join(upload_folder, '.key.txt') create_nested_path(upload_folder) with open(ssh_key_fp, 'w') as f: f.write(ssh_key) qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') if method == 'list': cmd = qiita_plugin.get_command('list_remote_files') params = Parameters.load(cmd, values_dict={ 'url': url, 'private_key': ssh_key_fp, 'study_id': study_id}) elif method == 'transfer': cmd = qiita_plugin.get_command('download_remote_files') params = Parameters.load(cmd, values_dict={ 'url': url, 'private_key': ssh_key_fp, 'destination': upload_folder}) else: status = 'error' message = 'Not a valid method' if status == 'success': job = ProcessingJob.create(self.current_user, params, True) job.submit() r_client.set( UPLOAD_STUDY_FORMAT % study_id, dumps({'job_id': job.id})) self.write({'status': status, 'message': message})
def workflow_handler_post_req(user_id, command_id, params): """Creates a new workflow in the system Parameters ---------- user_id : str The user creating the workflow command_id : int The first command to execute in the workflow params : str JSON representations of the parameters for the first command of the workflow Returns ------- dict of objects A dictionary containing the commands information {'status': str, 'message': str, 'workflow_id': int} """ parameters = Parameters.load(Command(command_id), json_str=params) status = 'success' message = '' try: wf = ProcessingWorkflow.from_scratch(User(user_id), parameters) except Exception as exc: wf = None wf_id = None job_info = None status = 'error' message = str(exc) if wf is not None: # this is safe as we are creating the workflow for the first time # and there is only one node. Remember networkx doesn't assure order # of nodes job = list(wf.graph.nodes())[0] inputs = [a.id for a in job.input_artifacts] job_cmd = job.command wf_id = wf.id job_info = { 'id': job.id, 'inputs': inputs, 'label': job_cmd.name, 'outputs': job_cmd.outputs } return { 'status': status, 'message': message, 'workflow_id': wf_id, 'job': job_info }
def sample_template_handler_post_request(study_id, user, filepath, data_type=None, direct_upload=False): """Creates a new sample template Parameters ---------- study_id: int The study to add the sample information user: qiita_db.user import User The user performing the request filepath: str The path to the sample template file data_type: str, optional If filepath is a QIIME mapping file, the data type of the prep information file direct_upload: boolean, optional If filepath is a direct upload; if False we need to process the filepath as part of the study upload folder Returns ------- dict of {'job': str} job: the id of the job adding the sample information to the study Raises ------ HTTPError 404 if the filepath doesn't exist """ # Check if the current user has access to the study sample_template_checks(study_id, user) # Check if the file exists if not direct_upload: fp_rsp = check_fp(study_id, filepath) if fp_rsp['status'] != 'success': raise HTTPError(404, reason='Filepath not found') filepath = fp_rsp['file'] is_mapping_file = looks_like_qiime_mapping_file(filepath) if is_mapping_file and not data_type: raise HTTPError(400, reason='Please, choose a data type if uploading ' 'a QIIME mapping file') qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('create_sample_template') params = Parameters.load( cmd, values_dict={'fp': filepath, 'study_id': study_id, 'is_mapping_file': is_mapping_file, 'data_type': data_type}) job = ProcessingJob.create(user, params, True) r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id}
def test_workflow_handler_patch_req(self): # Create a new workflow so it is in construction exp_command = Command(1) json_str = ( '{"input_data": 1, "max_barcode_errors": 1.5, ' '"barcode_type": "golay_12", "max_bad_run_length": 3, ' '"rev_comp": false, "phred_quality_threshold": 3, ' '"rev_comp_barcode": false, "rev_comp_mapping_barcodes": false, ' '"min_per_read_length_fraction": 0.75, "sequence_max_n": 0}') exp_params = Parameters.load(exp_command, json_str=json_str) exp_user = User('*****@*****.**') name = "Test processing workflow" # tests success wf = ProcessingWorkflow.from_scratch(exp_user, exp_params, name=name, force=True) graph = wf.graph nodes = list(graph.nodes()) job_id = nodes[0].id value = { 'dflt_params': 10, 'connections': { job_id: { 'demultiplexed': 'input_data' } } } obs = workflow_handler_patch_req('add', '/%s/' % wf.id, req_value=dumps(value)) new_jobs = set(wf.graph.nodes()) - set(nodes) self.assertEqual(len(new_jobs), 1) new_job = new_jobs.pop() exp = { 'status': 'success', 'message': '', 'job': { 'id': new_job.id, 'inputs': [job_id], 'label': 'Pick closed-reference OTUs', 'outputs': [['OTU table', 'BIOM']] } } self.assertEqual(obs, exp) obs = workflow_handler_patch_req('remove', '/%s/%s/' % (wf.id, new_job.id)) exp = {'status': 'success', 'message': ''} jobs = set(wf.graph.nodes()) - set(nodes) self.assertEqual(jobs, set())
def test_artifact_summary_post_request(self): # No access with self.assertRaises(QiitaHTTPError): artifact_summary_post_request(User('*****@*****.**'), 1) # Returns already existing job job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 2})) job._set_status('queued') obs = artifact_summary_post_request(User('*****@*****.**'), 2) exp = {'job': [job.id, 'queued', None]} self.assertEqual(obs, exp)
def test_artifact_summary_post_request(self): # No access with self.assertRaises(QiitaHTTPError): artifact_summary_post_request(User('*****@*****.**'), 1) # Returns already existing job job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 2}) ) job._set_status('queued') obs = artifact_summary_post_request(User('*****@*****.**'), 2) exp = {'job': [job.id, 'queued', None]} self.assertEqual(obs, exp)
def post(self): study_id = int(self.get_argument('study_id')) preprocessed_data_id = int(self.get_argument('preprocessed_data_id')) param_id = self.get_argument('parameter-set-%s' % preprocessed_data_id) parameters = Parameters.from_default_params( DefaultParameters(param_id), {'input_data': preprocessed_data_id}) job_id = plugin_submit(self.current_user, parameters) self.render('compute_wait.html', job_id=job_id, title='Processing', completion_redirect='/study/description/%d?top_tab=' 'preprocessed_data_tab&sub_tab=%s' % (study_id, preprocessed_data_id))
def post(self): analysis_id = int(self.get_argument('analysis_id')) user = self.current_user check_analysis_access(user, Analysis(analysis_id)) qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_analysis') params = Parameters.load(cmd, values_dict={'analysis_id': analysis_id}) job = ProcessingJob.create(user, params, True) # Store the job id attaching it to the sample template id r_client.set('analysis_delete_%d' % analysis_id, dumps({'job_id': job.id})) job.submit() self.redirect("%s/analysis/list/" % (qiita_config.portal_dir))
def artifact_summary_post_request(user_id, artifact_id): """Launches the HTML summary generation and returns the job information Parameters ---------- user_id : str The user making the request artifact_id : int or str The artifact id Returns ------- dict of objects A dictionary containing the artifact summary information {'status': str, 'message': str, 'job': list of [str, str, str]} """ artifact_id = int(artifact_id) artifact = Artifact(artifact_id) access_error = check_access(artifact.study.id, user_id) if access_error: return access_error # Check if the summary is being generated or has been already generated command = Command.get_html_generator(artifact.artifact_type) jobs = artifact.jobs(cmd=command) jobs = [j for j in jobs if j.status in ['queued', 'running', 'success']] if jobs: # The HTML summary is either being generated or already generated. # Return the information of that job so we only generate the HTML # once job = jobs[0] else: # Create a new job to generate the HTML summary and return the newly # created job information job = ProcessingJob.create( User(user_id), Parameters.load(command, values_dict={'input_data': artifact_id})) job.submit() return { 'status': 'success', 'message': '', 'job': [job.id, job.status, job.step] }
def test_patch(self): # Create a new job - through a workflow since that is the only way # of creating jobs in the interface exp_command = Command(1) json_str = ( '{"input_data": 1, "max_barcode_errors": 1.5, ' '"barcode_type": "golay_12", "max_bad_run_length": 3, ' '"rev_comp": false, "phred_quality_threshold": 3, ' '"rev_comp_barcode": false, "rev_comp_mapping_barcodes": false, ' '"min_per_read_length_fraction": 0.75, "sequence_max_n": 0}') exp_params = Parameters.load(exp_command, json_str=json_str) exp_user = User('*****@*****.**') name = "Test processing workflow" # tests success wf = ProcessingWorkflow.from_scratch(exp_user, exp_params, name=name, force=True) graph = wf.graph nodes = graph.nodes() job_id = nodes[0].id response = self.patch('/study/process/job/', { 'op': 'remove', 'path': job_id }) self.assertEqual(response.code, 200) exp = { 'status': 'error', 'message': "Can't delete job %s. It is 'in_construction' " "status. Please use /study/process/workflow/" % job_id } self.assertEqual(loads(response.body), exp) # Test success ProcessingJob(job_id)._set_error('Killed for testing') response = self.patch('/study/process/job/', { 'op': 'remove', 'path': job_id }) self.assertEqual(response.code, 200) exp = {'status': 'success', 'message': ''} self.assertEqual(loads(response.body), exp)
def post(self): study_id = int(self.get_argument('study_id')) prep_template_id = int(self.get_argument('prep_template_id')) raw_data = PrepTemplate(prep_template_id).artifact param_id = int(self.get_argument('preprocessing_parameters_id')) parameters = Parameters.from_default_params( DefaultParameters(param_id), {'input_data': raw_data.id}) job_id = plugin_submit(self.current_user, parameters) self.render('compute_wait.html', job_id=job_id, title='Preprocessing', completion_redirect='/study/description/%d?top_tab=' 'prep_template_tab&sub_tab=%s' % (study_id, prep_template_id))
def post(self): study_id = int(self.get_argument("study_id")) prep_template_id = int(self.get_argument("prep_template_id")) raw_data = PrepTemplate(prep_template_id).artifact param_id = int(self.get_argument("preprocessing_parameters_id")) parameters = Parameters.from_default_params(DefaultParameters(param_id), {"input_data": raw_data.id}) job_id = plugin_submit(self.current_user, parameters) self.render( "compute_wait.html", job_id=job_id, title="Preprocessing", completion_redirect="/study/description/%d?top_tab=" "prep_template_tab&sub_tab=%s" % (study_id, prep_template_id), )
def artifact_summary_post_request(user_id, artifact_id): """Launches the HTML summary generation and returns the job information Parameters ---------- user_id : str The user making the request artifact_id : int or str The artifact id Returns ------- dict of objects A dictionary containing the artifact summary information {'status': str, 'message': str, 'job': list of [str, str, str]} """ artifact_id = int(artifact_id) artifact = Artifact(artifact_id) access_error = check_access(artifact.study.id, user_id) if access_error: return access_error # Check if the summary is being generated or has been already generated command = Command.get_html_generator(artifact.artifact_type) jobs = artifact.jobs(cmd=command) jobs = [j for j in jobs if j.status in ['queued', 'running', 'success']] if jobs: # The HTML summary is either being generated or already generated. # Return the information of that job so we only generate the HTML # once job = jobs[0] else: # Create a new job to generate the HTML summary and return the newly # created job information job = ProcessingJob.create( User(user_id), Parameters.load(command, values_dict={'input_data': artifact_id})) job.submit() return {'status': 'success', 'message': '', 'job': [job.id, job.status, job.step]}
def test_artifact_summary_post_request(self): # No access obs = artifact_summary_post_request('*****@*****.**', 1) exp = {'status': 'error', 'message': 'User does not have access to study'} self.assertEqual(obs, exp) # Returns already existing job job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 2}) ) job._set_status('queued') obs = artifact_summary_post_request('*****@*****.**', 2) exp = {'status': 'success', 'message': '', 'job': [job.id, 'queued', None]} self.assertEqual(obs, exp)
def test_submit_to_EBI(self): # setting up test fna_fp = join(self.temp_dir, 'seqs.fna') demux_fp = join(self.temp_dir, 'demux.seqs') with open(fna_fp, 'w') as f: f.write(FASTA_EXAMPLE) with File(demux_fp, "w") as f: to_hdf5(fna_fp, f) pt = PrepTemplate(1) params = Parameters.from_default_params(DefaultParameters(1), {'input_data': pt.artifact.id}) artifact = Artifact.create([(demux_fp, 6)], "Demultiplexed", parents=[pt.artifact], processing_parameters=params) # submit job job = self._create_job('submit_to_EBI', { 'artifact': artifact.id, 'submission_type': 'VALIDATE' }) job._set_status('in_construction') job.submit() # wait for the job to fail, and check that the status is submitting checked_submitting = True while job.status != 'error': if checked_submitting: self.assertEqual('submitting', artifact.study.ebi_submission_status) checked_submitting = False # once it fails wait for a few to check status again sleep(5) exp = 'Some artifact submissions failed: %d' % artifact.id obs = artifact.study.ebi_submission_status self.assertEqual(obs, exp) # make sure that the error is correct, we have 2 options if environ.get('ASPERA_SCP_PASS', '') != '': self.assertIn('1.SKM2.640199', job.log.msg) else: self.assertIn('ASCP Error:', job.log.msg) # wait for everything to finish to avoid DB deadlocks sleep(5)
def artifact_summary_post_request(user, artifact_id): """Launches the HTML summary generation and returns the job information Parameters ---------- user : qiita_db.user.User The user making the request artifact_id : int or str The artifact id Returns ------- dict of objects A dictionary containing the job summary information {'job': [str, str, str]} """ artifact_id = int(artifact_id) artifact = Artifact(artifact_id) check_artifact_access(user, artifact) # Check if the summary is being generated or has been already generated command = Command.get_html_generator(artifact.artifact_type) jobs = artifact.jobs(cmd=command) jobs = [j for j in jobs if j.status in ['queued', 'running', 'success']] if jobs: # The HTML summary is either being generated or already generated. # Return the information of that job so we only generate the HTML # once - Magic number 0 -> we are ensuring that there is only one # job generating the summary, so we can use the index 0 to access to # that job job = jobs[0] else: # Create a new job to generate the HTML summary and return the newly # created job information job = ProcessingJob.create( user, Parameters.load(command, values_dict={'input_data': artifact_id}), True) job.submit() return {'job': [job.id, job.status, job.step]}
def workflow_handler_post_req(user_id, dflt_params_id, req_params): """Creates a new workflow in the system Parameters ---------- user_id : str The user creating the workflow dflt_params_id : int The default parameters to use for the first command of the workflow req_params : str JSON representations of the required parameters for the first command of the workflow Returns ------- dict of objects A dictionary containing the commands information {'status': str, 'message': str, 'workflow_id': int} """ dflt_params = DefaultParameters(dflt_params_id) req_params = loads(req_params) parameters = Parameters.from_default_params(dflt_params, req_params) wf = ProcessingWorkflow.from_scratch(User(user_id), parameters) # this is safe as we are creating the workflow for the first time and there # is only one node. Remember networkx doesn't assure order of nodes job = wf.graph.nodes()[0] inputs = [a.id for a in job.input_artifacts] job_cmd = job.command return { 'status': 'success', 'message': '', 'workflow_id': wf.id, 'job': { 'id': job.id, 'inputs': inputs, 'label': job_cmd.name, 'outputs': job_cmd.outputs } }
def test_submit_to_EBI(self): # setting up test fna_fp = join(self.temp_dir, 'seqs.fna') demux_fp = join(self.temp_dir, 'demux.seqs') with open(fna_fp, 'w') as f: f.write(FASTA_EXAMPLE) with File(demux_fp, "w") as f: to_hdf5(fna_fp, f) pt = PrepTemplate(1) params = Parameters.from_default_params( DefaultParameters(1), {'input_data': pt.artifact.id}) artifact = Artifact.create( [(demux_fp, 6)], "Demultiplexed", parents=[pt.artifact], processing_parameters=params) # submit job job = self._create_job('submit_to_EBI', { 'artifact': artifact.id, 'submission_type': 'VALIDATE'}) job._set_status('in_construction') job.submit() # wait for the job to fail, and check that the status is submitting checked_submitting = True while job.status != 'error': if checked_submitting: self.assertEqual('submitting', artifact.study.ebi_submission_status) checked_submitting = False # once it fails wait for a few to check status again sleep(5) exp = 'Some artifact submissions failed: %d' % artifact.id obs = artifact.study.ebi_submission_status self.assertEqual(obs, exp) # make sure that the error is correct, we have 2 options if environ.get('ASPERA_SCP_PASS', '') != '': self.assertIn('1.SKM2.640199', job.log.msg) else: self.assertIn('ASCP Error:', job.log.msg) # wait for everything to finish to avoid DB deadlocks sleep(5)
def test_artifact_summary_post_request(self): # No access obs = artifact_summary_post_request('*****@*****.**', 1) exp = { 'status': 'error', 'message': 'User does not have access to study' } self.assertEqual(obs, exp) # Returns already existing job job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 2})) job._set_status('queued') obs = artifact_summary_post_request('*****@*****.**', 2) exp = { 'status': 'success', 'message': '', 'job': [job.id, 'queued', None] } self.assertEqual(obs, exp)
def artifact_summary_post_request(user, artifact_id): """Launches the HTML summary generation and returns the job information Parameters ---------- user : qiita_db.user.User The user making the request artifact_id : int or str The artifact id Returns ------- dict of objects A dictionary containing the job summary information {'job': [str, str, str]} """ artifact_id = int(artifact_id) artifact = Artifact(artifact_id) check_artifact_access(user, artifact) # Check if the summary is being generated or has been already generated command = Command.get_html_generator(artifact.artifact_type) jobs = artifact.jobs(cmd=command) jobs = [j for j in jobs if j.status in ['queued', 'running', 'success']] if jobs: # The HTML summary is either being generated or already generated. # Return the information of that job so we only generate the HTML # once - Magic number 0 -> we are ensuring that there is only one # job generating the summary, so we can use the index 0 to access to # that job job = jobs[0] else: # Create a new job to generate the HTML summary and return the newly # created job information job = ProcessingJob.create(user, Parameters.load( command, values_dict={'input_data': artifact_id}), True) job.submit() return {'job': [job.id, job.status, job.step]}
def test_workflow_handler_patch_req(self): # Create a new workflow so it is in construction exp_command = Command(1) json_str = ( '{"input_data": 1, "max_barcode_errors": 1.5, ' '"barcode_type": "golay_12", "max_bad_run_length": 3, ' '"rev_comp": false, "phred_quality_threshold": 3, ' '"rev_comp_barcode": false, "rev_comp_mapping_barcodes": false, ' '"min_per_read_length_fraction": 0.75, "sequence_max_n": 0}') exp_params = Parameters.load(exp_command, json_str=json_str) exp_user = User('*****@*****.**') name = "Test processing workflow" # tests success wf = ProcessingWorkflow.from_scratch( exp_user, exp_params, name=name, force=True) graph = wf.graph nodes = list(graph.nodes()) job_id = nodes[0].id value = {'dflt_params': 10, 'connections': {job_id: {'demultiplexed': 'input_data'}}} obs = workflow_handler_patch_req( 'add', '/%s/' % wf.id, req_value=dumps(value)) new_jobs = set(wf.graph.nodes()) - set(nodes) self.assertEqual(len(new_jobs), 1) new_job = new_jobs.pop() exp = {'status': 'success', 'message': '', 'job': {'id': new_job.id, 'inputs': [job_id], 'label': 'Pick closed-reference OTUs', 'outputs': [['OTU table', 'BIOM']]}} self.assertEqual(obs, exp) obs = workflow_handler_patch_req( 'remove', '/%s/%s/' % (wf.id, new_job.id)) exp = {'status': 'success', 'message': ''} jobs = set(wf.graph.nodes()) - set(nodes) self.assertEqual(jobs, set())
def sample_template_delete_req(study_id, user_id): """Deletes the sample template attached to the study Parameters ---------- study_id : int The current study object id user_id : str The current user object id Returns ------- dict results dictonary in the format {'status': status, 'message': msg} status can be success, warning, or error depending on result message has the warnings or errors """ exists = _check_sample_template_exists(int(study_id)) if exists['status'] != 'success': return exists access_error = check_access(int(study_id), user_id) if access_error: return access_error qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_sample_template') params = Parameters.load(cmd, values_dict={'study': int(study_id)}) job = ProcessingJob.create(User(user_id), params) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'status': 'success', 'message': ''}
def test_patch(self): # Create a new job - through a workflow since that is the only way # of creating jobs in the interface exp_command = Command(1) json_str = ( '{"input_data": 1, "max_barcode_errors": 1.5, ' '"barcode_type": "golay_12", "max_bad_run_length": 3, ' '"rev_comp": false, "phred_quality_threshold": 3, ' '"rev_comp_barcode": false, "rev_comp_mapping_barcodes": false, ' '"min_per_read_length_fraction": 0.75, "sequence_max_n": 0}') exp_params = Parameters.load(exp_command, json_str=json_str) exp_user = User('*****@*****.**') name = "Test processing workflow" # tests success wf = ProcessingWorkflow.from_scratch( exp_user, exp_params, name=name, force=True) graph = wf.graph nodes = graph.nodes() job_id = nodes[0].id response = self.patch('/study/process/job/', {'op': 'remove', 'path': job_id}) self.assertEqual(response.code, 200) exp = {'status': 'error', 'message': "Can't delete job %s. It is 'in_construction' " "status. Please use /study/process/workflow/" % job_id} self.assertEqual(loads(response.body), exp) # Test success ProcessingJob(job_id)._set_error('Killed for testing') response = self.patch('/study/process/job/', {'op': 'remove', 'path': job_id}) self.assertEqual(response.code, 200) exp = {'status': 'success', 'message': ''} self.assertEqual(loads(response.body), exp)
def workflow_handler_post_req(user_id, dflt_params_id, req_params): """Creates a new workflow in the system Parameters ---------- user_id : str The user creating the workflow dflt_params_id : int The default parameters to use for the first command of the workflow req_params : str JSON representations of the required parameters for the first command of the workflow Returns ------- dict of objects A dictionary containing the commands information {'status': str, 'message': str, 'workflow_id': int} """ dflt_params = DefaultParameters(dflt_params_id) req_params = loads(req_params) parameters = Parameters.from_default_params(dflt_params, req_params) wf = ProcessingWorkflow.from_scratch(User(user_id), parameters) # this is safe as we are creating the workflow for the first time and there # is only one node. Remember networkx doesn't assure order of nodes job = wf.graph.nodes()[0] inputs = [a.id for a in job.input_artifacts] job_cmd = job.command return {'status': 'success', 'message': '', 'workflow_id': wf.id, 'job': {'id': job.id, 'inputs': inputs, 'label': job_cmd.name, 'outputs': job_cmd.outputs}}
def sample_template_handler_delete_request(study_id, user): """Deletes the sample template Parameters ---------- study_id: int The study to delete the sample information user: qiita_db.user The user performing the request Returns ------- dict of {'job': str} job: the id of the job deleting the sample information to the study Raises ------ HTTPError 404 If the sample template doesn't exist """ # Check if the current user has access to the study and if the sample # template exists sample_template_checks(study_id, user, check_exists=True) qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_sample_template') params = Parameters.load(cmd, values_dict={'study': int(study_id)}) job = ProcessingJob.create(user, params, True) # Store the job if deleteing the sample template r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id}
def correct_redis_data(key, cmd, values_dict, user): """Corrects the data stored in the redis DB Parameters ---------- key: str The redis key to fix cmd : qiita_db.software.Command Command to use to create the processing job values_dict : dict Dictionary used to instantiate the parameters of the command user : qiita_db.user. User The user that will own the job """ info = r_client.get(key) if info: info = loads(info) if info['job_id'] is not None: if 'is_qiita_job' in info: if info['is_qiita_job']: try: job = ProcessingJob(info['job_id']) payload = {'job_id': info['job_id'], 'alert_type': info['status'], 'alert_msg': info['alert_msg']} r_client.set(key, dumps(payload)) except (QiitaDBUnknownIDError, KeyError): # We shomehow lost the information of this job # Simply delete the key r_client.delete(key) else: # These jobs don't contain any information on the live # dump. We can safely delete the key r_client.delete(key) else: # These jobs don't contain any information on the live # dump. We can safely delete the key r_client.delete(key) else: # Job is null, we have the information here if info['status'] == 'success': # In the success case no information is stored. We can # safely delete the key r_client.delete(key) elif info['status'] == 'warning': # In case of warning the key message stores the warning # message. We need to create a new job, mark it as # successful and store the error message as expected by # the new structure params = Parameters.load(cmd, values_dict=values_dict) job = ProcessingJob.create(user, params) job._set_status('success') payload = {'job_id': job.id, 'alert_type': 'warning', 'alert_msg': info['message']} r_client.set(key, dumps(payload)) else: # The status is error. The key message stores the error # message. We need to create a new job and mark it as # failed with the given error message params = Parameters.load(cmd, values_dict=values_dict) job = ProcessingJob.create(user, params) job._set_error(info['message']) payload = {'job_id': job.id} r_client.set(key, dumps(payload)) else: # The key doesn't contain any information. Delete the key r_client.delete(key)
def sample_template_handler_patch_request(user, req_op, req_path, req_value=None, req_from=None, direct_upload=False): """Patches the sample template Parameters ---------- user: qiita_db.user.User The user performing the request req_op : str The operation to perform on the sample template req_path : str The path to the attribute to patch req_value : str, optional The new value req_from : str, optional The original path of the element direct_upload : boolean, optional If the file being uploaded comes from a direct upload (True) Returns ------- Raises ------ HTTPError 400 If the path parameter doens't follow the expected format 400 If the given operation is not supported """ req_path = [v for v in req_path.split('/') if v] # At this point we know the path should be at least length 2 if len(req_path) < 2: raise HTTPError(400, reason='Incorrect path parameter') study_id = int(req_path[0]) # Check if the current user has access to the study and if the sample # template exists sample_template_checks(study_id, user, check_exists=True) if req_op == 'remove': # Path format # column: study_id/columns/column_name # sample: study_id/samples/sample_id if len(req_path) != 3: raise HTTPError(400, reason='Incorrect path parameter') attribute = req_path[1] attr_id = req_path[2] qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_sample_or_column') params = Parameters.load(cmd, values_dict={ 'obj_class': 'SampleTemplate', 'obj_id': study_id, 'sample_or_col': attribute, 'name': attr_id }) job = ProcessingJob.create(user, params, True) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id} elif req_op == 'replace': # WARNING: Although the patch operation is a replace, is not a full # true replace. A replace is in theory equivalent to a remove + add. # In this case, the replace operation doesn't necessarily removes # anything (e.g. when only new columns/samples are being added to the) # sample information. # Path format: study_id/data # Forcing to specify data for extensibility. In the future we may want # to use this function to replace other elements of the sample # information if len(req_path) != 2: raise HTTPError(400, reason='Incorrect path parameter') attribute = req_path[1] if attribute == 'data': # Update the sample information if req_value is None: raise HTTPError(400, reason="Value is required when updating " "sample information") if direct_upload: # We can assume that the file exist as it was generated by # the system filepath = req_value if not exists(filepath): reason = ('Upload file not found (%s), please report to ' '*****@*****.**' % filepath) raise HTTPError(404, reason=reason) else: # Check if the file exists fp_rsp = check_fp(study_id, req_value) if fp_rsp['status'] != 'success': raise HTTPError(404, reason='Filepath not found') filepath = fp_rsp['file'] qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('update_sample_template') params = Parameters.load(cmd, values_dict={ 'study': study_id, 'template_fp': filepath }) job = ProcessingJob.create(user, params, True) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id} else: raise HTTPError(404, reason='Attribute %s not found' % attribute) else: raise HTTPError(400, reason='Operation %s not supported. Current ' 'supported operations: remove, replace' % req_op)
def test_artifact_summary_get_request(self): user = User('*****@*****.**') # Artifact w/o summary obs = artifact_summary_get_request(user, 1) exp_p_jobs = [[ '063e553b-327c-4818-ab4a-adfe58e49860', 'Split libraries FASTQ', 'queued', None, None ], [ 'bcc7ebcd-39c1-43e4-af2d-822e3589f14d', 'Split libraries', 'running', 'demultiplexing', None ]] exp_files = [ (1L, '1_s_G1_L001_sequences.fastq.gz (raw forward seqs)'), (2L, '1_s_G1_L001_sequences_barcodes.fastq.gz (raw barcodes)') ] exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'processing_parameters': {}, 'files': exp_files, 'summary': None, 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [] } self.assertEqual(obs, exp) # Artifact with summary being generated job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 1})) job._set_status('queued') obs = artifact_summary_get_request(user, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'processing_parameters': {}, 'files': exp_files, 'summary': None, 'job': [job.id, 'queued', None], 'processing_jobs': exp_p_jobs, 'errored_jobs': [] } self.assertEqual(obs, exp) # Artifact with summary fd, fp = mkstemp(suffix=".html") close(fd) with open(fp, 'w') as f: f.write('<b>HTML TEST - not important</b>\n') a = Artifact(1) a.set_html_summary(fp) self._files_to_remove.extend([fp, a.html_summary_fp[1]]) exp_files.append( (a.html_summary_fp[0], '%s (html summary)' % basename(a.html_summary_fp[1]))) exp_summary_path = relpath(a.html_summary_fp[1], qiita_config.base_data_dir) obs = artifact_summary_get_request(user, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'processing_parameters': {}, 'files': exp_files, 'summary': exp_summary_path, 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [] } self.assertEqual(obs, exp) # No access demo_u = User('*****@*****.**') with self.assertRaises(QiitaHTTPError): obs = artifact_summary_get_request(demo_u, 1) # A non-owner/share user can't see the files a.visibility = 'public' obs = artifact_summary_get_request(demo_u, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'visibility': 'public', 'editable': False, 'buttons': '', 'processing_parameters': {}, 'files': [], 'summary': exp_summary_path, 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [] } self.assertEqual(obs, exp) # returnig to private a.visibility = 'private' # admin gets buttons obs = artifact_summary_get_request(User('*****@*****.**'), 2) exp_p_jobs = [[ 'd19f76ee-274e-4c1b-b3a2-a12d73507c55', 'Pick closed-reference OTUs', 'error', 'generating demux file', 'Error message' ]] exp_files = [(3L, '1_seqs.fna (preprocessed fasta)'), (4L, '1_seqs.qual (preprocessed fastq)'), (5L, '1_seqs.demux (preprocessed demux)')] exp = { 'name': 'Demultiplexed 1', 'artifact_id': 2, 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 2?\')) { ' 'set_artifact_visibility(\'public\', 2) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '2?\')) { set_artifact_visibility(\'sandbox\', 2) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button> <a class="btn btn-primary ' 'btn-sm" href="/ebi_submission/2"><span ' 'class="glyphicon glyphicon-export"></span> ' 'Submit to EBI</a> <a class="btn btn-primary ' 'btn-sm" href="/vamps/2"><span class="glyphicon ' 'glyphicon-export"></span> Submit to VAMPS</a>'), 'processing_parameters': { 'max_barcode_errors': 1.5, 'sequence_max_n': 0, 'max_bad_run_length': 3, 'phred_offset': u'auto', 'rev_comp': False, 'phred_quality_threshold': 3, 'input_data': 1, 'rev_comp_barcode': False, 'rev_comp_mapping_barcodes': False, 'min_per_read_length_fraction': 0.75, 'barcode_type': u'golay_12' }, 'files': exp_files, 'summary': None, 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [] } self.assertEqual(obs, exp) # analysis artifact obs = artifact_summary_get_request(user, 8) exp = { 'name': 'noname', 'artifact_id': 8, 'visibility': 'sandbox', 'editable': True, 'buttons': '', 'processing_parameters': {}, 'files': [(27, 'biom_table.biom (biom)')], 'summary': None, 'job': None, 'processing_jobs': [], 'errored_jobs': [] } self.assertEqual(obs, exp)
def test_artifact_summary_get_request(self): user = User('*****@*****.**') # Artifact w/o summary obs = artifact_summary_get_request(user, 1) exp_files = [ (1L, '1_s_G1_L001_sequences.fastq.gz (raw forward seqs)'), (2L, '1_s_G1_L001_sequences_barcodes.fastq.gz (raw barcodes)')] exp = {'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': None, 'job': None, 'errored_summary_jobs': []} self.assertEqual(obs, exp) # Artifact with summary being generated job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 1}) ) job._set_status('queued') obs = artifact_summary_get_request(user, 1) exp = {'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': None, 'job': [job.id, 'queued', None], 'errored_summary_jobs': []} self.assertEqual(obs, exp) # Artifact with summary fd, fp = mkstemp(suffix=".html") close(fd) with open(fp, 'w') as f: f.write('<b>HTML TEST - not important</b>\n') a = Artifact(1) a.set_html_summary(fp) self._files_to_remove.extend([fp, a.html_summary_fp[1]]) exp_files.append( (a.html_summary_fp[0], '%s (html summary)' % basename(a.html_summary_fp[1]))) exp_summary_path = relpath( a.html_summary_fp[1], qiita_config.base_data_dir) obs = artifact_summary_get_request(user, 1) exp = {'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': exp_summary_path, 'job': None, 'errored_summary_jobs': []} self.assertEqual(obs, exp) # No access demo_u = User('*****@*****.**') with self.assertRaises(QiitaHTTPError): obs = artifact_summary_get_request(demo_u, 1) # A non-owner/share user can't see the files a.visibility = 'public' obs = artifact_summary_get_request(demo_u, 1) exp = {'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'public', 'editable': False, 'buttons': '', 'processing_info': {}, 'files': [], 'is_from_analysis': False, 'summary': exp_summary_path, 'job': None, 'errored_summary_jobs': []} self.assertEqual(obs, exp) # returnig to private a.visibility = 'private' # admin gets buttons obs = artifact_summary_get_request(User('*****@*****.**'), 2) exp_files = [ (3L, '1_seqs.fna (preprocessed fasta)'), (4L, '1_seqs.qual (preprocessed fastq)'), (5L, '1_seqs.demux (preprocessed demux)')] exp = {'name': 'Demultiplexed 1', 'artifact_id': 2, 'artifact_type': 'Demultiplexed', 'artifact_timestamp': '2012-10-01 10:10', 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 2?\')) { ' 'set_artifact_visibility(\'public\', 2) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '2?\')) { set_artifact_visibility(\'sandbox\', 2) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button> <a class="btn btn-primary ' 'btn-sm" href="/ebi_submission/2"><span ' 'class="glyphicon glyphicon-export"></span> ' 'Submit to EBI</a> <a class="btn btn-primary ' 'btn-sm" href="/vamps/2"><span class="glyphicon ' 'glyphicon-export"></span> Submit to VAMPS</a>'), 'processing_info': { 'command': 'Split libraries FASTQ', 'software': 'QIIME', 'software_version': '1.9.1', 'processing_parameters': { 'max_barcode_errors': '1.5', 'sequence_max_n': '0', 'max_bad_run_length': '3', 'phred_offset': u'auto', 'rev_comp': 'False', 'phred_quality_threshold': '3', 'input_data': '1', 'rev_comp_barcode': 'False', 'rev_comp_mapping_barcodes': 'False', 'min_per_read_length_fraction': '0.75', 'barcode_type': u'golay_12'}}, 'files': exp_files, 'is_from_analysis': False, 'summary': None, 'job': None, 'errored_summary_jobs': []} self.assertEqual(obs, exp) # analysis artifact obs = artifact_summary_get_request(user, 8) exp = {'name': 'noname', 'artifact_id': 8, 'artifact_type': 'BIOM', # this value changes on build so copy from obs 'artifact_timestamp': obs['artifact_timestamp'], 'visibility': 'sandbox', 'editable': True, 'buttons': '', 'processing_info': {}, 'files': [(27, 'biom_table.biom (biom)')], 'is_from_analysis': True, 'summary': None, 'job': None, 'errored_summary_jobs': []} self.assertEqual(obs, exp)
def test_download_study(self): tmp_dir = mkdtemp() self._clean_up_files.append(tmp_dir) biom_fp = join(tmp_dir, 'otu_table.biom') smr_dir = join(tmp_dir, 'sortmerna_picked_otus') log_dir = join(smr_dir, 'seqs_otus.log') tgz = join(tmp_dir, 'sortmerna_picked_otus.tgz') with biom_open(biom_fp, 'w') as f: et.to_hdf5(f, "test") makedirs(smr_dir) with open(log_dir, 'w') as f: f.write('\n') with open(tgz, 'w') as f: f.write('\n') files_biom = [(biom_fp, 'biom'), (smr_dir, 'directory'), (tgz, 'tgz')] params = Parameters.from_default_params( Command(3).default_parameter_sets.next(), {'input_data': 1}) a = Artifact.create(files_biom, "BIOM", parents=[Artifact(2)], processing_parameters=params) for _, fp, _ in a.filepaths: self._clean_up_files.append(fp) response = self.get('/download_study_bioms/1') self.assertEqual(response.code, 200) exp = ( '- 1256812 /protected/processed_data/1_study_1001_closed_' 'reference_otu_table.biom processed_data/1_study_1001_closed_' 'reference_otu_table.biom\n' '- 36615 /protected/templates/1_prep_1_qiime_[0-9]*-' '[0-9]*.txt mapping_files/4_mapping_file.txt\n' '- 1256812 /protected/processed_data/' '1_study_1001_closed_reference_otu_table.biom processed_data/' '1_study_1001_closed_reference_otu_table.biom\n' '- 36615 /protected/templates/1_prep_1_qiime_[0-9]*-' '[0-9]*.txt mapping_files/5_mapping_file.txt\n' '- 1256812 /protected/processed_data/' '1_study_1001_closed_reference_otu_table_Silva.biom processed_data' '/1_study_1001_closed_reference_otu_table_Silva.biom\n' '- 36615 /protected/templates/1_prep_1_qiime_[0-9]*-' '[0-9]*.txt mapping_files/6_mapping_file.txt\n' '- 36615 /protected/templates/1_prep_2_qiime_[0-9]*-' '[0-9]*.txt mapping_files/7_mapping_file.txt\n' '- [0-9]* /protected/BIOM/{0}/otu_table.biom ' 'BIOM/{0}/otu_table.biom\n' '- 1 /protected/BIOM/{0}/sortmerna_picked_otus/seqs_otus.log ' 'BIOM/{0}/sortmerna_picked_otus/seqs_otus.log\n' '- 36615 /protected/templates/1_prep_1_qiime_[0-9]*-[0-9]*.' 'txt mapping_files/{0}_mapping_file.txt\n'.format(a.id)) self.assertRegexpMatches(response.body, exp) response = self.get('/download_study_bioms/200') self.assertEqual(response.code, 405) # changing user so we can test the failures BaseHandler.get_current_user = Mock( return_value=User("*****@*****.**")) response = self.get('/download_study_bioms/1') self.assertEqual(response.code, 405) a.visibility = 'public' response = self.get('/download_study_bioms/1') self.assertEqual(response.code, 200) exp = ( '- [0-9]* /protected/BIOM/{0}/otu_table.biom ' 'BIOM/{0}/otu_table.biom\n' '- 1 /protected/BIOM/{0}/sortmerna_picked_otus/seqs_otus.log ' 'BIOM/{0}/sortmerna_picked_otus/seqs_otus.log\n' '- 36615 /protected/templates/1_prep_1_qiime_[0-9]*-[0-9]*.' 'txt mapping_files/{0}_mapping_file.txt\n'.format(a.id)) self.assertRegexpMatches(response.body, exp)
def test_artifact_summary_get_request(self): # Artifact w/o summary obs = artifact_summary_get_request('*****@*****.**', 1) exp_p_jobs = [ ['063e553b-327c-4818-ab4a-adfe58e49860', 'Split libraries FASTQ', 'queued', None, None], ['bcc7ebcd-39c1-43e4-af2d-822e3589f14d', 'Split libraries', 'running', 'demultiplexing', None]] exp_files = [ (1L, '1_s_G1_L001_sequences.fastq.gz (raw forward seqs)'), (2L, '1_s_G1_L001_sequences_barcodes.fastq.gz (raw barcodes)')] exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'summary': None, 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'private', 'buttons': '<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public</button>' ' <button onclick="if (confirm(\'Are you sure you ' 'want to revert to sandbox artifact id: 1?\')) ' '{ set_artifact_visibility(\'sandbox\', 1) }" ' 'class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>', 'files': exp_files, 'editable': True} self.assertEqual(obs, exp) # Artifact with summary being generated job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 1}) ) job._set_status('queued') obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'summary': None, 'job': [job.id, 'queued', None], 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'private', 'buttons': '<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public</button>' ' <button onclick="if (confirm(\'Are you sure you ' 'want to revert to sandbox artifact id: 1?\')) { ' 'set_artifact_visibility(\'sandbox\', 1) }" ' 'class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>', 'files': exp_files, 'editable': True} self.assertEqual(obs, exp) # Artifact with summary fd, fp = mkstemp(suffix=".html") close(fd) with open(fp, 'w') as f: f.write('<b>HTML TEST - not important</b>\n') a = Artifact(1) a.html_summary_fp = fp self._files_to_remove.extend([fp, a.html_summary_fp[1]]) exp_files.append( (a.html_summary_fp[0], '%s (html summary)' % basename(a.html_summary_fp[1]))) obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'summary': '<b>HTML TEST - not important</b>\n', 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'private', 'buttons': '<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public</button>' ' <button onclick="if (confirm(\'Are you sure you ' 'want to revert to sandbox artifact id: 1?\')) { ' 'set_artifact_visibility(\'sandbox\', 1) }" ' 'class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>', 'files': exp_files, 'editable': True} self.assertEqual(obs, exp) # No access obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'error', 'message': 'User does not have access to study'} self.assertEqual(obs, exp) # A non-owner/share user can't see the files a.visibility = 'public' obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'summary': '<b>HTML TEST - not important</b>\n', 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'public', 'buttons': '', 'files': [], 'editable': False} self.assertEqual(obs, exp)
def test_complete_job(self): # Complete success pt = npt.assert_warns( QiitaDBWarning, PrepTemplate.create, pd.DataFrame({'new_col': {'1.SKD6.640190': 1}}), Study(1), '16S') c_job = ProcessingJob.create( User('*****@*****.**'), Parameters.load( Command.get_validator('BIOM'), values_dict={'template': pt.id, 'files': dumps({'BIOM': ['file']}), 'artifact_type': 'BIOM'}), True) c_job._set_status('running') fd, fp = mkstemp(suffix='_table.biom') close(fd) with open(fp, 'w') as f: f.write('\n') self._clean_up_files.append(fp) exp_artifact_count = get_count('qiita.artifact') + 1 payload = dumps( {'success': True, 'error': '', 'artifacts': {'OTU table': {'filepaths': [(fp, 'biom')], 'artifact_type': 'BIOM'}}}) job = self._create_job('complete_job', {'job_id': c_job.id, 'payload': payload}) private_task(job.id) self.assertEqual(job.status, 'success') self.assertEqual(c_job.status, 'success') self.assertEqual(get_count('qiita.artifact'), exp_artifact_count) # Complete job error payload = dumps({'success': False, 'error': 'Job failure'}) job = self._create_job( 'complete_job', {'job_id': 'bcc7ebcd-39c1-43e4-af2d-822e3589f14d', 'payload': payload}) private_task(job.id) self.assertEqual(job.status, 'success') c_job = ProcessingJob('bcc7ebcd-39c1-43e4-af2d-822e3589f14d') self.assertEqual(c_job.status, 'error') self.assertEqual(c_job.log, LogEntry.newest_records(numrecords=1)[0]) self.assertEqual(c_job.log.msg, 'Job failure') # Complete internal error pt = npt.assert_warns( QiitaDBWarning, PrepTemplate.create, pd.DataFrame({'new_col': {'1.SKD6.640190': 1}}), Study(1), '16S') c_job = ProcessingJob.create( User('*****@*****.**'), Parameters.load( Command.get_validator('BIOM'), values_dict={'template': pt.id, 'files': dumps({'BIOM': ['file']}), 'artifact_type': 'BIOM'}), True) c_job._set_status('running') fp = '/surprised/if/this/path/exists.biom' payload = dumps( {'success': True, 'error': '', 'artifacts': {'OTU table': {'filepaths': [(fp, 'biom')], 'artifact_type': 'BIOM'}}}) job = self._create_job('complete_job', {'job_id': c_job.id, 'payload': payload}) private_task(job.id) self.assertEqual(job.status, 'success') self.assertEqual(c_job.status, 'error') self.assertIn('No such file or directory', c_job.log.msg)
def sample_template_handler_patch_request(user, req_op, req_path, req_value=None, req_from=None): """Patches the sample template Parameters ---------- user: qiita_db.user.User The user performing the request req_op : str The operation to perform on the sample template req_path : str The path to the attribute to patch req_value : str, optional The new value req_from : str, optional The original path of the element Returns ------- Raises ------ HTTPError 400 If the path parameter doens't follow the expected format 400 If the given operation is not supported """ req_path = [v for v in req_path.split('/') if v] # At this point we know the path should be at least length 2 if len(req_path) < 2: raise HTTPError(400, reason='Incorrect path parameter') study_id = int(req_path[0]) # Check if the current user has access to the study and if the sample # template exists sample_template_checks(study_id, user, check_exists=True) if req_op == 'remove': # Path format # column: study_id/columns/column_name # sample: study_id/samples/sample_id if len(req_path) != 3: raise HTTPError(400, reason='Incorrect path parameter') attribute = req_path[1] attr_id = req_path[2] qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_sample_or_column') params = Parameters.load( cmd, values_dict={'obj_class': 'SampleTemplate', 'obj_id': study_id, 'sample_or_col': attribute, 'name': attr_id}) job = ProcessingJob.create(user, params, True) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id} elif req_op == 'replace': # WARNING: Although the patch operation is a replace, is not a full # true replace. A replace is in theory equivalent to a remove + add. # In this case, the replace operation doesn't necessarily removes # anything (e.g. when only new columns/samples are being added to the) # sample information. # Path format: study_id/data # Forcing to specify data for extensibility. In the future we may want # to use this function to replace other elements of the sample # information if len(req_path) != 2: raise HTTPError(400, reason='Incorrect path parameter') attribute = req_path[1] if attribute == 'data': # Update the sample information if req_value is None: raise HTTPError(400, reason="Value is required when updating " "sample information") # Check if the file exists fp_rsp = check_fp(study_id, req_value) if fp_rsp['status'] != 'success': raise HTTPError(404, reason='Filepath not found') filepath = fp_rsp['file'] qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('update_sample_template') params = Parameters.load( cmd, values_dict={'study': study_id, 'template_fp': filepath}) job = ProcessingJob.create(user, params, True) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % study_id, dumps({'job_id': job.id})) job.submit() return {'job': job.id} else: raise HTTPError(404, reason='Attribute %s not found' % attribute) else: raise HTTPError(400, reason='Operation %s not supported. Current ' 'supported operations: remove, replace' % req_op)
def test_job_ajax_patch_req(self): # Create a new job - through a workflow since that is the only way # of creating jobs in the interface exp_command = Command(1) json_str = ( '{"input_data": 1, "max_barcode_errors": 1.5, ' '"barcode_type": "golay_12", "max_bad_run_length": 3, ' '"rev_comp": false, "phred_quality_threshold": 3, ' '"rev_comp_barcode": false, "rev_comp_mapping_barcodes": false, ' '"min_per_read_length_fraction": 0.75, "sequence_max_n": 0}') exp_params = Parameters.load(exp_command, json_str=json_str) exp_user = User('*****@*****.**') name = "Test processing workflow" # tests success wf = ProcessingWorkflow.from_scratch( exp_user, exp_params, name=name, force=True) graph = wf.graph nodes = list(graph.nodes()) job_id = nodes[0].id # Incorrect path parameter obs = job_ajax_patch_req('remove', '/%s/somethingelse' % job_id) exp = {'status': 'error', 'message': 'Incorrect path parameter: missing job id'} self.assertEqual(obs, exp) obs = job_ajax_patch_req('remove', '/') exp = {'status': 'error', 'message': 'Incorrect path parameter: missing job id'} self.assertEqual(obs, exp) # Job id is not like a job id obs = job_ajax_patch_req('remove', '/notAJobId') exp = {'status': 'error', 'message': 'Incorrect path parameter: ' 'notAJobId is not a recognized job id'} self.assertEqual(obs, exp) # Job doesn't exist obs = job_ajax_patch_req('remove', '/6d368e16-2242-4cf8-87b4-a5dc40bc890b') exp = {'status': 'error', 'message': 'Incorrect path parameter: ' '6d368e16-2242-4cf8-87b4-a5dc40bc890b is not a ' 'recognized job id'} self.assertEqual(obs, exp) # in_construction job obs = job_ajax_patch_req('remove', '/%s' % job_id) exp = {'status': 'error', 'message': "Can't delete job %s. It is 'in_construction' " "status. Please use /study/process/workflow/" % job_id} self.assertEqual(obs, exp) # job status != 'error' job = ProcessingJob(job_id) job._set_status('queued') obs = job_ajax_patch_req('remove', '/%s' % job_id) exp = {'status': 'error', 'message': 'Only jobs in "error" status can be deleted.'} self.assertEqual(obs, exp) # Operation not supported job._set_status('queued') obs = job_ajax_patch_req('add', '/%s' % job_id) exp = {'status': 'error', 'message': 'Operation "add" not supported. Current supported ' 'operations: remove'} self.assertEqual(obs, exp) # Test success job._set_error('Killed for testing') obs = job_ajax_patch_req('remove', '/%s' % job_id) exp = {'status': 'success', 'message': ''} self.assertEqual(obs, exp)
def prep_template_patch_req(user_id, req_op, req_path, req_value=None, req_from=None): """Modifies an attribute of the prep template Parameters ---------- user_id : str The id of the user performing the patch operation req_op : str The operation to perform on the prep information req_path : str The prep information and attribute to patch req_value : str, optional The value that needs to be modified req_from : str, optional The original path of the element Returns ------- dict of {str, str, str} A dictionary with the following keys: - status: str, whether if the request is successful or not - message: str, if the request is unsuccessful, a human readable error - row_id: str, the row_id that we tried to delete """ req_path = [v for v in req_path.split('/') if v] if req_op == 'replace': # The structure of the path should be /prep_id/attribute_to_modify/ # so if we don't have those 2 elements, we should return an error if len(req_path) != 2: return {'status': 'error', 'message': 'Incorrect path parameter'} prep_id = int(req_path[0]) attribute = req_path[1] # Check if the user actually has access to the prep template prep = PrepTemplate(prep_id) access_error = check_access(prep.study_id, user_id) if access_error: return access_error status = 'success' msg = '' if attribute == 'investigation_type': prep.investigation_type = req_value elif attribute == 'data': fp = check_fp(prep.study_id, req_value) if fp['status'] != 'success': return fp fp = fp['file'] qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('update_prep_template') params = Parameters.load( cmd, values_dict={'prep_template': prep_id, 'template_fp': fp}) job = ProcessingJob.create(User(user_id), params, True) r_client.set(PREP_TEMPLATE_KEY_FORMAT % prep_id, dumps({'job_id': job.id})) job.submit() elif attribute == 'name': prep.name = req_value.strip() else: # We don't understand the attribute so return an error return {'status': 'error', 'message': 'Attribute "%s" not found. ' 'Please, check the path parameter' % attribute} return {'status': status, 'message': msg} elif req_op == 'remove': # The structure of the path should be: # /prep_id/row_id/{columns|samples}/name if len(req_path) != 4: return {'status': 'error', 'message': 'Incorrect path parameter'} prep_id = int(req_path[0]) row_id = req_path[1] attribute = req_path[2] attr_id = req_path[3] # Check if the user actually has access to the study pt = PrepTemplate(prep_id) access_error = check_access(pt.study_id, user_id) if access_error: return access_error qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_sample_or_column') params = Parameters.load( cmd, values_dict={'obj_class': 'PrepTemplate', 'obj_id': prep_id, 'sample_or_col': attribute, 'name': attr_id}) job = ProcessingJob.create(User(user_id), params, True) # Store the job id attaching it to the sample template id r_client.set(PREP_TEMPLATE_KEY_FORMAT % prep_id, dumps({'job_id': job.id})) job.submit() return {'status': 'success', 'message': '', 'row_id': row_id} else: return {'status': 'error', 'message': 'Operation "%s" not supported. ' 'Current supported operations: replace, remove' % req_op, 'row_id': '0'}
def test_artifact_summary_get_request(self): # Artifact w/o summary obs = artifact_summary_get_request('*****@*****.**', 1) exp_p_jobs = [ ['063e553b-327c-4818-ab4a-adfe58e49860', 'Split libraries FASTQ', 'queued', None, None], ['bcc7ebcd-39c1-43e4-af2d-822e3589f14d', 'Split libraries', 'running', 'demultiplexing', None]] exp_files = [ (1L, '1_s_G1_L001_sequences.fastq.gz (raw forward seqs)'), (2L, '1_s_G1_L001_sequences_barcodes.fastq.gz (raw barcodes)')] exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'processing_parameters': {}, 'summary': None, 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'private', 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'files': exp_files, 'editable': True, 'prep_id': 1, 'study_id': 1} self.assertEqual(obs, exp) # Artifact with summary being generated job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 1}) ) job._set_status('queued') obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'processing_parameters': {}, 'summary': None, 'job': [job.id, 'queued', None], 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'private', 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'files': exp_files, 'editable': True, 'prep_id': 1, 'study_id': 1} self.assertEqual(obs, exp) # Artifact with summary fd, fp = mkstemp(suffix=".html") close(fd) with open(fp, 'w') as f: f.write('<b>HTML TEST - not important</b>\n') a = Artifact(1) a.html_summary_fp = fp self._files_to_remove.extend([fp, a.html_summary_fp[1]]) exp_files.append( (a.html_summary_fp[0], '%s (html summary)' % basename(a.html_summary_fp[1]))) obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'processing_parameters': {}, 'summary': '<b>HTML TEST - not important</b>\n', 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'private', 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 1?\')) { ' 'set_artifact_visibility(\'public\', 1) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '1?\')) { set_artifact_visibility(\'sandbox\', 1) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button>'), 'files': exp_files, 'editable': True, 'prep_id': 1, 'study_id': 1} self.assertEqual(obs, exp) # No access obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'error', 'message': 'User does not have access to study'} self.assertEqual(obs, exp) # A non-owner/share user can't see the files a.visibility = 'public' obs = artifact_summary_get_request('*****@*****.**', 1) exp = {'status': 'success', 'message': '', 'name': 'Raw data 1', 'processing_parameters': {}, 'summary': '<b>HTML TEST - not important</b>\n', 'job': None, 'processing_jobs': exp_p_jobs, 'errored_jobs': [], 'visibility': 'public', 'buttons': '', 'files': [], 'editable': False, 'prep_id': 1, 'study_id': 1} self.assertEqual(obs, exp) # returnig to private a.visibility = 'sandbox' # admin gets buttons obs = artifact_summary_get_request('*****@*****.**', 2) exp_p_jobs = [ ['d19f76ee-274e-4c1b-b3a2-a12d73507c55', 'Pick closed-reference OTUs', 'error', 'generating demux file', 'Error message']] exp_files = [ (3L, '1_seqs.fna (preprocessed fasta)'), (4L, '1_seqs.qual (preprocessed fastq)'), (5L, '1_seqs.demux (preprocessed demux)')] exp = {'status': 'success', 'files': exp_files, 'errored_jobs': [], 'editable': True, 'visibility': 'private', 'job': None, 'message': '', 'name': 'Demultiplexed 1', 'processing_jobs': exp_p_jobs, 'processing_parameters': { 'max_barcode_errors': 1.5, 'sequence_max_n': 0, 'max_bad_run_length': 3, 'phred_offset': u'auto', 'rev_comp': False, 'phred_quality_threshold': 3, 'input_data': 1, 'rev_comp_barcode': False, 'rev_comp_mapping_barcodes': False, 'min_per_read_length_fraction': 0.75, 'barcode_type': u'golay_12'}, 'summary': None, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 2?\')) { ' 'set_artifact_visibility(\'public\', 2) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '2?\')) { set_artifact_visibility(\'sandbox\', 2) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button> <a class="btn btn-primary ' 'btn-sm" href="/vamps/2"><span class="glyphicon ' 'glyphicon-export"></span> Submit to VAMPS</a>'), 'study_id': 1, 'prep_id': 1} self.assertEqual(obs, exp)
def sample_template_patch_request(user_id, req_op, req_path, req_value=None, req_from=None): """Modifies an attribute of the artifact Parameters ---------- user_id : str The id of the user performing the patch operation req_op : str The operation to perform on the artifact req_path : str The prep information and attribute to patch req_value : str, optional The value that needs to be modified req_from : str, optional The original path of the element Returns ------- dict of {str, str} A dictionary with the following keys: - status: str, whether if the request is successful or not - message: str, if the request is unsuccessful, a human readable error """ if req_op == 'remove': req_path = [v for v in req_path.split('/') if v] # format # column: study_id/row_id/columns/column_name # sample: study_id/row_id/samples/sample_id if len(req_path) != 4: return {'status': 'error', 'message': 'Incorrect path parameter'} st_id = req_path[0] row_id = req_path[1] attribute = req_path[2] attr_id = req_path[3] # Check if the user actually has access to the template st = SampleTemplate(st_id) access_error = check_access(st.study_id, user_id) if access_error: return access_error qiita_plugin = Software.from_name_and_version('Qiita', 'alpha') cmd = qiita_plugin.get_command('delete_sample_or_column') params = Parameters.load(cmd, values_dict={ 'obj_class': 'SampleTemplate', 'obj_id': int(st_id), 'sample_or_col': attribute, 'name': attr_id }) job = ProcessingJob.create(User(user_id), params) # Store the job id attaching it to the sample template id r_client.set(SAMPLE_TEMPLATE_KEY_FORMAT % st_id, dumps({'job_id': job.id})) job.submit() return {'status': 'success', 'message': '', 'row_id': row_id} else: return { 'status': 'error', 'message': 'Operation "%s" not supported. ' 'Current supported operations: remove' % req_op, 'row_id': 0 }
def test_artifact_summary_get_request(self): user = User('*****@*****.**') main_buttons = ( '<button onclick="if (confirm(' "\'Are you sure you want to make " "public artifact id: 1?')) { set_artifact_visibility('public', 1) " '}" class="btn btn-primary btn-sm">Make public</button> <button ' 'onclick="if (confirm(' "'Are you sure you want to revert to " "sandbox artifact id: 1?')) { set_artifact_visibility('sandbox', 1" ') }" class="btn btn-primary btn-sm">Revert to sandbox</button> ') private_download_button = ( '<button class="btn btn-primary btn-sm" type="button" ' 'aria-expanded="false" aria-controls="privateDownloadLink" ' 'onclick="generate_private_download_link(%s)">Generate Download ' 'Link</button><div class="collapse" id="privateDownloadLink"><div ' 'class="card card-body" id="privateDownloadText">Generating ' 'Download Link...</div></div>') # Artifact w/o summary obs = artifact_summary_get_request(user, 1) exp_files = [ (1, '1_s_G1_L001_sequences.fastq.gz (raw forward seqs)', '2125826711', '58 Bytes'), (2, '1_s_G1_L001_sequences_barcodes.fastq.gz (raw barcodes)', '2125826711', '58 Bytes') ] exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'private', 'editable': True, 'buttons': main_buttons + private_download_button % 1, 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': None, 'job': None, 'errored_summary_jobs': [] } self.assertEqual(obs, exp) # Artifact with summary being generated job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command(7), values_dict={'input_data': 1})) job._set_status('queued') obs = artifact_summary_get_request(user, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'private', 'editable': True, 'buttons': main_buttons + private_download_button % 1, 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': None, 'job': [job.id, 'queued', None], 'errored_summary_jobs': [] } self.assertEqual(obs, exp) # Artifact with summary fd, fp = mkstemp(suffix=".html") close(fd) with open(fp, 'w') as f: f.write('<b>HTML TEST - not important</b>\n') a = Artifact(1) a.set_html_summary(fp) self._files_to_remove.extend([fp, a.html_summary_fp[1]]) exp_files.append((a.html_summary_fp[0], '%s (html summary)' % basename(a.html_summary_fp[1]), '1642196267', '33 Bytes')) exp_summary_path = relpath(a.html_summary_fp[1], qiita_config.base_data_dir) obs = artifact_summary_get_request(user, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'private', 'editable': True, 'buttons': main_buttons + private_download_button % 1, 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': exp_summary_path, 'job': None, 'errored_summary_jobs': [] } self.assertEqual(obs, exp) # No access demo_u = User('*****@*****.**') with self.assertRaises(QiitaHTTPError): obs = artifact_summary_get_request(demo_u, 1) # A non-owner/share user can't see the files a.visibility = 'public' obs = artifact_summary_get_request(demo_u, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'public', 'editable': False, 'buttons': '', 'processing_info': {}, 'files': [], 'is_from_analysis': False, 'summary': exp_summary_path, 'job': None, 'errored_summary_jobs': [] } self.assertEqual(obs, exp) # testing sandbox a.visibility = 'sandbox' obs = artifact_summary_get_request(user, 1) exp = { 'name': 'Raw data 1', 'artifact_id': 1, 'artifact_type': 'FASTQ', 'artifact_timestamp': '2012-10-01 09:10', 'visibility': 'sandbox', 'editable': True, 'buttons': private_download_button % 1, 'processing_info': {}, 'files': exp_files, 'is_from_analysis': False, 'summary': exp_summary_path, 'job': None, 'errored_summary_jobs': [] } self.assertEqual(obs, exp) # returnig to private a.visibility = 'private' # admin gets buttons obs = artifact_summary_get_request(User('*****@*****.**'), 2) exp_files = [(3, '1_seqs.fna (preprocessed fasta)', '', '0 Bytes'), (4, '1_seqs.qual (preprocessed fastq)', '', '0 Bytes'), (5, '1_seqs.demux (preprocessed demux)', '', '0 Bytes')] exp = { 'name': 'Demultiplexed 1', 'artifact_id': 2, 'artifact_type': 'Demultiplexed', 'artifact_timestamp': '2012-10-01 10:10', 'visibility': 'private', 'editable': True, 'buttons': ('<button onclick="if (confirm(\'Are you sure you ' 'want to make public artifact id: 2?\')) { ' 'set_artifact_visibility(\'public\', 2) }" ' 'class="btn btn-primary btn-sm">Make public' '</button> <button onclick="if (confirm(\'Are you ' 'sure you want to revert to sandbox artifact id: ' '2?\')) { set_artifact_visibility(\'sandbox\', 2) ' '}" class="btn btn-primary btn-sm">Revert to ' 'sandbox</button> <a class="btn btn-primary ' 'btn-sm" href="/ebi_submission/2"><span ' 'class="glyphicon glyphicon-export"></span> ' 'Submit to EBI</a> <a class="btn btn-primary ' 'btn-sm" href="/vamps/2"><span class="glyphicon ' 'glyphicon-export"></span> Submit to VAMPS</a> ' + private_download_button % 2), 'processing_info': { 'command_active': True, 'software_deprecated': False, 'command': 'Split libraries FASTQ', 'processing_parameters': { 'max_barcode_errors': '1.5', 'sequence_max_n': '0', 'max_bad_run_length': '3', 'phred_offset': 'auto', 'rev_comp': 'False', 'phred_quality_threshold': '3', 'input_data': '1', 'rev_comp_barcode': 'False', 'rev_comp_mapping_barcodes': 'False', 'min_per_read_length_fraction': '0.75', 'barcode_type': 'golay_12' }, 'software_version': '1.9.1', 'software': 'QIIME' }, 'files': exp_files, 'is_from_analysis': False, 'summary': None, 'job': None, 'errored_summary_jobs': [] } self.assertEqual(obs, exp) # analysis artifact obs = artifact_summary_get_request(user, 8) exp = { 'name': 'noname', 'artifact_id': 8, 'artifact_type': 'BIOM', # this value changes on build so copy from obs 'artifact_timestamp': obs['artifact_timestamp'], 'visibility': 'sandbox', 'editable': True, 'buttons': private_download_button % 8, 'processing_info': {}, 'files': [(22, 'biom_table.biom (biom)', '1756512010', '1.1 MB')], 'is_from_analysis': True, 'summary': None, 'job': None, 'errored_summary_jobs': [] } self.assertEqual(obs, exp)
def test_complete_job(self): # Complete success pt = npt.assert_warns(QiitaDBWarning, PrepTemplate.create, pd.DataFrame({'new_col': { '1.SKD6.640190': 1 }}), Study(1), '16S') c_job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command.get_validator('BIOM'), values_dict={ 'template': pt.id, 'files': dumps({'BIOM': ['file']}), 'artifact_type': 'BIOM' }), True) c_job._set_status('running') fd, fp = mkstemp(suffix='_table.biom') close(fd) with open(fp, 'w') as f: f.write('\n') self._clean_up_files.append(fp) exp_artifact_count = get_count('qiita.artifact') + 1 payload = dumps({ 'success': True, 'error': '', 'artifacts': { 'OTU table': { 'filepaths': [(fp, 'biom')], 'artifact_type': 'BIOM' } } }) job = self._create_job('complete_job', { 'job_id': c_job.id, 'payload': payload }) private_task(job.id) self.assertEqual(job.status, 'success') self.assertEqual(c_job.status, 'success') self.assertEqual(get_count('qiita.artifact'), exp_artifact_count) # Complete job error payload = dumps({'success': False, 'error': 'Job failure'}) job = self._create_job('complete_job', { 'job_id': 'bcc7ebcd-39c1-43e4-af2d-822e3589f14d', 'payload': payload }) private_task(job.id) self.assertEqual(job.status, 'success') c_job = ProcessingJob('bcc7ebcd-39c1-43e4-af2d-822e3589f14d') self.assertEqual(c_job.status, 'error') self.assertEqual(c_job.log, LogEntry.newest_records(numrecords=1)[0]) self.assertEqual(c_job.log.msg, 'Job failure') # Complete internal error pt = npt.assert_warns(QiitaDBWarning, PrepTemplate.create, pd.DataFrame({'new_col': { '1.SKD6.640190': 1 }}), Study(1), '16S') c_job = ProcessingJob.create( User('*****@*****.**'), Parameters.load(Command.get_validator('BIOM'), values_dict={ 'template': pt.id, 'files': dumps({'BIOM': ['file']}), 'artifact_type': 'BIOM' }), True) c_job._set_status('running') fp = '/surprised/if/this/path/exists.biom' payload = dumps({ 'success': True, 'error': '', 'artifacts': { 'OTU table': { 'filepaths': [(fp, 'biom')], 'artifact_type': 'BIOM' } } }) job = self._create_job('complete_job', { 'job_id': c_job.id, 'payload': payload }) private_task(job.id) self.assertEqual(job.status, 'success') self.assertEqual(c_job.status, 'error') self.assertIn('No such file or directory', c_job.log.msg)
def test_download_study(self): tmp_dir = mkdtemp() self._clean_up_files.append(tmp_dir) biom_fp = join(tmp_dir, 'otu_table.biom') smr_dir = join(tmp_dir, 'sortmerna_picked_otus') log_dir = join(smr_dir, 'seqs_otus.log') tgz = join(tmp_dir, 'sortmerna_picked_otus.tgz') with biom_open(biom_fp, 'w') as f: et.to_hdf5(f, "test") makedirs(smr_dir) with open(log_dir, 'w') as f: f.write('\n') with open(tgz, 'w') as f: f.write('\n') files_biom = [(biom_fp, 'biom'), (smr_dir, 'directory'), (tgz, 'tgz')] params = Parameters.from_default_params( next(Command(3).default_parameter_sets), {'input_data': 1}) a = Artifact.create(files_biom, "BIOM", parents=[Artifact(2)], processing_parameters=params) for x in a.filepaths: self._clean_up_files.append(x['fp']) response = self.get('/download_study_bioms/1') self.assertEqual(response.code, 200) exp = ('- 1256812 /protected/processed_data/' '1_study_1001_closed_reference_otu_table.biom processed_data/' '1_study_1001_closed_reference_otu_table.biom\n' '- [0-9]* /protected/templates/1_prep_1_[0-9]*-[0-9]*.txt ' 'mapping_files/4_mapping_file.txt\n' '- 1256812 /protected/processed_data/' '1_study_1001_closed_reference_otu_table.biom processed_data/' '1_study_1001_closed_reference_otu_table.biom\n' '- [0-9]* /protected/templates/1_prep_1_[0-9]*-[0-9]*.txt ' 'mapping_files/5_mapping_file.txt\n' '- 1256812 /protected/processed_data/1_study_1001_' 'closed_reference_otu_table_Silva.biom processed_data/' '1_study_1001_closed_reference_otu_table_Silva.biom\n' '- [0-9]* /protected/templates/1_prep_1_[0-9]*-[0-9]*.txt ' 'mapping_files/6_mapping_file.txt\n' '- 1093210 /protected/BIOM/7/biom_table.biom ' 'BIOM/7/biom_table.biom\n' '- [0-9]* /protected/templates/1_prep_2_[0-9]*-[0-9]*.txt ' 'mapping_files/7_mapping_file.txt\n' '- [0-9]* /protected/BIOM/{0}/otu_table.biom ' 'BIOM/{0}/otu_table.biom\n' '- 1 /protected/BIOM/10/sortmerna_picked_otus/seqs_otus.log ' 'BIOM/{0}/sortmerna_picked_otus/seqs_otus.log\n' '- [0-9]* /protected/templates/1_prep_1_[0-9]*-[0-9]*.txt ' 'mapping_files/{0}_mapping_file.txt\n'.format(a.id)) self.assertRegex(response.body.decode('ascii'), exp) response = self.get('/download_study_bioms/200') self.assertEqual(response.code, 405) # changing user so we can test the failures BaseHandler.get_current_user = Mock( return_value=User("*****@*****.**")) response = self.get('/download_study_bioms/1') self.assertEqual(response.code, 405) a.visibility = 'public' response = self.get('/download_study_bioms/1') # returning visibility a.visibility = 'private' self.assertEqual(response.code, 200) # we should have the same files than the previous test, except artifact # and mapping file 7: position 6 and 7; thus removing 6 twice exp = exp.split('\n') exp.pop(6) exp.pop(6) exp = '\n'.join(exp) self.assertRegex(response.body.decode('ascii'), exp)