def test_transcription_of_proteins(self): """Test transcription shouldn't work on a protein!""" for s in protein_seqs: with self.assertRaises(ValueError): Seq.transcribe(s) if isinstance(s, Seq.Seq): with self.assertRaises(ValueError): s.transcribe()
def test_transcription_of_proteins(self): """Test transcription shouldn't work on a protein!""" for s in protein_seqs: with self.assertRaises(ValueError): Seq.transcribe(s) if isinstance(s, Seq.Seq): with self.assertRaises(ValueError): s.transcribe()
def test_seq_object_transcription_method(self): for nucleotide_seq in test_seqs: if isinstance(nucleotide_seq, Seq.Seq): self.assertEqual( repr(Seq.transcribe(nucleotide_seq)), repr(nucleotide_seq.transcribe()), )
def test_transcription_dna_into_rna(self): for nucleotide_seq in test_seqs: expected = Seq.transcribe(nucleotide_seq) self.assertEqual( str(nucleotide_seq).replace("t", "u").replace("T", "U"), str(expected), )
def test_transcription_dna_into_rna(self): for nucleotide_seq in test_seqs: if isinstance(nucleotide_seq.alphabet, Alphabet.DNAAlphabet): expected = Seq.transcribe(nucleotide_seq) self.assertEqual( str(nucleotide_seq).replace("t", "u").replace("T", "U"), str(expected))
def print_proteins_and_codons_using_mitocondrial_yeast_table(seq): dna = Seq(seq) mRna = dna.transcribe() #Diccionario d = {} d["mRNA"] = [mRna] d["protein"] = [] d["stop_codon"] = [] #Revisar si tiene codon de inicio codon_inicio = False for codon in range(0,len(dna),3): if "ATG" in dna[codon:codon+3]: #Variable con la posicion del primer aa del codon de inicio posicion_inicio = codon dnaCoding = dna[codon:len(dna)] d["protein"] = dnaCoding.translate(to_stop = True, table = 3) #Si hay codon de inicio codon_inicio = True #Solo para encontrar un codon break if "ATA" in dna[codon:codon+3]: #Variable con la posicion del primer aa del codon de inicio posicion_inicio = codon dnaCoding = dna[codon:len(dna)] d["protein"] = dnaCoding.translate(to_stop = True, table = 3) #Si hay codon de inicio codon_inicio = True #Solo para encontrar un codon break if "GTG" in dna[codon:codon+3]: #Variable con la posicion del primer aa del codon de inicio posicion_inicio = codon dnaCoding = dna[codon:len(dna)] d["protein"] = dnaCoding.translate(to_stop = True, table = 3) #Si hay codon de inicio codon_inicio = True #Solo para encontrar un codon break #Si si lo hay buscar codon de paro despues del codon de inicio if codon_inicio == True: for codon in range(0,len(dna),3): #print(dna[codon:codon+3]) if ("TAG" in dna[codon:codon+3]) & (posicion_inicio < codon): d["stop_codon"].append("TAG") break if ("TAA" in dna[codon:codon+3]) & (posicion_inicio < codon): d["stop_codon"].append("TAA") break return d
def dna_aa(): if session.username == None: redirect(URL(r=request, c='account', f='log_in')) form = FORM( TABLE( TR( 'Sequence (raw format): ', TEXTAREA(_type='text', _name='sequence', requires=IS_NOT_EMPTY())), #TR("Sequence Type: ", # SELECT("Raw Format", "FASTA", # _name="seq_type")), TR( 'Action: ', SELECT('Complementation', 'Transcribe', 'Translate', 'Back Transcribe', 'Back Translate', _name='action'), INPUT(_type='submit', _value='SUBMIT')))) if form.accepts(request.vars, session): #if form.vars.seq_type == "FASTA": # session['sequence'] = \ # seqClean(fasta_to_raw(form.vars.sequence.upper())) #else: session['sequence'] = seqClean(form.vars.sequence.upper()) if form.vars.action == "Complementation": session['action'] = "Complementation" session['Complement'] = Seq.reverse_complement(session['sequence']) if form.vars.action == "Transcribe": session['action'] = 'Transcribe' session['Transcribed RNA'] = Seq.transcribe(session['sequence']) if form.vars.action == "Back Transcribe": session['action'] = 'Back Transcribe' session['DNA'] = Seq.back_transcribe(session['sequence']) if form.vars.action == "Translate": session['action'] = 'Translate' session.update(translate(session['sequence'])) if form.vars.action == "Back Translate": session['action'] = 'Back Translate' session.update(back_translate(session['sequence'])) redirect(URL(r=request, f='dna_aa_output')) return dict(form=form)
def dna_aa(): if session.username == None: redirect(URL(r=request, c='account', f='log_in')) form = FORM(TABLE(TR('Sequence (raw format): ', TEXTAREA(_type='text', _name='sequence', requires=IS_NOT_EMPTY())), #TR("Sequence Type: ", # SELECT("Raw Format", "FASTA", # _name="seq_type")), TR('Action: ', SELECT('Complementation', 'Transcribe', 'Translate', 'Back Transcribe', 'Back Translate', _name='action'), INPUT(_type='submit', _value='SUBMIT')))) if form.accepts(request.vars,session): #if form.vars.seq_type == "FASTA": # session['sequence'] = \ # seqClean(fasta_to_raw(form.vars.sequence.upper())) #else: session['sequence'] = seqClean(form.vars.sequence.upper()) if form.vars.action == "Complementation": session['action'] = "Complementation" session['Complement'] = Seq.reverse_complement(session['sequence']) if form.vars.action == "Transcribe": session['action'] = 'Transcribe' session['Transcribed RNA'] = Seq.transcribe(session['sequence']) if form.vars.action == "Back Transcribe": session['action'] = 'Back Transcribe' session['DNA'] = Seq.back_transcribe(session['sequence']) if form.vars.action == "Translate": session['action'] = 'Translate' session.update(translate(session['sequence'])) if form.vars.action == "Back Translate": session['action'] = 'Back Translate' session.update(back_translate(session['sequence'])) redirect(URL(r=request, f='dna_aa_output')) return dict(form=form)
def test_transcription_dna_string_into_rna(self): seq = "ATGAAACTG" self.assertEqual("AUGAAACUG", Seq.transcribe(seq))
#Sanity test on the test sequence alphabets (see also enhancement bug 2597) for nucleotide_seq in test_seqs: if hasattr(nucleotide_seq, "alphabet"): if "U" in str(nucleotide_seq).upper(): assert not isinstance(nucleotide_seq.alphabet, Alphabet.DNAAlphabet) if "T" in str(nucleotide_seq).upper(): assert not isinstance(nucleotide_seq.alphabet, Alphabet.RNAAlphabet) print print "Transcribe DNA into RNA" print "=======================" for nucleotide_seq in test_seqs: try: expected = Seq.transcribe(nucleotide_seq) assert str(nucleotide_seq).replace("t", "u").replace("T", "U") == str(expected) print "%s -> %s" \ % (repr(nucleotide_seq) , repr(expected)) except ValueError, e: expected = None print "%s -> %s" \ % (repr(nucleotide_seq) , str(e)) #Now test the Seq object's method if isinstance(nucleotide_seq, Seq.Seq): try: assert repr(expected) == repr(nucleotide_seq.transcribe()) except ValueError: assert expected is None
# Import the sequence from the Biopython library from Bio.Seq import * def complement(seq): comp_seq="" mapping = {'A':'T', "C":"G", "G":"C", "T":"A"} for nucleotide in gene: comp_seq += mapping[nucleotide] return comp_seq; def reverse(seq): rev_seq = seq[::-1] return rev_seq if __name__ == '__main__': gene = "TCAGACTGGTGCCGTGGTGCTCTCGCCCGATGTGACGTCGACCGCCAGCGGCGCGATGACGCCGAGGATTTCCGTGATCGTTTCGGAGGGCACGCCGGCTGCGGTCAGCGCGTCGGCCAAGTGTCCGGCGACCAGGCTGAAGTGGTGCATGGTAATTCCGCGCCCCTGATGGACTTGCTTCATCGGCGCACCGGTATAGGGCTCGGGCCCGCCAAGCGCGGCCGCGAAAAACTCCACCTGCTTGCCCTTGAGGCGGCTCATGTTCGTACCGCTGAAGAAGGCCGATAGTTGGTCATCGGCAAGCACACGAACATAGAAGTCCTCGACGACGACTTCGATGGCCTCATGCCCGCCGATCTTGTCGTAGATGCTGATCGGCTCACGTTTGCGCAAGCGTGACAGTAGTCCCATTTTTATA" res = reverse(complement(gene)) print(res) # Define a sequence as a DNA Seq object seq = Seq("CCTCAGCGAGGACAGCAAGGGACTAGCC") # The complement() method can act just like your complement() function. complement = seq.complement() # Similarly, we can use the reverse_complement() method. reverse_complement = seq.reverse_complement() # We can even use the transcribe() method to switch alphabets to RNA RNA = seq.transcribe() print(RNA)
#Sanity test on the test sequence alphabets (see also enhancement bug 2597) for nucleotide_seq in test_seqs : if hasattr(nucleotide_seq, "alphabet") : if "U" in str(nucleotide_seq).upper() : assert not isinstance(nucleotide_seq.alphabet, Alphabet.DNAAlphabet) if "T" in str(nucleotide_seq).upper() : assert not isinstance(nucleotide_seq.alphabet, Alphabet.RNAAlphabet) print print "Transcribe DNA into RNA" print "=======================" for nucleotide_seq in test_seqs: try : expected = Seq.transcribe(nucleotide_seq) assert str(nucleotide_seq).replace("t","u").replace("T","U") == str(expected) print "%s -> %s" \ % (repr(nucleotide_seq) , repr(expected)) except ValueError, e : expected = None print "%s -> %s" \ % (repr(nucleotide_seq) , str(e)) #Now test the Seq object's method if isinstance(nucleotide_seq, Seq.Seq) : try : assert repr(expected) == repr(nucleotide_seq.transcribe()) except ValueError : assert expected is None for s in protein_seqs :
print("Stop found:", seqs[temp_window:temp_window + 3]) temp_result.append( temp_window + 3) # Stores stop codon index in list with start codon. break temp_window += 3 # Iterates by 3, codon size. # print(temp_result) # print(seqs[temp_result[0]: temp_result[1]]) # result_seqs.append(seqs[temp_result[0]: temp_result[1]]) # Adds protein to list from stored index locations, only if a stop codon is present at the end e.g. # a stop codon was found before the end of the sequence. try: dna = seqs[temp_result[0]:temp_result[1]] rna = Seq.transcribe(dna) protein = Seq.translate(rna, stop_symbol="") print(protein) if protein not in result_seqs: # Stops the addition of duplicate peptides result_seqs.append(protein) except IndexError: pass window += 1 print(result_seqs) # Writes sequences to file. file = open("result_peptides.txt", "w")
def transcription(seqData): dnaSeq = Seq(seqData[::-1]) return dnaSeq.transcribe() #manipulateSeqFromFile("data/dna_chromosome_1.seq")
def test_seq_object_transcription_method(self): for nucleotide_seq in test_seqs: if isinstance(nucleotide_seq.alphabet, Alphabet.DNAAlphabet) and \ isinstance(nucleotide_seq, Seq.Seq): self.assertEqual(repr(Seq.transcribe(nucleotide_seq)), repr(nucleotide_seq.transcribe()))
def test_transcription_dna_string_into_rna(self): seq = "ATGAAACTG" self.assertEqual("AUGAAACUG", Seq.transcribe(seq))
def test_transcription_dna_into_rna(self): for nucleotide_seq in test_seqs: if isinstance(nucleotide_seq.alphabet, Alphabet.DNAAlphabet): expected = Seq.transcribe(nucleotide_seq) self.assertEqual(str(nucleotide_seq).replace("t", "u").replace("T", "U"), str(expected))