def main():
# Read in the RNA sequences from a file specified by user input
filename = input("Please enter the input file name: ")
rnainfo = readfasta(filename)
# Prepare to re-write the RNA sequences to an output file specified by user input
outfilename = input("Please enter the output file name: ")
handle = open(outfilename, mode="w")
# Iterate through each RNA sequence in the input file
for i in range(len(rnainfo)):
# Specify gene that is being evaluated
handle.write("Gene " + str(i+1) + ": " + rnainfo[i][2] + "\n\n")
# Translate the RNA Sequence to its corresponding single-letter amino acid sequence
# Write information to the output file
translatedseq = translate(rnainfo[i][2])
handle.write("Protein Sequence " + str(i+1) + ": " + translatedseq + "\n\n")
# Scan the single-letter amino acid sequence for transmembrane helices
# Write results to the output file
findTMD(translatedseq, handle)
# Close file
handle.close()
def bootstrap():
sequences = readfasta("mt_homo_dna.fasta")
list_original_sequences = []
for sequence in range(
0, len(sequences)
): #convert (list of lists) to (list of strings), makes logic easier later
list_original_sequences.append(sequences[sequence][1])
print("Original Sequences")
for sequence in range(0, len(list_original_sequences)):
print(list_original_sequences[sequence])
i = 0 #counter for number of letters appended
j = len(
min(list_original_sequences, key=len)
) #num of letters needed to be appended, shortest string in orig. seqs
k = len(list_original_sequences) - 1 #number of sequences
new_sequences = [
""
] * k #generates k number of empty strings, stores in list
while i != j:
random_num = random.randint(0, j - 1) #select random column
for sequence in range(0, k): #iterate thru total num of sequences
new_sequences[sequence] += list_original_sequences[sequence][
random_num] #appends each sequence, each iter.
i += 1
print("New Sequences")
for sequence in range(0, len(new_sequences)):
print(new_sequences[sequence])
def main():
sequences = readfasta.readfasta(sys.arv[1])
# sequences = readfasta.readfasta("mt_homo_dna.fasta")
table = d.get_k2p_table(sequences)
global help_table
help_table = table
find_smallest(table)
def main():
print( "*****\nBioinformatics - Assignment 2 - Group 2\n*****\n" )
# scan in all fasta files in the "genes" directory
os.chdir( os.getcwd() + "/genes/" )
for file in glob.glob( "*.fasta" ):
print( file )
genes = readfasta( file )
for gene in genes:
print( gene[1][:60] )
def main():
print("*****\nBioinformatics - Assignment 2 - Group 2\n*****\n")
# scan in all fasta files in the "genes" directory
os.chdir(os.getcwd() + "/genes/")
file = glob.glob("*.fasta")[0]
# read all the genes from the fasta file
print(file)
genes = readfasta(file)
original_tree = generate_tree(genes)
print(original_tree[0])
clade_count_dict = {}
# count the clades of the original tree and add them as keys
build_clade_count_dict(original_tree[0], clade_count_dict)
BOOTSTRAP_TIMES = 20
multi_aligned_sequences = \
progressive_alignment(genes, original_tree[0], original_tree[1])
multi_aligned_sequences = reorder_alignments(multi_aligned_sequences)
for sequence in multi_aligned_sequences:
print(sequence[0][:120])
#count each clade in bootstrap trees matching a clade from original tree
for i in range(0, BOOTSTRAP_TIMES):
bootstrapped_genes = generate_bootstrap_genes(multi_aligned_sequences)
this_tree = generate_boots_tree(bootstrapped_genes)
print("Bootstrap Tree ", i)
print(this_tree)
clade_search(this_tree, clade_count_dict)
# return a dict containing the clades as keys mapped to their confidence
clade_confidences = \
calculate_confidences( clade_count_dict, BOOTSTRAP_TIMES )
for clade, confidence in clade_confidences.items():
print("clade: ", clade)
print("confidence: ", confidence)
def get_k2p_table(sequence_list):
thread_count = 2
size = len(sequence_list)
table = dict()
processes = mp.Pool(processes=thread_count)
process_pool = []
for seq in sequence_list:
table[seq[0]] = dict()
for i in range(size):
seq1 = sequence_list[i]
for j in range(i, size):
seq2 = sequence_list[j]
process_pool.append(processes.apply_async(k2p_multiprocess, (seq1, seq2,)))
processes.close()
processes.join()
for p in process_pool:
result = p.get()
s1name = result[0]
s2name = result[1]
distance = result[2]
table[s1name][s2name] = distance
table[s2name][s1name] = distance
return table
if __name__ == '__main__':
sq1 = r.readfasta("sample.fasta.txt")[0][1]
sq2 = r.readfasta("sample.fasta.txt")[1][1]
k2p(sq1, sq2)
'''
Zoe Moore 9/15/2019
A program that reads RNA sequences from a text file and translates
them to their corresponding amino acid sequences.
'''
from readfasta import readfasta
from RNATranslate import translate
# Read in the RNA sequences from a file specified by user input
filename = input("Please enter the input file name: ")
rnainfo = readfasta(filename)
# Prepare to re-write the RNA sequences to an output file specified by user input
outfilename = input("Please enter the rna output file name: ")
handle = open(outfilename, mode="w")
# Separate out three RNA sequences and write them to separate lines of a .txt file
seqone = rnainfo[0][2]
handle.write(seqone + "\n\n")
seqtwo = rnainfo[1][2]
handle.write(seqtwo + "\n\n")
seqthree = rnainfo[2][2]
handle.write(seqthree + "\n\n")
handle.close()
# Translate RNA sequences to their single-letter amino acid sequences
aaseqone = translate(seqone)
def main():
print( "*****\nBioinformatics - Assignment 1 - Group 3\n*****\n" )
# for each fsa tested, a 0 will be added to the report card
# if random/our function picked the wrong reading frame, and
# a 1 will be added if it picks the right reading frame
randoms_report_card = []
our_report_card = []
random_was_right = 0
we_were_right = 0
number_of_files_scanned = 0
# the actual reading frame of all fsa we input is always 2+
# which is represented by the index 1
ACTUAL_READING_FRAME = 1
# scan in all fsa files in the "genes" directory
os.chdir( os.getcwd() + "/genes/" )
for file in glob.glob( "*.fsa" ):
print( file )
gene = readfasta( file )[0][1]
rfs = get_all_reading_frames( gene )
# if random picks the correct reading frame
if randint( 0, 5 ) == ACTUAL_READING_FRAME:
random_was_right = random_was_right + 1
randoms_report_card.append(1)
else:
randoms_report_card.append(0)
# if our algorithm picks the correct reading frame
if find_best_reading_frame( rfs ) == ACTUAL_READING_FRAME:
we_were_right = we_were_right + 1
our_report_card.append(1)
else:
our_report_card.append(0)
number_of_files_scanned = number_of_files_scanned + 1
print( "*****\n" )
print( number_of_files_scanned, "genes scanned" )
percent_we_were_right = we_were_right/number_of_files_scanned * 100
percent_rand_was_right = random_was_right/number_of_files_scanned * 100
percent_we_were_right = round( percent_we_were_right, 3 )
percent_rand_was_right = round( percent_rand_was_right, 3 )
print( "Our code was right ", percent_we_were_right, "% of the time" )
print( "Random was right ", percent_rand_was_right, "% of the time\n" )
print( "Our report card: ", our_report_card )
print( "Random's report card: ", randoms_report_card )
ourStats = stats.ttest_ind(randoms_report_card,our_report_card)
print("The p-value is " + str(ourStats.pvalue))
if ourStats.pvalue < 0.05:
print("Our program did statistically significantly better at"
+ " picking the correct RF than a randomly picked RF.")
else:
print("Our program did NOT do statistically significantly better at"
+ " picking the correct RF than a randomly picked RF.")
help="The path to the FASTA file "
+ "containing all sequences to be compared.")
parser.add_argument("-p", "--pairwiseComparisonFile", type=str,
required=False, default="",
help="The path to the alignment file "
+ "containing all pairwise alignments and their scores. "
+ "If this is not present, we will generate all pairwise "
+ "comparisons (may take a very long time!!).")
parser.add_argument("-b", "--bootstrap", type=int, default=1000,
help="The number of bootstrapping iterations to perform. "
+ "Reasonable values range from one to ten thousand. "
"These are computationally cheap (seconds per round)." )
args = parser.parse_args()
allTrees = {} # Simply counts the occurrence of each tree
canonicalFasta = readfasta(args.fastaFile)
canonicalComparisons = args.pairwiseComparisonFile
# Run all pairwise comparisons if necessary
# This will give us the "canonical comparison" file
if (canonicalComparisons == "") or (not os.path.exists(canonicalComparisons)):
print("Pairwise comparison filing missing or absent. Running all comparisons...")
if canonicalComparisons == "":
fastaName = (args.fastaFile).rstrip(".fasta")
canonicalComparisons = fastaName + ".txt"
writePairwiseAlignmentFile( canonicalFasta, canonicalComparisons )
# Build the "canonical" phylogenetic tree and add it to the collection of all trees
canonicalFinalNode = doNeighborJoining(canonicalComparisons, canonicalFasta)
allTrees[canonicalFinalNode.getTreeFile()] = 1
'''
Runs a number of tests on the classes and functions in our phylogeny generator
Tyler Young
'''
from team_2_optimal_alignment_sensitive import *
from team_2_neighbor_joining import *
from readfasta import readfasta
from team_2_bootstrapping import getBootstrappedSequences
import time
fastaData = readfasta("mtDNA.fasta")
distMatrix = constructMatrixFromFile("mtDNA_alignments_with_gorilla_original.txt", fastaData)
for i in range(len(distMatrix)):
print(fastaData[i][1],distMatrix[i])
for i in range(len(distMatrix)):
print(distMatrix[i])
finalNode = getNeighborJoiningPhylogeny(getNeighborJoiningSequences(fastaData), distMatrix)
print(finalNode.getTreeFile())
genomes = [ "AATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCG",
"GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGG",
"GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGG",
"GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGG",
"GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGG",
"GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG",
"GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGG"]
print("Running optimal alignment . . .")
alignment = OptimalAlignment( genomes[0], genomes[1] )
