class SegCheck(unittest.TestCase): mMasker = Masker.MaskerSeg() def testEmpty(self): """test empty input.""" self.assertEqual(self.mMasker(""), "") def testProtein(self): """test protein input.""" self.assertEqual( self.mMasker("ACDEFGHIKLWWWWWWWWWWWWWWwwwwwwwwwwwacdefghikl"), "ACDEFGHIKLXXXXXXXXXXXXXXxxxxxxxxxxxacdefghikl") def testCoding(self): """test coding sequence input.""" self.assertEqual( self.mMasker("GCCTGCGACGAGTTCGGCCACATCAAGCT" "GTGGTGGTGGTGGTGGTGGTGGTGGTGGT" "GGTGGTGGTGGTGGTGGTGGTGGTGGTGG" "tggtggtggtggtggtgggcctgcgacga" "gttcggccacatcaagctg"), "GCCTGCGACGAGTTCGGCCACATCAAGCT" "GNNNNNNNNNNNNNNNNNNNNNNNNNNNN" "NNNNNNNNNNNNNNNNNNNNNNNNNNNNN" "nnnnnnnnnnnnnnnnnngcctgcgacga" "gttcggccacatcaagctg")
def maskMali(mali, method="seg"): """mask multiple alignment according to an external masker. """ if method == "seg": masker = Masker.MaskerSeg() elif method == "bias": masker = Masker.MaskerBias() elif method == "random": masker = Masker.MaskerRandom() if mali.getAlphabet() == "na" and method in ("seg", "bias"): for id, s in mali.items(): ss = Genomics.TranslateDNA2Protein(s.mString) mss = masker(ss) columns = [] for x in range(0, len(mss)): if mss[x] in ("X", "x"): columns += range(x, x + 3) mali.getEntry(id).maskColumns(columns) else: for id, s in mali.items(): mali[id].mString = masker(s.mString)
def main(argv=None): if argv is None: argv = sys.argv parser = E.OptionParser(version="%prog version", usage=globals()["__doc__"]) parser.add_option( "-m", "--method", dest="methods", type="choice", action="append", choices=("translate", "translate-to-stop", "truncate-at-stop", "back-translate", "mark-codons", "apply-map", "build-map", "pseudo-codons", "filter", "interleaved-codons", "map-codons", "remove-gaps", "mask-seg", "mask-bias", "mask-codons", "mask-incomplete-codons", "mask-stops", "mask-soft", "remove-stops", "upper", "lower", "reverse-complement", "sample", "shuffle"), help="method to apply to sequences.") parser.add_option("-p", "--parameters", dest="parameters", type="string", help="parameter stack for methods that require one " "[default=%default].") parser.add_option("-x", "--ignore-errors", dest="ignore_errors", action="store_true", help="ignore errors [default = %default].") parser.add_option("--sample-proportion", dest="sample_proportion", type="float", help="sample proportion [default = %default].") parser.add_option("--exclude-pattern", dest="exclude_pattern", type="string", help="exclude all sequences with ids matching pattern " "[default = %default].") parser.add_option("--include-pattern", dest="include_pattern", type="string", help="include only sequences with ids matching pattern " "[default = %default].") parser.add_option("--filter-method", dest="filter_methods", type="string", action="append", help="filtering methods to apply " "[default = %default].") parser.add_option( "-t", "--sequence-type", dest="type", type="choice", choices=("aa", "na"), help="sequence type (aa or na) [%default]. This option determines " "which characters to use for masking [default = %default].") parser.add_option( "-l", "--template-identifier", dest="template_identifier", type="string", help="template for numerical identifier [default = %default] " "for the operation --build-map. A %i is replaced by the position " "of the sequence in the file.") parser.set_defaults( methods=[], parameters="", type="na", aa_mask_chars="xX", aa_mask_char="x", na_mask_chars="nN", na_mask_char="n", gap_chars="-.", gap_char="-", template_identifier="ID%06i", ignore_errors=False, exclude_pattern=None, include_pattern=None, sample_proportion=None, filter_methods=[], ) (options, args) = E.Start(parser) options.parameters = options.parameters.split(",") rx_include, rx_exclude = None, None if options.include_pattern: rx_include = re.compile(options.include_pattern) if options.exclude_pattern: rx_exclude = re.compile(options.exclude_pattern) iterator = FastaIterator.FastaIterator(options.stdin) nseq = 0 map_seq2nid = {} if "apply-map" in options.methods: map_seq2nid = IOTools.ReadMap(open(options.parameters[0], "r")) del options.parameters[0] if options.type == "na": mask_chars = options.na_mask_chars mask_char = options.na_mask_char else: mask_chars = options.aa_mask_chars mask_char = options.aa_mask_char if "map-codons" in options.methods: map_codon2code = IOTools.ReadMap(open(options.parameters[0], "r")) del options.parameters[0] if "mask-soft" in options.methods: f = options.parameters[0] del options.parameters[0] hard_masked_iterator = FastaIterator.FastaIterator(open(f, "r")) if "mask-codons" in options.methods or "back-translate" in options.methods: # open a second stream to read sequences from f = options.parameters[0] del options.parameters[0] other_iterator = FastaIterator.FastaIterator(open(f, "r")) ninput, noutput, nerrors, nskipped = 0, 0, 0, 0 if "sample" in options.methods: if not options.sample_proportion: raise ValueError("specify a sample proportion") sample_proportion = options.sample_proportion else: sample_proportion = None filter_min_sequence_length = None filter_max_sequence_length = None filter_id_list = None for f in options.filter_methods: if f.startswith("min-length"): filter_min_sequence_length = int(f.split("=")[1]) elif f.startswith("max-length"): filter_max_sequence_length = int(f.split("=")[1]) elif f.startswith("id-file"): filter_id_list = [ line[:-1] for line in IOTools.openFile(f.split("=")[1]) ] def raiseIfNotCodon(l, title): '''raise ValueError if sequence length l is not divisible by 3''' if l % 3 != 0: raise ValueError("length of sequence %s not divisible by 3" % (title)) while 1: try: cur_record = next(iterator) except StopIteration: break if cur_record is None: break nseq += 1 ninput += 1 sequence = re.sub(" ", "", cur_record.sequence) l = len(sequence) if rx_include and not rx_include.search(cur_record.title): nskipped += 1 continue if rx_exclude and rx_exclude.search(cur_record.title): nskipped += 1 continue if sample_proportion: if random.random() > sample_proportion: continue if not (filter_id_list is None or cur_record.title in filter_id_list): nskipped += 1 continue for method in options.methods: if method == "translate": # translate such that gaps are preserved seq = [] ls = len(re.sub('[%s]' % options.gap_chars, sequence, "")) if ls % 3 != 0: msg = "length of sequence %s (%i) not divisible by 3" % ( cur_record.title, ls) nerrors += 1 if options.ignore_errors: E.warn(msg) continue else: raise ValueError(msg) for codon in [sequence[x:x + 3] for x in range(0, l, 3)]: aa = Genomics.MapCodon2AA(codon) seq.append(aa) sequence = "".join(seq) elif method == "back-translate": # translate from an amino acid alignment to codon alignment seq = [] try: other_record = next(other_iterator) except StopIteration: raise ValueError("run out of sequences") if cur_record.title != other_record.title: raise "sequence titles don't match: %s %s" % ( cur_record.title, other_record.title) other_sequence = re.sub("[ %s]" % options.gap_chars, "", other_record.sequence) if len(other_sequence) % 3 != 0: raise ValueError( "length of sequence %s not divisible by 3" % (other_record.title)) r = re.sub("[%s]" % options.gap_chars, "", sequence) if len(other_sequence) != len(r) * 3: raise ValueError( "length of sequences do not match: %i vs %i" % (len(other_sequence), len(r))) x = 0 for aa in sequence: if aa in options.gap_chars: c = options.gap_char * 3 else: c = other_sequence[x:x + 3] x += 3 seq.append(c) sequence = "".join(seq) elif method == "pseudo-codons": raiseIfNotCodon(l, cur_record.title) seq = [] for codon in [sequence[x:x + 3] for x in range(0, l, 3)]: aa = Genomics.MapCodon2AA(codon) seq.append(aa) sequence = " ".join(seq) elif method == "reverse-complement": sequence = string.translate( sequence, string.maketrans("ACGTacgt", "TGCAtgca"))[::-1] elif method in ("mask-stops", "remove-stops"): c = [] codon = [] new_sequence = [] if method == "mask-stops": char = options.na_mask_char elif method == "remove-stops": char = options.gap_char for x in sequence: if x not in options.gap_chars: codon.append(x.upper()) c.append(x) if len(codon) == 3: codon = "".join(codon).upper() # mask all non-gaps if Genomics.IsStopCodon(codon): for x in c: if x in options.gap_chars: new_sequence.append(x) else: new_sequence.append(char) else: new_sequence += c c = [] codon = [] new_sequence += c sequence = "".join(new_sequence) elif method == "mask-soft": # Get next hard masked record and extract sequence and length try: cur_hm_record = next(hard_masked_iterator) except StopIteration: break hm_sequence = re.sub(" ", "", cur_hm_record.sequence) lhm = len(hm_sequence) new_sequence = [] # Check lengths of unmasked and soft masked sequences the same if l != lhm: raise ValueError( "length of unmasked and hard masked sequences not " "identical for record %s" % (cur_record.title)) # Check if hard masked seq contains repeat (N), if so replace N # with lowercase sequence from unmasked version if sequence == hm_sequence: pass else: for x, y in zip_longest(sequence, hm_sequence): if y == "N": new_sequence += x.lower() else: new_sequence += x.upper() sequence = "".join(new_sequence) elif method == "map-codons": raiseIfNotCodon(l, cur_record.title) seq = [] for codon in (sequence[x:x + 3].upper() for x in range(0, l, 3)): if codon not in map_codon2code: aa = "X" else: aa = map_codon2code[codon] seq.append(aa) sequence = "".join(seq) elif method == "interleaved-codons": raiseIfNotCodon(l, cur_record.title) seq = [] for codon in [sequence[x:x + 3] for x in range(0, l, 3)]: aa = Genomics.MapCodon2AA(codon) seq.append("%s:%s" % (aa, codon)) sequence = " ".join(seq) elif method == "translate-to-stop": seq = [] for codon in [sequence[x:x + 3] for x in range(0, l, 3)]: if Genomics.IsStopCodon(codon): break aa = Genomics.MapCodon2AA(codon) seq.append(aa) sequence = "".join(seq) elif method == "truncate-at-stop": seq = [] for codon in [sequence[x:x + 3] for x in range(0, l, 3)]: if Genomics.IsStopCodon(codon): break seq.append(codon) sequence = "".join(seq) elif method == "remove-gaps": seq = [] for s in sequence: if s in options.gap_chars: continue seq.append(s) sequence = "".join(seq) elif method == "upper": sequence = sequence.upper() elif method == "lower": sequence = sequence.lower() elif method == "mark-codons": raiseIfNotCodon(l, cur_record.title) seq = [] sequence = " ".join( [sequence[x:x + 3] for x in range(0, l, 3)]) elif method == "apply-map": id = re.match("^(\S+)", cur_record.title).groups()[0] if id in map_seq2nid: rest = cur_record.title[len(id):] cur_record.title = map_seq2nid[id] + rest elif method == "build-map": # build a map of identifiers id = re.match("^(\S+)", cur_record.title).groups()[0] new_id = options.template_identifier % nseq if id in map_seq2nid: raise "duplicate fasta entries - can't map those: %s" % id map_seq2nid[id] = new_id cur_record.title = new_id elif method == "mask-bias": masker = Masker.MaskerBias() sequence = masker(sequence) elif method == "mask-seg": masker = Masker.MaskerSeg() sequence = masker(sequence) elif method == "shuffle": s = list(sequence) random.shuffle(s) sequence = "".join(s) elif method == "mask-incomplete-codons": seq = list(sequence) for x in range(0, l, 3): nm = len([x for x in seq[x:x + 3] if x in mask_chars]) if 0 < nm < 3: seq[x:x + 3] = [mask_char] * 3 sequence = "".join(seq) elif method == "mask-codons": # mask codons based on amino acids given as reference # sequences. other_record = next(other_iterator) if other_record is None: raise ValueError("run out of sequences.") if cur_record.title != other_record.title: raise ValueError("sequence titles don't match: %s %s" % (cur_record.title, other_record.title)) other_sequence = re.sub(" ", "", other_record.sequence) if len(other_sequence) * 3 != len(sequence): raise ValueError( "sequences for %s don't have matching lengths %i - %i" % (cur_record.title, len(other_sequence) * 3, len(sequence))) seq = list(sequence) c = 0 for x in other_sequence: if x in options.aa_mask_chars: if x.isupper(): seq[c:c + 3] = [options.na_mask_char.upper()] * 3 else: seq[c:c + 3] = [options.na_mask_char.lower()] * 3 c += 3 sequence = "".join(seq) l = len(sequence) if filter_min_sequence_length is not None and \ l < filter_min_sequence_length: nskipped += 1 if filter_max_sequence_length is not None and \ l > filter_max_sequence_length: nskipped += 1 continue options.stdout.write(">%s\n%s\n" % (cur_record.title, sequence)) noutput += 1 if "build-map" in options.methods: p = options.parameters[0] if p: outfile = IOTools.openFile(p, "w") else: outfile = options.stdout outfile.write("old\tnew\n") for old_id, new_id in list(map_seq2nid.items()): outfile.write("%s\t%s\n" % (old_id, new_id)) if p: outfile.close() E.info("ninput=%i, noutput=%i, nskipped=%i, nerrors=%i" % (ninput, noutput, nskipped, nerrors)) E.Stop()