def pseudoTranslate(self, transl_table=1, out_type="standard", code=None):
"""Returns a pseudo protein alignment from *self*, a DNA alignment.
The result is of datatype standard instead of protein, which allows
the use of special recodings, like distinguishing between two types
of serines, like in :meth:`Alignment.recode23aa()`.
*self* is translated using :attribute:`Code(transl_table).code`.
Alternatively, the genetic code can be provided through the parameter *code*.
If such a code is provided, the value of *transl_table* is ignored.
The parameter *code* can take to types of values:
1) It can be a string naming the code to use, as defined in Biopython's
`CodonTable.unambiguous_dna_by_name.keys()`
2) It can be a dictionnary *code* whose keys are codons, and the values are
the corresponding amino-acids. All triplets present in the matrix should
also be present in the code dictionnary, except triplets of indels. Codons
and the corresponding amino-acids are expected to be in lower case.
It may be possible to use a code based on another codon length as 3,
but this has not been tested as of June 2012.
At the moment, we can only do translations where the sequences are phased
with the coding frame, ie the first sequence position is the first position
of the codon, and the last sequence position should be a last codon position.
The default behaviour is to use translation table 1, that is the standard genetic code.
Other available translation tables, this week::
if transl_table == 1: # standard
elif transl_table == 2: # vertebrate mito
elif transl_table == 4: # Mold, Protozoan,
# and Coelenterate Mitochondrial Code
# and the Mycoplasma/Spiroplasma Code
elif transl_table == 5: # invertebrate mito
elif transl_table == 9: # echinoderm mito
and now 6, 10, 11, 12, 13, 14, 21.
(These are found in p4.GeneticCode.py or in :class:`Code`)
*transl_table* may also be provided as text consisting in blank-separated elements.
Each elements consists in n characters, where n is the number of defined codons.
The first element lists the coded (pseudo-)amino-acids.
The second elements describes whether a codon can be a start codon ('M') or not ('-').
The other elements correspond to the (pseudo-)nucleotides at the successive codon positions.
Example::
FFJJZZZZYY**CC*WBBBBPPPPHHQQUUUUIIIMTTTTNNKKXXOOVVVVAAAADDEEGGGG
---M---------------M------------MMMM---------------M------------
TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
"""
gm = ['p4.alignment_recoding.pseudoTranslate()']
if self.dataType != 'dna':
gm.append("Self should be a DNA alignment")
raise P4Error(gm)
if code is None:
#from GeneticCode import Code
code = Code(transl_table, in_type="dna", out_type=out_type).code
codelength = Code(transl_table).codelength
else:
if isinstance(code, types.StringType):
code = getBiopythonCode(code) # defined in code_utils.py
# We assume that the "codons" have all the same length,
# and we look at the first codon in the dictionary to know this length.
codelength = len(code.keys()[0])
# We use standard type, because, depending on the code used to make the translation,
# we may get something that contains symbols not corresponding to normal amino-acids.
out_type = "standard"
if self.length % codelength != 0:
gm.append("The length of self should be a multiple of %i" % codelength)
raise P4Error(gm)
ali = self.dupe()
ali.dataType = out_type
ali.length = self.length / codelength
ali.symbols = CAT(sorted(set(code.values())))
ali.equates = {}
ali.dim = len(ali.symbols)
ali.nexusSets = None
ali.parts = []
ali.excludeDelete = None
for seq in ali.sequences:
# Initialize an all-gap sequence.
seq.sequence = ['-'] * ali.length
seq.dataType = out_type
for i in range(len(self.sequences)):
# the original sequence
dnaSeq = self.sequences[i].sequence
# the future pseudo-translation
pseudoProtSeq = ali.sequences[i].sequence
for j in range(ali.length):
theCodon = dnaSeq[(j * codelength):((j+1) * codelength)]
if code.has_key(theCodon):
pseudoProtSeq[j] = code[theCodon]
elif theCodon == '-' * codelength:
# full indel
pseudoProtSeq[j] = '-'
elif theCodon.count('-'):
# partial indel
gm.append(" seq %i, position %4i, dnaSeq %4i, codon '%s' is incomplete" % (
i, j, (j*codelength), theCodon))
raise P4Error(gm)
else:
# Should we use a CodonTranslationError (defined in code_utils.py) here ?
gm.append(" seq %i position %4i, dnaSeq %4i, codon '%s' is not a known codon" % (
i, j, (j*codelength), theCodon))
raise P4Error(gm)
for seq in ali.sequences:
# Convert from list to string.
#s.sequence = string.join(s.sequence, '')
seq.sequence = CAT(seq.sequence)
#print s.sequence
return ali
def pseudoTranslate(self, transl_table=1, out_type="standard", code=None):
"""Returns a pseudo protein alignment from *self*, a DNA alignment.
The result is of datatype standard instead of protein, which allows
the use of special recodings, like distinguishing between two types
of serines, like in :meth:`Alignment.recode23aa()`.
*self* is translated using :attribute:`Code(transl_table).code`.
Alternatively, the genetic code can be provided through the parameter *code*.
If such a code is provided, the value of *transl_table* is ignored.
The parameter *code* can take to types of values:
1) It can be a string naming the code to use, as defined in Biopython's
`CodonTable.unambiguous_dna_by_name.keys()`
2) It can be a dictionnary *code* whose keys are codons, and the values are
the corresponding amino-acids. All triplets present in the matrix should
also be present in the code dictionnary, except triplets of indels. Codons
and the corresponding amino-acids are expected to be in lower case.
It may be possible to use a code based on another codon length as 3,
but this has not been tested as of June 2012.
At the moment, we can only do translations where the sequences are phased
with the coding frame, ie the first sequence position is the first position
of the codon, and the last sequence position should be a last codon position.
The default behaviour is to use translation table 1, that is the standard genetic code.
Other available translation tables, this week::
if transl_table == 1: # standard
elif transl_table == 2: # vertebrate mito
elif transl_table == 4: # Mold, Protozoan,
# and Coelenterate Mitochondrial Code
# and the Mycoplasma/Spiroplasma Code
elif transl_table == 5: # invertebrate mito
elif transl_table == 9: # echinoderm mito
and now 6, 10, 11, 12, 13, 14, 21.
(These are found in p4.GeneticCode.py or in :class:`Code`)
*transl_table* may also be provided as text consisting in blank-separated elements.
Each elements consists in n characters, where n is the number of defined codons.
The first element lists the coded (pseudo-)amino-acids.
The second elements describes whether a codon can be a start codon ('M') or not ('-').
The other elements correspond to the (pseudo-)nucleotides at the successive codon positions.
Example::
FFJJZZZZYY**CC*WBBBBPPPPHHQQUUUUIIIMTTTTNNKKXXOOVVVVAAAADDEEGGGG
---M---------------M------------MMMM---------------M------------
TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
"""
gm = ['p4.alignment_recoding.pseudoTranslate()']
if self.dataType != 'dna':
gm.append("Self should be a DNA alignment")
raise P4Error(gm)
if code is None:
#from GeneticCode import Code
code = Code(transl_table, in_type="dna", out_type=out_type).code
codelength = Code(transl_table).codelength
else:
if isinstance(code, str):
code = getBiopythonCode(code) # defined in code_utils.py
# We assume that the "codons" have all the same length,
# and we look at the first codon in the dictionary to know this length.
codelength = len(code.keys()[0])
# We use standard type, because, depending on the code used to make the translation,
# we may get something that contains symbols not corresponding to normal amino-acids.
out_type = "standard"
if self.length % codelength != 0:
gm.append("The length of self should be a multiple of %i" % codelength)
raise P4Error(gm)
ali = self.dupe()
ali.dataType = out_type
ali.length = self.length / codelength
ali.symbols = CAT(sorted(set(code.values())))
ali.equates = {}
ali.dim = len(ali.symbols)
ali.nexusSets = None
ali.parts = []
ali.excludeDelete = None
for seq in ali.sequences:
# Initialize an all-gap sequence.
seq.sequence = ['-'] * ali.length
seq.dataType = out_type
for i in range(len(self.sequences)):
# the original sequence
dnaSeq = self.sequences[i].sequence
# the future pseudo-translation
pseudoProtSeq = ali.sequences[i].sequence
for j in range(ali.length):
theCodon = dnaSeq[(j * codelength):((j + 1) * codelength)]
if theCodon in code:
pseudoProtSeq[j] = code[theCodon]
elif theCodon == '-' * codelength:
# full indel
pseudoProtSeq[j] = '-'
elif theCodon.count('-'):
# partial indel
gm.append(
" seq %i, position %4i, dnaSeq %4i, codon '%s' is incomplete"
% (i, j, (j * codelength), theCodon))
raise P4Error(gm)
else:
# Should we use a CodonTranslationError (defined in code_utils.py) here ?
gm.append(
" seq %i position %4i, dnaSeq %4i, codon '%s' is not a known codon"
% (i, j, (j * codelength), theCodon))
raise P4Error(gm)
for seq in ali.sequences:
# Convert from list to string.
#s.sequence = ''.join(s.sequence)
seq.sequence = CAT(seq.sequence)
#print s.sequence
return ali
