def real_dna():
dna = load_seq("./data/X73525.fa")
threshold = longest_ORF_noncoding(dna, 500)
aminoacidsequence = gene_finder(dna, threshold)
return aminoacidsequence
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
a=[] #creating an empty list
threshold = longest_ORF_noncoding(dna,1500) #Assign Value to threshold
Long_Orfs = len(longest_ORF(dna)) #assign value to Long_Orfs
if Long_Orfs>threshold): #Compare values
a.append(coding_strand_to_AA(dna)) #add to the list
dna = load_seq("./data/X73525.fa") #obtaining genes
print gene_finder(dna) #showing the list of Amino Acids
def gene_finder(dna):
#Makes sure it all comes together
from load import load_seq
dna = load_seq("/home/tolu/GeneFinder/data/X73525.fa")
threshold = longest_ORF_noncoding(dna, 1500)
output = []
protein = ''
orfs = find_all_ORFs_both_strands(dna)
i = 0
for i in range(len(orfs)):
if (len(orfs[i]) >= threshold):
protein = coding_strand_to_AA(orfs[i])
output.append(protein)
return output
returns: a list of all amino acid sequences coded by the sequence dna.
>>> gene_finder("ATGCGAATGTAGCATCAAA")
['MRM', 'MLHSH']
"""
print 'Finding threshold...'
threshold = len(longest_ORF_noncoding(dna, 1500))
print threshold
all_ORFs = find_all_ORFs_both_strands(dna)
returns = []
i=0
print 'Entering while loop... '
while i < len(all_ORFs):
if len(all_ORFs[i]) >= threshold:
returns.append(coding_strand_to_AA(all_ORFs[i]))
print 'Added sequence'
i+=1
print str(len(returns)) + 'sequences added: \n'
print returns
if __name__ == "__main__":
import doctest
#doctest.testmod()
#doctest.run_docstring_examples(coding_strand_to_AA, globals(), verbose=True)
gene_finder(load_seq("./data/X73525.fa"))
return proteins
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
len(dna)
num_trials = 1500
allorfs = find_all_ORFs_both_strands(dna)
longest = len(longest_ORF(dna))
amirandom = longest_ORF_noncoding(dna, num_trials)
finallist = ORFsinOrder(dna , amirandom)
translated = []
for i in range(0, len(finallist)-1): #This loop translates all of the resulting potential genes into their final format.
translated.append(coding_strand_to_AA(finallist[i]))
return translated
if __name__ == "__main__":
import doctest
doctest.testmod()
mygenes = gene_finder(load_seq("./data/X73525.fa")) #mygenes is the final variable that contains all the potential genes above a threshold.
# Sets i to weep dna, j to sweep codons and sees where it sees where i:i+3 is in Codons
# and returns the AA sequence for that codon.
return ''.join([ aa[j] for i in range(0,len(dna),3) for j in range(len(codons)) if dna[i:i+3] in codons[j]])
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
# Finds the ORF length for threshold
ORF_length = longest_ORF_noncoding( dna ,threshold)
# End ORFs
Real_ORFs = []
# Finds all the ORFs and sets i to them
for i in find_all_ORFs_both_strands(dna):
if len(i) > ORF_length:
Real_ORFs.append(coding_strand_to_AA(i))
return len(Real_ORFs),Real_ORFs
if __name__ == "__main__":
import doctest
doctest.testmod()
print gene_finder( load_seq("./data/X73525.fa"), 1500)
from gene_finder import *
from load import load_seq
salmonella_dna = load_seq("./data/X73525.fa")
def two_lists_contain_same_elements(list1, list2):
if len(list1) != len(list2):
return False
else:
for list_item in list1:
if list_item in list2:
continue
else:
return False
return True
def coding_strand_to_AA_unit_tests():
""" Unit tests for the coding_strand_to_AA function """
# DNA input strands
dna_input1 = "ACTGCCCC"
dna_input2 = "AGCTGAGGGTGTTTTGGA"
dna_input3 = "CAGGCTTGCGGCTTCTTAA"
# Expected output amino acid strands
e_output1 = "TA"
e_output2 = "S|GCFG"
e_output3 = "QACGFL"
# Actual output amino acid strands
a_output1 = coding_strand_to_AA(dna_input1)
def main():
dna = load_seq("./data/X73525.fa")
threshold = longest_ORF_noncoding(dna, 1500)
candidate_genes = gene_finder(dna, threshold)
def gene_finder(dna):
""" Returns the amino acid sequences coded by all genes that have an ORF
larger than the specified threshold.
dna: a DNA sequence
threshold: the minimum length of the ORF for it to be considered a valid
gene.
returns: a list of all amino acid sequences whose ORFs meet the minimum
length specified.
"""
# TODO: implement this
# determine threshold
threshold = longest_ORF_noncoding(dna, 1500)
# call coding_strand_to_AA on each of the ORFs
return [
coding_strand_to_AA(ORF) for ORF in (find_all_ORFs_both_strands(dna))
if (len(ORF) > threshold)
]
if __name__ == "__main__":
import doctest
doctest.testmod()
dna = load_seq("./data/X73525.fa")
print gene_finder(dna)
"""
acids = []
for i in range(0, len(dna) - 2, 3):
acids.append(aa_table[dna[i:i + 3]])
return ''.join(acids)
def gene_finder(dna):
""" Returns the amino acid sequences coded by all genes that have an ORF
larger than the specified threshold.
dna: a DNA sequence
threshold: the minimum length of the ORF for it to be considered a valid
gene.
returns: a list of all amino acid sequences whose ORFs meet the minimum
length specified.
"""
acids = []
threshold = longest_ORF_noncoding(dna, 1500)
for i in find_all_ORFs_both_strands(dna):
if len(i) >= threshold:
acids.append(coding_strand_to_AA(i))
return acids
if __name__ == "__main__":
import doctest
doctest.testmod()
print(gene_finder(load_seq('./data/X73525.fa')))
def run_gene_finder():
"""Loads gene and returns long_ORFS"""
dna = load_seq('./data/X73525.fa')
amino_acids = gene_finder(dna)
return amino_acids
def get_threshold():
"""Returns a conservative threshold to use to get ORFS. Prints 789"""
dna = load_seq('./data/X73525.fa')
return longest_ORF_noncoding(dna,1500)
def gene_finder_salmonella():
from load import load_seq
dna = load_seq("./data/X73525.fa")
threshold = len(longest_ORF_noncoding(dna,1500))
salmonella_aa = gene_finder(dna,threshold)
return salmonella_aa
def get_reverse_complement(dna):
""" Computes the reverse complementary sequence of DNA for the specfied DNA
sequence
dna: a DNA sequence represented as a string
returns: the reverse complementary DNA sequence represented as a string
>>> get_reverse_complement("ATGCCCGCTTT")
'AAAGCGGGCAT'
>>> get_reverse_complement("CCGCGTTCA")
'TGAACGCGG'
>>> get_reverse_complement("ATCG")
'CGAT'
"""
# TODO: implement this
reversed_dna = dna[::-1]
result = ' '
for letter in reversed_dna:
result = result + get_complement(letter)
return result
def divide_to_codons(dna):
"""Takes a DNA sequence and outputs a list of string triplets(codons) that makes up the sequence
Last element might be incomplete codon with less then three letters
>>> divide_to_codons("ATGTGAA")
['ATG', 'TGA', 'A']
>>> divide_to_codons("ATGTGA")
['ATG', 'TGA']
>>> divide_to_codons("ATGTGAAA")
['ATG', 'TGA', 'AA']
"""
index = 0
result = []
while index < len(dna):
result.append(dna[index:index+3])
index = index + 3
return result
def rest_of_ORF(dna):
""" Takes a DNA sequence that is assumed to begin with a start
codon and returns the sequence up to but not including the
first in frame stop codon. If there is no in frame stop codon,
returns the whole string.
dna: a DNA sequence
returns: the open reading frame represented as a string
>>> rest_of_ORF("ATGTGAA")
'ATG'
>>> rest_of_ORF("ATGAGATAGG")
'ATGAGA'
>>> rest_of_ORF("ATG")
'ATG'
>>> rest_of_ORF("AT")
'AT'
>>> rest_of_ORF("ATGASDASDWASDWADASDSAD")
'ATGASDASDWASDWADASDSAD'
>>> rest_of_ORF("ATGTGTTAAATGAAAAAATAGAA")
'ATGTGT'
"""
stop_codons = ['TAG', 'TAA, TGA']
#list of codons from which the dna is composed of
codons = divide_to_codons(dna)
result = ""
index = 0
while index + 1 < len(codons):
#If next codons isn't a stop codon, add it to string and iterate
if codons[index + 1] not in stop_codons:
result = result + codons[index]
index = index + 1
else:
#Add codon before stop codon
result = result + codons[index]
return result
return dna
def find_all_ORFs_oneframe(dna):
"""
Finds all non-nested open reading frames in the given DNA
sequence and returns them as a list. This function should
only find ORFs that are in the default frame of the sequence
(i.e. they start on indices that are multiples of 3).
By non-nested we mean that if an ORF occurs entirely within
another ORF, it should not be included in the returned list of ORFs.
dna: a DNA sequence
returns: a list of non-nested ORFs
>>> find_all_ORFs_oneframe("ATGCATGAATGTAGATAGATGTGCCC")
['ATGCATGAATGTAGA', 'ATGTGCCC']
>>> find_all_ORFs_oneframe("ATGTGAA")
['ATG']
>>> find_all_ORFs_oneframe('ASDASDAWSDSD')
[]
>>> find_all_ORFs_oneframe('TATATGCATGAATGTAGATAGATGTGCTAAATAATAATGTTTTAAATT')
['ATGCATGAATGTAGA', 'ATGTGC', 'ATGTTT']
"""
index = 0
orf_list = []
while index < len(dna):
if dna[index:index+3] == 'ATG':
#appended ORF
orf = rest_of_ORF(dna[index:])
orf_list.append(orf)
index = index + len(orf)
else:
index = index + 3
return orf_list
def find_all_ORFs(dna):
"""
Finds all non-nested open reading frames in the given DNA sequence in
all 3 possible frames and returns them as a list. By non-nested we
mean that if an ORF occurs entirely within another ORF and they are
both in the same frame, it should not be included in the returned list
of ORFs.
dna: a DNA sequence
returns: a list of non-nested ORFs
This unit testing would be enough because there isn't any special exceptions that needs to be tested. Also, this case tests this function's
ability to grab orf from three different possible reading frames.
>>> find_all_ORFs("ATGCATGAATGTAG")
['ATGCATGAATGTAG', 'ATGAATGTAG', 'ATG']
"""
#orf list from all frames
orf_list = []
#zero offset frame
orf_list = orf_list + find_all_ORFs_oneframe(dna)
#first offset frame
orf_list = orf_list + find_all_ORFs_oneframe(dna[1:])
#second offset frame
orf_list = orf_list + find_all_ORFs_oneframe(dna[2:])
return orf_list
def find_all_ORFs_both_strands(dna):
"""
Finds all non-nested open reading frames in the given DNA sequence on both
strands.
dna: a DNA sequence
returns: a list of non-nested ORFs
>>> find_all_ORFs_both_strands("ATGCGAATGTAGCATCAAA")
['ATGCGAATG', 'ATGCTACATTCGCAT']
"""
reverse = get_reverse_complement(dna)
#finds orfs in both direction
orf_list = find_all_ORFs(dna) + find_all_ORFs(reverse_complement)
return orf_list
def longest_ORF(dna):
"""
Finds the longest ORF on both strands of the specified DNA and returns it
as a string
>>> longest_ORF("ATGCGAATGTAGCATCAAA")
'ATGCTACATTCGCAT'
"""
longest_length = 0
orfs = find_all_ORFs_both_strands(dna)
for orf in orfs:
if len(orf) > longest_length:
longest_orf = orf
longest_length = len(orf)
return longest_orf
def longest_ORF_noncoding(dna, num_trials):
"""
Computes the maximum length of the longest ORF over num_trials shuffles
of the specfied DNA sequence
dna: a DNA sequence
num_trials: the number of random shuffles
returns: the maximum length longest ORF
"""
x = 0
longest = 0
while x < num_trials:
shuffled_dna = shuffle_string(dna)
longest_orf_length = len(longest_ORF(shuffled_dna))
if longest_orf_length > longest:
longest = longest_orf_length
x = x + 1
return longest
def coding_strand_to_AA(dna):
""" Computes the Protein encoded by a sequence of DNA. This function
does not check for start and stop codons (it assumes that the input
DNA sequence represents an protein coding region).
dna: a DNA sequence represented as a string
returns: a string containing the sequence of amino acids encoded by the
the input DNA fragment
>>> coding_strand_to_AA("ATGCGA")
'MR'
>>> coding_strand_to_AA("ATGCCCGCTTT")
'MPA'
>>> coding_strand_to_AA("TTTATCATGTTAGTTA")
'FIMLV'
"""
codons = divide_to_codons(dna)
amino_acid = ''
for codon in codons:
if len(codon) == 3:
amino_acid = amino_acid + aa_table[codon]
return amino_acid
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
threshold = longest_ORF_noncoding(dna, 1500)
all_orfs = find_all_ORFs_both_strands(dna)
amnio_acids = []
for orf in all_orfs:
if len(orf) > threshold :
amino_acids.append(coding_strang_to_AA(orf))
return amino_acids
if __name__ == "__main__":
import doctest
doctest.testmod(verbose = True)
doctest.run_docstring_examples(coding_strand_to_AA, globals(), verbose = True)
dna_seq = load_seq('data/X73525.fa')
print (gene_finder(dna_seq))
s = 0
while s <= len(dna) - 3:
m.append(aa_table[dna[s:s + 3]])
s = s + 3
k = ''
k = k.join(m)
return k
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
ac = []
threshold = longest_ORF_noncoding(dna, 1500)
dna_long = find_all_ORFs_both_strands(dna)
for i in dna_long:
if len(i) > threshold:
ac.append(coding_strand_to_AA(i))
return ac
if __name__ == "__main__":
import doctest
print(gene_finder(dna=load_seq("./data/X73525.fa")))
doctest.testmod(verbose=True)
>>> coding_strand_to_AA("TTTATCATGTTAGTTA")
'FIMLV'
"""
codons = divide_to_codons(dna)
amino_acid = ''
for codon in codons:
if len(codon) == 3:
amino_acid += aa_table[codon]
return amino_acid
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
threshold = longest_ORF_noncoding(dna, 1500)
all_orfs = find_all_ORFs_both_strands(dna)
amino_acids = []
for orf in all_orfs:
if len(orf) > threshold:
amino_acids.append(coding_strand_to_AA(orf))
return amino_acids
if __name__ == "__main__":
import doctest
doctest.testmod()
#doctest.run_docstring_examples(coding_strand_to_AA, globals())
dna_seq = load_seq('data/X73525.fa')
print gene_finder(dna_seq)
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
No appropriate doctests can be written for this function - the result can and
most likely will vary with each call, because longest_ORF_noncoding is
inherently not consistent in its return values, due to the random nature
of the shuffle.
"""
max_len = len(longest_ORF_noncoding(dna, 1500))
return sorted(
[
coding_strand_to_AA(orf)
for orf in find_all_ORFs_both_strands(dna) if len(orf) >= max_len
],
key=len,
reverse=True
) #Returns reverse length sorted list of all translated genes that are longer than threshold
if __name__ == "__main__":
import doctest
doctest.testmod()
result = gene_finder(load_seq("./data/X73525.fa"))
print "Here is the result:"
for translated_protein in result:
print translated_protein
for k in range(0,len(dna_three)):
threes = dna_three[k]
if len(threes)==3:
amino_acid_1 = aa_table[threes]
amino_acid += amino_acid.join(amino_acid_1)
k = k + 1
return amino_acid
def gene_finder(dna):
""" Returns the amino acid sequences coded by all genes that have an ORF
larger than the specified threshold.
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
# TODO: implement this
threshold = longest_ORF_noncoding(dna, 1500)
both_strand_orfs_unthreshold = find_all_ORFs_both_strands(dna)
both_strand_orfs_threshold = []
for orfs in both_strand_orfs_unthreshold:
if len(orfs) > threshold:
both_strand_orfs_threshold.append(orfs)
final_amino_conversion = map(coding_strand_to_AA, both_strand_orfs_threshold)
return final_amino_conversion
dna = load_seq('./data/X73525.fa')
print gene_finder(dna)
def salmonella_gene_finder():
dna = load_seq("./data/X73525.fa")
genes = gene_finder(dna)
for gene in genes:
print gene
for i in range(0, len(dna), 3):
codon = dna[i:i+3]
if len(codon) == 3:
aa_sequence += aa_table[codon]
return aa_sequence
def gene_finder(dna):
""" Returns the amino acid sequences that are likely coded by the specified dna
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
aa_list = []
threshold = longest_ORF_noncoding(dna, 1500)
print threshold
dna_list = find_all_ORFs_both_strands(dna)
for i in range(0, len(dna_list)):
if len(dna_list[i]) > threshold:
aa_list.append(coding_strand_to_AA(dna_list[i]))
return aa_list
if __name__ == "__main__":
import doctest
#doctest.testmod()
#doctest.run_docstring_examples(coding_strand_to_AA, globals())
from load import load_seq
dna = load_seq("./data/X73525.fa")
print gene_finder(dna)
shuffle(DNA)
compare = []
for index in range(len(longest_frame)): #cycles through num_trials number of indexes comparing to find longest ORF
if len(longest_frame[index]) > len(compare):
compare = longest_frame[index]
else:
compare = compare
return len(compare)
#print longest_ORF_noncoding('ATGCGAATGTAGCATCAAA', 30)
def gene_finder(dna, threshold):
""" Returns the amino acid sequences coded by all genes that have an ORF
larger than the specified threshold.
dna: a DNA sequence
threshold: the minimum length of the ORF for it to be considered a valid
gene.
returns: a list of all amino acid sequences whose ORFs meet the minimum
length specified.
"""
amino_acids = []
all_frames = find_all_ORFs_both_strands(dna)
for index in range(len(all_frames)): #if the length of ORF is above the threshold, adds it to list
if len(all_frames[index]) > threshold:
amino_acids.append(coding_strand_to_AA(all_frames[index])) #finds amino acids coresponding to codons from above list
return amino_acids
if __name__ == '__main__':
dna = load_seq('./data/X73525.fa')
gene_finder(dna,600)
print(gene_finder(dna, 600))