def test_init(self): '''__init__ should do the expected with a cigar string''' with self.assertRaises(cigar.Error): cigar.Cigar("5M2") with self.assertRaises(cigar.Error): cigar.Cigar("H5M2X") test_cig = '5S2M3I1M1D4H' self.assertEqual(test_cig, str(cigar.Cigar(test_cig)))
def acquire_clip_pos(deal_cigar): seq = list(cigar.Cigar(deal_cigar).items()) if seq[0][1] == 'S': first_pos = seq[0][0] else: first_pos = 0 if seq[-1][1] == 'S': last_pos = seq[-1][0] else: last_pos = 0 # seq = cigar.split('S') # if len(seq) == 3: # first_pos = int(seq[0]) # last_pos = int(seq[1].split('M')[-1]) # return [first_pos, last_pos] # if len(seq) == 1: # return [] # if len(seq) == 2: # if seq[1] == '': # return [] # first_pos = int(seq[0]) # last_pos = 0 bias = 0 for i in seq: if i[1] == 'M' or i[1] == 'D': bias += i[0] return [first_pos, last_pos, bias]
def acquire_clip_pos(deal_cigar): ''' resolution of cigar in supplementary mapping ''' seq = list(cigar.Cigar(deal_cigar).items()) first_pos = seq[0][0] if seq[0][1] == 'S' else 0 last_pos = seq[-1][0] if seq[-1][1] == 'S' else 0 bias = 0 for i in seq: if i[1] in ['M', 'D']: bias += i[0] return [first_pos, last_pos, bias]
def analysis_cigar(deal_cigar, ins_l): seq = list(cigar.Cigar(deal_cigar).items()) SoftClip_len = 0 if seq[0][1] == 'S': SoftClip_len += seq[0][0] if seq[-1][1] == 'S': SoftClip_len += seq[-1][0] if SoftClip_len * 4 > ins_l: return 0 else: return 1
def acquire_clip_pos(deal_cigar): seq = list(cigar.Cigar(deal_cigar).items()) if seq[0][1] == 'S': first_pos = seq[0][0] else: first_pos = 0 if seq[-1][1] == 'S': last_pos = seq[-1][0] else: last_pos = 0 bias = 0 for i in seq: if i[1] == 'M' or i[1] == 'D': bias += i[0] return [first_pos, last_pos, bias]
def test_get_differences_from_ref(self): '''check test_get_differences_from_ref finds the correct differences''' ref = fastn.Fasta('ID', 'ACGTACGTACGT') c = cigar.Cigar("12M") pairs_to_check = [(cigar.Cigar("12M"), 'ACGTACGTACGT'), (cigar.Cigar("12M"), 'AGGTACGTACGT'), (cigar.Cigar("1S12M"), 'AAGGTACGTACGT'), (cigar.Cigar("1S12M1S"), 'AAGGTACGTACGTA'), (cigar.Cigar("1M1I10M"), 'AiCGTACGTACGT'), (cigar.Cigar("3M1I3M1D3M"), 'AGGiTACTACGT'), (cigar.Cigar("2S3M1I3M1D3M5S"), 'ssAGGiTACTACGTsssss')] correct_answers = [[], [(1, 'S', 'C/G', 1)], [(1, 'S', 'C/G', 1)], [(1, 'S', 'C/G', 1)], [(1, 'I', 'i', 1)], [(1, 'S', 'C/G', 1), (3, 'I', 'i', 1), (6, 'D', 'G', 1)], [(1, 'S', 'C/G', 1), (3, 'I', 'i', 1), (6, 'D', 'G', 1)]] for i in range(len(pairs_to_check)): self.assertListEqual(pairs_to_check[i][0].get_differences_from_ref(pairs_to_check[i][1], ref), correct_answers[i])
def __init__(self, line): # example line: # HS4_6280:2:1104:12102:124607 99 PyYM_01_v1 1 47 2S73M = 362 438 TGTTAAAAATATCATTTATATAATATAATTAAAATTATTTATTTTTAGATATTATAATATTATGAATAATAGTAT HHHHHHHHHHHHHHHHHHGHHHHHHHHHHHGFHHHHHHHEHHHHHHHFCHFHHHHGFHCHHFHFAFFEFECF@BF AS:i:73 try: (self.id, self.flag, self.rname, self.pos, self.mapq, self.cigar, self.mrname, self.mpos, self.isize, self.seq, self.qual, *self.tags_list) = line.rstrip().split('\t') self.pos = int(self.pos) - 1 self.flag = int(self.flag) self.mapq = int(self.mapq) self.cigar = cigar.Cigar(self.cigar) self.mpos = int(self.mpos) - 1 self.isize = int(self.isize) self.tags = {} for tag in self.tags_list: (tag, type, value) = tag.split(':', 2) if type == 'i': value = int(value) self.tags[tag] = (type, value) except: raise Error('Error reading this sam line:\n' + line)
def clip_analysis(deal_cigar, clipping_threshold): seq = list(cigar.Cigar(deal_cigar).items()) if seq[0][1] == 'S': first_pos = seq[0][0] else: first_pos = 0 if seq[-1][1] == 'S': last_pos = seq[-1][0] else: last_pos = 0 total_len = first_pos + last_pos signal_len = 0 for i in seq: signal_len += i[0] if signal_len == 0: return 0 if total_len * 1.0 / signal_len >= clipping_threshold: return 0 else: return 1
def pysam_cigar(x): _convertcigar = dict(zip(['M', 'I', 'D', 'N', 'S', 'H'], range(6))) as_list = list(cr.Cigar(x).items()) rev_list = [tuple((i[1], i[0])) for i in as_list] pysam_ready = [tuple((_convertcigar[i[0]], i[1])) for i in rev_list] return (pysam_ready)
def extract_vcf_records( sample_name, # input paths alignments_path, contigs_path, ref_fasta_path, vcf_template_path, # output paths vcf_out_path, selected_contigs_path, flanked_contigs_path, flank_length, min_insert_size): n_records = 0 ref_fasta = pysam.FastaFile(ref_fasta_path) contig_fasta = pysam.FastaFile(contigs_path) selected_contig_fasta = open(selected_contigs_path, "w") flanked_contig_fasta = open(flanked_contigs_path, "w") alns = pandas.read_csv(alignments_path, sep=" ") reader = vcfpy.Reader.from_path(vcf_template_path) reader.header.samples = vcfpy.SamplesInfos([sample_name]) writer = vcfpy.Writer.from_path(vcf_out_path, reader.header) contig_loci = set() # parse each alignment and look for insertions above min_insert_size for r in alns.iterrows(): # skip secondary alignments hit = r[1]["Hit"] if hit > 0: continue query_name = r[1]["QName"] # local alignment window in the reference ref_chrom, ref_start, ref_end, phase_set, phase, n = query_name.split( "_") phase_set = phase_set[2:] phase = phase[2:] # convert to ints ref_start, ref_end = (int(ref_start), int(ref_end)) # alignment start and end for reference sequence target_start = r[1]["TStart"] target_end = r[1]["TEnd"] # alignment start and end for query sequence query_start = r[1]["QStart"] query_end = r[1]["QEnd"] # strand-ness of the query sequence strand = r[1]["Strand"] # parse cigar for variant extraction cig = cigar.Cigar(r[1]["CIGAR"]) ops = list(cig.items()) # convert sequences to the positive strand query_seq = contig_fasta.fetch(query_name) if strand == "-": query_seq = str(Bio.Seq.Seq(query_seq).reverse_complement()) ref_seq = ref_fasta.fetch(ref_chrom, ref_start, ref_end) # initialize iterators for the cigar string query_pos = query_start target_pos = target_start # we are looking to extract insertions larger than 50bp for op in ops: # skip matches if op[1] == 'M': query_pos += op[0] target_pos += op[0] # skip deletions in the query sequence elif op[1] == 'D': target_pos += op[0] # insertions in the query sequence elif op[1] == 'I': # only interested in large insertions if op[0] > min_insert_size: # Generate pysam.VariantRecord # need to check conversion from 0-based coordinates to 1-based ref_allele = ref_seq[target_pos] alt_allele = ref_allele + query_seq[query_pos:query_pos + op[0]] gt = "" if phase == "1": gt = "1|0" elif phase == "2": gt = "0|1" else: gt = "0/1" break_point = ref_start + target_pos # output VCF record corresponding to the insertion rec = vcfpy.Record( CHROM=ref_chrom, POS=break_point + 1, ID=[query_name], REF=ref_allele, ALT=[vcfpy.Substitution("INS", alt_allele)], QUAL=999, FILTER=["PASS"], INFO={}, FORMAT=[ "GT", "SVLEN", "PS", "HP", "CIGAR", "STRAND", "CONTIG_START" ], calls=[ vcfpy.Call(sample=sample_name, data=vcfpy.OrderedDict( GT=gt, SVLEN=op[0], PS=phase_set, HP=phase, CIGAR=str(cig), STRAND=strand, CONTIG_START=str(query_start))) ]) n_records += 1 # output contig that contains this insertion writer.write_record(rec) contig_locus = ">" + query_name + "_" + sample_name contig_hash = sha1("_{chrom}_{pos}_{alt}".format( chrom=ref_chrom, pos=ref_start, alt=alt_allele[1:]).encode()).hexdigest() contig_name = contig_locus + "_" + contig_hash + "_" + str( op[0]) if contig_locus not in contig_loci: selected_contig_fasta.writelines( [contig_name + "\n", query_seq + "\n"]) contig_loci.add(contig_locus) # output same insertion, but with flanking sequences # note, the interval is [start, end[ if flank_length > 0: left_flank = ref_fasta.fetch( ref_chrom, break_point - flank_length, break_point) right_flank = ref_fasta.fetch( ref_chrom, break_point, break_point + flank_length) else: left_flank = "" right_flank = "" flanked_contig_fasta.writelines([ contig_name + "\n", left_flank + alt_allele[1:] + right_flank + "\n" ]) query_pos += op[0] selected_contig_fasta.close() return n_records
def get_seq(sam, ref, ret_pos=False, from_line=False, correct=False, find_ref=True): ret = ["", 0, None, None] maxlen = 0 if from_line: op = io.StringIO(sam) else: op = open(sam, 'r') with op as f: s = f.readline() # read the 1st line while s != '': ss = s.split() if len(ss) < 5: s = f.readline() continue if ss[0] != '@SQ' and ss[0] != '@PG': if ss[1] == '0' or ss[ 1] == '16': # take only main alignment (not chimeric) Bit = ss[1] Chrom = ss[2] if ss[1] == '0': pos = max(int(ss[3]) - 1, 0) else: pos = max(int(ss[3]) - 1, 0) CIGAR = ss[5] # SamSeq = ss[9] # print ss[0] # print Q # print(Chrom, pos, Bit, LenghtOnRef(CIGAR), ref) Len = len(cigar.Cigar(CIGAR)) offset_start = 0 offset_end = 0 if correct: offset_start = CIGAR.split("S")[0] try: offset_start = int(offset_start) except: offset_start = 0 # print(offset_start) offset_end = re.split('[a-zA-Z]', CIGAR)[-2] try: offset_end = int(offset_end) except: offset_end = 0 if Len < maxlen: continue if find_ref: Seq = SeqInRef(Chrom, pos - offset_start, Bit, LenghtOnRef(CIGAR) + offset_end, ref) else: Seq = "NotLookedFor" # print("Inside", Seq) if ss[2] == '*' or "chr" not in ss[2]: Chrom = None else: try: Chrom = int(ss[2][3:]) + 0 except: Chrom = ss[2][3:] ret = [Seq + "", 1, Chrom, pos + 0] maxlen = max(len(Seq), maxlen) else: break s = f.readline() if ret_pos: return ret else: return ret[:2]
def extract_consensus_insertions(contig_path, cons_path, ref_fasta_path, vcf_out_path, vcf_template_path, min_insertion_size, flank_length, flanked_contigs_path): n_records = 0 # open input sequences cons_fasta = pysam.FastaFile(cons_path) ref_fasta = pysam.FastaFile(ref_fasta_path) flanked_contig_fasta = open(flanked_contigs_path, "w") (samples, loci) = collect_genotypes(contig_path) print("Found", len(samples), "samples for", len(loci), "phased loci") reader = vcfpy.Reader.from_path(vcf_template_path) reader.header.samples = vcfpy.SamplesInfos(list(samples)) writer = vcfpy.Writer.from_path(vcf_out_path, reader.header) for contig in cons_fasta.references: # parse coordinates (chrom, start, end) = contig.split("_") (start, end) = int(start), int(end) cons_seq = cons_fasta.fetch(contig) ref_seq = ref_fasta.fetch(chrom, start, end) aligner = mappy.Aligner(seq = ref_seq, preset = None , k = 15, w = 10, n_threads = 1, max_join_long = 20000, max_join_short = 10000, min_join_flank_sc = 10, min_join_flank_ratio = 0.1, max_gap = 10000, bw = 2000, end_bonus = 10, zdrop = 10000, zdrop_inv = 1000, scoring = (2, 4, 4, 10, 300, 0, 1), extra_flags = 0x1) alignments = list(aligner.map(cons_seq, seq2 = None, cs = True, MD = False)) if len(alignments) == 0: print("No hits in", contig) continue aln = max(alignments, key = lambda x: x.blen) cig = cigar.Cigar(aln.cigar_str) ops = list(cig.items()) cons_pos = aln.q_st target_pos = aln.r_st strand = "+" if aln.strand == -1: cons_seq = str(Bio.Seq.Seq(cons_seq).reverse_complement()) strand = "-" # print(contig) for op in ops: # skip matches if op[1] == 'M': cons_pos += op[0] target_pos += op[0] # skip deletions in the query sequence elif op[1] == 'D': target_pos += op[0] # insertions in the query sequence elif op[1] == 'I': # only interested in large insertions if op[0] > min_insertion_size: # Generate pysam.VariantRecord # need to check conversion from 0-based coordinates to 1-based ref_allele = ref_seq[target_pos-1] alt_allele = cons_seq[cons_pos:cons_pos + op[0]] break_point = start + target_pos # output VCF record corresponding to the insertion # print(break_point, (start + end) / 2 ) # print(len(loci[contig]), "samples at", contig) # build calls data structure calls = [] for sample in samples: sample_gt = "0/0" ps = 0 if sample in loci[contig]: sample_gt = loci[contig][sample]["1"] + "|" + loci[contig][sample]["2"] ps = loci[contig][sample]["ps"] sample_call = vcfpy.Call(sample = sample, data = vcfpy.OrderedDict(GT = sample_gt, PS = ps)) # print(sample_call) calls.append(sample_call) rec = vcfpy.Record(CHROM = chrom, POS = break_point, ID = [contig + "_" + str(cons_pos)], REF = ref_allele, ALT = [vcfpy.Substitution("INS", ref_allele + alt_allele)], QUAL = 999, FILTER = ["PASS"], INFO = vcfpy.OrderedDict(SVLEN = op[0], CIGAR = [str(cig)], STRAND = strand, CONTIG_START = str(aln.q_st)), FORMAT = ["GT", "PS"], calls = calls) # output contig that contains this insertion writer.write_record(rec) # output same insertion, but with flanking sequences # note, the interval is [start, end[ if flank_length > 0: left_flank = ref_fasta.fetch(chrom, break_point - flank_length, break_point) right_flank = ref_fasta.fetch(chrom, break_point, break_point + flank_length) else: left_flank = "" right_flank = "" flanked_contig_fasta.writelines([ ">" + contig + "_" + str(cons_pos) + "\n", left_flank + alt_allele[1:] + right_flank + "\n"]) # output same contig, but with large flanking sequences # note, the interval is [start, end[ n_records += 1 cons_pos += op[0] flanked_contig_fasta.close() return n_records
def test_soft_clipped_bases(self): '''Check that sort_clipped_bases() counts the right number of bases''' self.assertEqual(cigar.Cigar("10M").soft_clipped_bases(), 0) self.assertEqual(cigar.Cigar("1S10M").soft_clipped_bases(), 1) self.assertEqual(cigar.Cigar("10M2S").soft_clipped_bases(), 2) self.assertEqual(cigar.Cigar("2S10M3S").soft_clipped_bases(), 5)
def test_reverse(self): '''Test that reverse works as expected''' c = cigar.Cigar('1S10M1I5M2S') c.reverse() self.assertEqual(str(c), '2S5M1I10M1S')
def test_read_hit_length(self): '''Check that read_hit_length() returns the right number''' self.assertEqual(cigar.Cigar("10M").read_hit_length(), 10) self.assertEqual(cigar.Cigar("1S9M").read_hit_length(), 9) self.assertEqual(cigar.Cigar("1S7M1I1M").read_hit_length(), 9) self.assertEqual(cigar.Cigar("1S7M1D1M").read_hit_length(), 8)