from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 7 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE}|-----") IP = "192.168.8.212" PORT = 12000 PORT_2 = 12001 c = Client(IP, PORT) c_2 = Client(IP, PORT_2) s = Seq() s.seq_read_fasta("../P0/Sequences/FRAT1.txt") count = 0 i = 0 while i < len(s.strbases) and count < 5: fragment = s.strbases[i:i + 10] count += 1 i += 10 print("Fragment", count, ":", fragment) if count % 2 == 0: print(c_2.talk("Fragment" + str(count) + ": " + fragment)) else: print(c.talk("Fragment" + str(count) + ": " + fragment))
from Client0 import Client from Seq1 import Seq IP = "127.0.0.1" PORT = 8080 FOLDER = "../Session-04/" GENE = "U5" c = Client(IP, PORT) print(c) s = Seq("").read_fasta(FOLDER + GENE) c.debug_talk(f"Sending {GENE} gene to the server") c.debug_talk(str(s))
from Client0 import Client from pathlib import Path PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to PORT = 20000 IP = "127.0.0.1" # -- Create a client object c = Client(IP, PORT) print(c.talk("Sending the U5 Gene to the server...")) print(c.talk(Path("U5.txt").read_text()))
from Client0 import Client # cd P2 <<enter>> python Ex2.py # for printing in the terminal PRACTICE = 2 EXERCISE = 1 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE}|-----") # IP always a string, Port always integer IP = "192.168.8.212" PORT = 12000 # IP always a string, Port always integer c = Client(IP, PORT) c.advanced_ping() c.ping() print(f"IP: {c.ip}, {c.port}")
from Client0 import Client from termcolor import colored PORT = 8081 IP = "212.128.253.169" s = Client(IP, PORT) for i in range(5): print('To Server:', colored(f'Message {i+1}', 'blue')) print(f'From Server:', s.debug_talk(colored(f'Message {i+1}', 'green')))
from Client0 import Client SESSION = 10 EXERCISE = 2 print(f"-----| SESSION {SESSION}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.42" PORT = 8080 # -- Create a client object c = Client(IP, PORT) print(c) # -- Send a message to the server print("Sending a message to the server...") response1 = c.talk("Test1...") print(f"ECHO: {response1}") print("Sending a message to the server...") response2 = c.talk("Test2...") print(f"ECHO: {response2}") print("Sending a message to the server...") response3 = c.talk("Test3...") print(f"ECHO: {response3}") print("Sending a message to the server...") response4 = c.talk("Test4...") print(f"ECHO: {response4}")
from Client0 import Client print("---|PRACTICE 2: EXERCISE 2|---") IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) print(str(c))
from Client0 import Client IP = "127.0.0.1" PORT = 10000 c = Client(IP, PORT) print(c) print() c.debug_talk("Message 1---") print() c.debug_talk("Message 2: Testing!!!")
from Client0 import Client PRACTICE = 2 EXERCISE = 4 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "212.128.253.142" PORT = 8080 c = Client(IP, PORT) #unir ip y port print(c) c.debug_talk("Message 1---") c.debug_talk("Message 2: Testing !!!")
from Client0 import Client from Seq1 import Seq IP = "127.0.0.1" PORT = 8080 PORT2= 8081 FOLDER = "../Session-04/" EXT = ".txt" GENE = "FRAT1" c = Client(IP, PORT) c1= Client(IP, PORT2) print(c) s = Seq().read_fasta(FOLDER + GENE + EXT) b = str(s) print(f"Gene {GENE}: {b}") length=10 c.talk(f"Sending {GENE} Gene to the server..., in fragments of {length}") c1.talk(f"Sending {GENE} Gene to the server..., in fragments of {length}") for i in range(10): fragm = b[i*length: (i+1)*length] print(f"Fragment {i+1}: {fragm}") message= (f"Fragment {i+1}: {fragm}") if i % 2: c1.talk(message)
from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "192.168.1.105" PORT = 8080 clnt = Client(IP, PORT) print(clnt) # -- Send a message to the server print("Sending a message to the server...") response = clnt.talk("Hi there!") print(f"Response: {response}")
from Client0 import Client print(f"-----| Practice 2, Exercise 2 |------") # -- Parameters of the server to talk to ip = "127.0.0.1" port = 8080 # -- Create a client object create_client = Client(ip, port) print(create_client)
from Client0 import Client ip = "192.168.1.45" port = 8080 c = Client(ip, port) for i in range(5): c.debug_talk(f"Message {i}")
from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 8083 # -- Create a client object c = Client(IP, PORT) response = c.talk("Message for u <3") print("Response:", response)
from Client0 import Client PRACTICE = 3 EXERCISE = 7 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "127.0.0.1" PORT = 8080 # -- Cofigure the client c = Client(IP, PORT) print(c) # -- Test 1: Ping print("* Testing PING...") print(c.talk("PING")) # -- Test 2: Get print("* Testing GET...") for i in range(5): cmd = f"GET {i}" print(f"{cmd}: {c.talk(cmd)}", end="") # -- Test 3: INFO # -- Get the sequence 0 for testing seq = c.talk("GET 0") print() print("* Testing INFO...") cmd = f"INFO {seq}"
# -- Write a python program that takes 5 fragments of 10 bases each from the FRAT1 gene # -- and sends them to the server. # -- Use the talk method. Print the fragments on the Client console for checking from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.42" PORT = 8080 c = Client(IP, PORT) print(c) s = Seq() s.read_fasta("../SESSION-04/FRAT1.txt") s1 = str(s) message = "Sending FRAT1 Gene to the server, in fragments of 10 bases..." F1 = "" F2 = "" F3 = "" F4 = "" F5 = "" for index in range(0, 50): if 0 <= index < 10: F1 = F1 + s1[index] elif 10 <= index < 20:
from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "212.128.253.129" PORT = 8099 c = Client(IP, PORT) FOLDER = "../Session-04/" txt = ".txt" gene = "FRAT1" file_name = FOLDER + gene + txt s0 = Seq('') s0 = str(s0.read_fasta(file_name)) len0 = 10 num_frag = 5 print(f"Gene {gene}: {s0}") fragments = [] for e in range(num_frag): print(f"fragment {e+1}: {s0[len0*e:len0*(e+1)]}") fragments.append(s0[len0 * e:len0 * (e + 1)]) c.talk(fragments[0]) c.talk(fragments[1]) c.talk(fragments[2]) c.talk(fragments[3]) c.talk(fragments[4])
from Client0 import Client from termcolor import colored from pathlib import Path PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.213" PORT = 8080 # -- Create a client object c = Client(IP, PORT) #Reading text FILENAME = "U5.txt" file_contents = Path(FILENAME).read_text() lines = file_contents.split("\n") body = lines[1:] bodystr = " " bodystr = bodystr.join(body) # -- Send a message to the server print("Sending a message to the server...") response1 = "Sending gene U5" response2 = bodystr response_list = [response1, response2] for i in response_list: print("To server: ", colored(response1, "green"), "\n", "From server: ", c.debug_talk(i))
from Client0 import Client from P1.Seq1 import Seq PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") FOLDER = "../Session-04/" Filename = "FRAT1" TypeDoc = '.txt' IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) seq = Seq().read_fasta(FOLDER + Filename + TypeDoc) bases = str(seq) print('Gene ', Filename, ':', seq) c.talk(f"Sending {Filename} Gene to the server, in fragments of 10 bases") for i in range(5): fragment = (bases[i * 10:(i + 1) * 10]) print(f"Fragment {i+1}: {fragment}") c.talk(f"Fragment {i+1}: {fragment}")
import server_utils PRACTICE = 3 EXERCISE = 7 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") list_sequences = [ "ACGTAAAAGTTTAAGCGCCAAT", "AGTCCCCCCAAAATTTTGGGGGAATAT", "AGAGAGAGGATTATTATATACTCTTC", "GGGGGGGGGGGTTTTTTTTTAAAAAACCCC", "AAAAAATTTTTCGAAAAAAA" ] list_genes = ["U5", "ADA", "FRAT1", "FXN", "RNU6_269P"] IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) print("*Testing PING...") print(c.talk("OK!")) print("*Testing GET...") for elem in range(0, len(list_sequences)): response = c.talk("GET " + str(elem)) print(f"{response}") print("*Testing INFO...") for elem in range(0, len(list_sequences)): response = c.talk("INFO " + str(elem)) print(f"{response}")
from Client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "212.128.253.1" PORT = 8080 # -- Create a client object c = Client(IP, PORT) # -- Testing the talk function: print("Sending a message to the server...") response = c.talk("Testing!!!") print(f"Response: {response}")
from Client0 import Client PRACTICE = 2 EXERCISE = 4 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "192.168.1.40" PORT = 8080 c = Client(IP, PORT) #merges ip and port as c # -- message to and from the server c.debug_talk("Message 1---") c.debug_talk("Message 2: Testing !!!")
from Client0 import Client from Seq1 import Seq # -- Parameters of the server to talk to ip = "127.0.0.1" port = 8080 file = "../DNA Files/" extension = ".txt" dna = 'U5' # -- Create a client object c = Client(ip, port) # -- Print the IP and PORTs print(c) # -- Read the Gene from a file s = Seq().read_fasta(file + dna + extension) # -- Send the Gene c.debug_talk(f"Sending {dna} Gene to the server...") c.debug_talk(str(s))
from Client0 import Client print("-----| Practice 3 |------") list_of_genes = ["U5", "ADA", "FRAT1", "FXN", "RNU6_269P" ] IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) t = "" print("*Testing PING...") print(c.talk("PING")) print("*Testing GET...") print("*Testing INFO...") print(c.talk("INFO ATCCGTA")) print("*Testing COMP...") print(c.talk("COMP ACCTCCTCTCCAGCAATGCCAACCCCAGTCCAGGCCCCCATCCGCCCAGGATCTCGATCA")) print("*Testing REV...") print(c.talk("REV ACCTCCTCTCCAGCAATGCCAACCCCAGTCCAGGCCCCCATCCGCCCAGGATCTCGATCA")) print("*Testing GENE...") for e in list_of_genes: print(c.talk("GENE "+ e))
from P1.Seq1 import Seq from Client0 import Client PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 8081 c = Client(IP, PORT) s = Seq() s.read_fasta('../P2/FRAT1.txt') count = 0 i = 0 while i < len(s.strbases) and count < 5: fragment = s.strbases[i:i + 10] count += 1 i += 10 print(c.talk(fragment))
from Client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) s = Seq() s.read_fasta("../P0/Sequences/U5.txt") print(c) c.debug_talk("Sending the U5 Gene to the server...") c.debug_talk(s)
from Client0 import Client IP = "192.168.1.149" PORT = 8080 c = Client(IP, PORT) for a in range(5): c.debug_talk(f"Message {a}")
from Client0 import Client PRACTICE = 2 EXERCISE = 2 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") IP = "192.168.56.1" PORT = 8080 c = Client(IP, PORT) c.__str__()
from Client0 import Client PRACTICE = 2 EXERCISE = 1 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.45" PORT = 8080 # -- Create a client object c = Client(IP, PORT) # -- Test the ping method c.ping() # -- Print the IP and PORTs print(f"IP: {c.ip}, {c.port}")
from Client0 import Client from Seq2 import Seq print("---|PRACTICE 2: EXERCISE 6|---") IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) s = Seq() s.seq_read_fasta("./Sequences/FRAT1.txt") count = 0 i = 0 while i < len(s.strbases) and count < 5: fragment = s.strbases[i:i + 10] count += 1 i += 10 print("Fragment", count, ":", fragment) c.debug_talk(fragment)