def test1(self):
"""
Test 1.
"""
result = describe_dna('ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert str(result) == '[5_6insTT;17del;26A>C;35dup]'
def _filter(variants, ref_seq1, ref_seq2):
raw_de_variants = extractor.describe_dna(ref_seq1, ref_seq2)
seq_variants = de_to_hgvs(
raw_de_variants,
{"reference": ref_seq1, "observed": ref_seq2},
)
return [v for v in variants if v not in seq_variants]
def test2(self):
"""
Test 2.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTACTGTG',
'TAAGCACCAGGAGTCCATGAAGAAGCTGGATCCTCCCATGGAATCCCCTACTCTACTGTG')
assert str(result) == '[26A>C;30C>A;35G>C]'
def test4(self):
"""
Test 4.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGAATCCCCTACTCTA')
assert str(result) == '[26_29inv;30C>G;41del]'
def test2(self):
"""
Test 2.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTACTGTG',
'TAAGCACCAGGAGTCCATGAAGAAGCTGGATCCTCCCATGGAATCCCCTACTCTACTGTG')
assert str(result) == '[26A>C;30C>A;35G>C]'
def _extract_hgvs_internal_model(obs_seq, r_model):
ref_seq = r_model["sequence"]["seq"]
de_variants = extractor.describe_dna(ref_seq, obs_seq)
return de_to_hgvs(
de_variants,
{"reference": ref_seq, "observed": obs_seq},
)
def test1(self):
"""
Test 1.
"""
result = describe_dna(
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert str(result) == '[5_6insTT;17del;26A>C;35dup]'
def test4(self):
"""
Test 4.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGAATCCCCTACTCTA')
assert str(result) == '[26_29inv;30C>G;41del]'
def _extract(self):
self.de_model = {
"reference":
copy.deepcopy(self.internal_indexing_model["reference"]),
"coordinate_system":
"i",
"variants":
describe_dna(
self.references["reference"]["sequence"]["seq"],
self.references["observed"]["sequence"]["seq"],
),
}
def description_extractor(reference, observed):
de_variants = extractor.describe_dna(reference, observed)
de_hgvs_variants = de_to_hgvs(de_variants, {
"reference": reference,
"observed": observed
})
hgvs_indexing_variants = variants_to_internal_indexing(de_hgvs_variants)
crossmap = crossmap_to_hgvs_setup("g")
hgvs_variants = locations_to_hgvs_locations(
{"variants": hgvs_indexing_variants}, crossmap)
normalized_description = variants_to_description(hgvs_variants["variants"])
return normalized_description
def map_description(
description,
reference_id,
selector_id=None,
slice_to=None,
clean=False,
):
# Get the observed sequence
d = Description(description)
d.normalize()
if d.errors:
return {"errors": d.errors}
if not d.references and not d.references.get("observed"):
return {"errors": [{"details": "No observed sequence or other error occured."}]}
obs_seq = d.references["observed"]["sequence"]["seq"]
r_model = retrieve_reference(reference_id)
if r_model is None:
return {"errors": [reference_not_retrieved(reference_id, [])]}
ref_seq2 = d.references["reference"]["sequence"]["seq"]
if selector_id:
s_model = get_selector_model(r_model["annotations"], selector_id, True)
if s_model is None:
return {"errors": [no_selector_found(reference_id, selector_id, [])]}
if s_model["inverted"]:
obs_seq = reverse_complement(obs_seq)
ref_seq2 = reverse_complement(ref_seq2)
if slice_to:
r_model = _get_reference_model(r_model, selector_id, slice_to)
ref_seq1 = r_model["sequence"]["seq"]
# Get the description extractor hgvs internal indexing variants
variants = _extract_hgvs_internal_model(obs_seq, r_model)
if clean:
raw_de_variants = extractor.describe_dna(ref_seq1, ref_seq2)
seq_variants = de_to_hgvs(
raw_de_variants,
{"reference": ref_seq1, "observed": ref_seq2},
)
if [v for v in seq_variants if v not in variants]:
return {
"errors": [{"code": "EMAPFILTER", "details": "Unsuccessful filtering."}]
}
variants = [v for v in variants if v not in seq_variants]
return _get_description(variants, r_model, selector_id)
def _single_variant(self, sample, expected):
"""
General single variant test.
"""
reference = 'ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT'
result = describe_dna(reference, sample)
assert result[0].type == expected[0]
assert result[0].start == expected[1]
assert result[0].end == expected[2]
assert result[0].sample_start == expected[3]
assert result[0].sample_end == expected[4]
assert result[0].deleted[0].sequence == expected[5]
assert result[0].inserted[0].sequence == expected[6]
assert str(result[0]) == expected[7]
def _single_variant(self, sample, expected):
"""
General single variant test.
"""
reference = 'ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT'
result = describe_dna(reference, sample)
assert result[0].type == expected[0]
assert result[0].start == expected[1]
assert result[0].end == expected[2]
assert result[0].sample_start == expected[3]
assert result[0].sample_end == expected[4]
assert result[0].deleted[0].sequence == expected[5]
assert result[0].inserted[0].sequence == expected[6]
assert str(result[0]) == expected[7]
def description_extractor_submit():
"""
The Variant Description Extractor (experimental service).
There multiple ways for the user to provide two sequences, corresponding to
the values for the `reference_method` and `sample_method` fields, each
requiring some additional fields to be defined:
`raw_method`
The reference and sample sequences are pasted into the form fields.
- `reference_sequence`: The reference sequence.
- `sample_sequence`: The sample sequence.
`file_method`
The reference and sample sequences are uploaded.
- `reference_file`: The reference file.
- `sample_file`: The sample file.
`refseq_method`
The reference and sample sequences are given by RefSeq accession numbers.
- `reference_accession_number`: RefSeq accession number for the reference
sequence.
- `sample_accession_number`: RefSeq accession number for the sample
sequence.
"""
output = Output(__file__)
output.addMessage(__file__, -1, 'INFO',
'Received Description Extract request from %s'
% request.remote_addr)
stats.increment_counter('description-extractor/website')
r = s = ''
reference_method = request.form.get('reference_method')
sample_method = request.form.get('sample_method')
reference_sequence = request.form.get('reference_sequence')
sample_sequence = request.form.get('sample_sequence')
reference_file = request.files.get('reference_file')
sample_file = request.files.get('sample_file')
reference_filename = ''
sample_filename = ''
reference_accession_number = request.form.get('reference_accession_number')
sample_accession_number = request.form.get('sample_accession_number')
if reference_method == 'refseq_method':
if reference_accession_number:
retriever = Retriever.GenBankRetriever(output)
genbank_record = retriever.loadrecord(reference_accession_number)
if genbank_record:
r = unicode(genbank_record.seq)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Reference accession number input fields is empty.')
elif reference_method == 'file_method':
if reference_file:
reference_filename = reference_file.filename
r = util.read_dna(reference_file)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'No reference file provided.')
else: # raw_method
if reference_sequence:
r = util.read_dna(StringIO.StringIO(reference_sequence))
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Reference sequence number input fields is empty.')
if sample_method == 'refseq_method':
if sample_accession_number:
retriever = Retriever.GenBankRetriever(output)
genbank_record = retriever.loadrecord(sample_accession_number)
if genbank_record:
s = unicode(genbank_record.seq)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Sample accession number input fields is empty.')
elif sample_method == 'file_method':
if sample_file:
sample_filename = sample_file.filename
s = util.read_dna(sample_file)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'No sample file provided.')
else: # raw_method
if sample_sequence:
s = util.read_dna(StringIO.StringIO(sample_sequence))
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Sample sequence number input fields is empty.')
# Todo: Move this to the describe module.
if not r or not util.is_dna(r):
output.addMessage(__file__, 3, 'ENODNA',
'Reference sequence is not DNA.')
if not s or not util.is_dna(s):
output.addMessage(__file__, 3, 'ENODNA',
'Sample sequence is not DNA.')
raw_vars = None
if r and s:
if (len(r) > settings.EXTRACTOR_MAX_INPUT_LENGTH or
len(s) > settings.EXTRACTOR_MAX_INPUT_LENGTH):
output.addMessage(__file__, 3, 'EMAXSIZE',
'Input sequences are restricted to {:,} bp.'
.format(settings.EXTRACTOR_MAX_INPUT_LENGTH))
else:
raw_vars = extractor.describe_dna(r, s)
errors, warnings, summary = output.Summary()
messages = map(util.message_info, output.getMessages())
output.addMessage(__file__, -1, 'INFO',
'Finished Description Extract request')
return render_template('description-extractor.html',
extractor_max_input_length=settings.EXTRACTOR_MAX_INPUT_LENGTH,
reference_sequence=reference_sequence or '',
sample_sequence=sample_sequence or '',
reference_accession_number=reference_accession_number or '',
sample_accession_number=sample_accession_number or '',
reference_filename=reference_filename or '',
sample_filename=sample_filename or '',
raw_vars=raw_vars, errors=errors, summary=summary, messages=messages,
reference_method=reference_method, sample_method=sample_method)
def name_checker():
"""
Name checker.
"""
# For backwards compatibility with older LOVD versions, we support the
# `mutationName` argument. If present, we redirect and add `standalone=1`.
#
# Also for backwards compatibility, we support the `name` argument as an
# alias for `description`.
if 'name' in request.args:
return redirect(url_for('.name_checker',
description=request.args['name'],
standalone=request.args.get('standalone')),
code=301)
if 'mutationName' in request.args:
return redirect(url_for('.name_checker',
description=request.args['mutationName'],
standalone=1),
code=301)
description = request.args.get('description')
if not description:
return render_template('name-checker.html')
output = Output(__file__)
output.addMessage(__file__, -1, 'INFO', 'Received variant %s from %s'
% (description, request.remote_addr))
stats.increment_counter('name-checker/website')
variantchecker.check_variant(description, output)
errors, warnings, summary = output.Summary()
parse_error = output.getOutput('parseError')
record_type = output.getIndexedOutput('recordType', 0, '')
reference = output.getIndexedOutput('reference', 0, '')
if reference:
if record_type == 'LRG':
reference_filename = reference + '.xml'
else :
reference_filename = reference + '.gb'
else:
reference_filename = None
genomic_dna = output.getIndexedOutput('molType', 0) != 'n'
genomic_description = output.getIndexedOutput('genomicDescription', 0, '')
# Create a link to the UCSC Genome Browser.
browser_link = None
raw_variants = output.getIndexedOutput('rawVariantsChromosomal', 0)
if raw_variants:
positions = [pos
for descr, (first, last) in raw_variants[2]
for pos in (first, last)]
bed_url = url_for('.bed', description=description, _external=True)
browser_link = ('http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&'
'position={chromosome}:{start}-{stop}&hgt.customText='
'{bed_file}'.format(chromosome=raw_variants[0],
start=min(positions) - 10,
stop=max(positions) + 10,
bed_file=urllib.quote(bed_url)))
# Experimental description extractor.
if (output.getIndexedOutput('original', 0) and
output.getIndexedOutput('mutated', 0)):
allele = extractor.describe_dna(output.getIndexedOutput('original', 0),
output.getIndexedOutput('mutated', 0))
extracted = '(skipped)'
if allele:
extracted = unicode(allele)
else:
extracted = ''
# Todo: Generate the fancy HTML views for the proteins here instead of in
# `mutalyzer.variantchecker`.
arguments = {
'description' : description,
'messages' : map(util.message_info, output.getMessages()),
'summary' : summary,
'parse_error' : parse_error,
'errors' : errors,
'genomicDescription' : genomic_description,
'chromDescription' : output.getIndexedOutput(
'genomicChromDescription', 0),
'genomicDNA' : genomic_dna,
'visualisation' : output.getOutput('visualisation'),
'descriptions' : output.getOutput('descriptions'),
'protDescriptions' : output.getOutput('protDescriptions'),
'oldProtein' : output.getOutput('oldProteinFancy'),
'altStart' : output.getIndexedOutput('altStart', 0),
'altProtein' : output.getOutput('altProteinFancy'),
'newProtein' : output.getOutput('newProteinFancy'),
'transcriptInfo' : output.getIndexedOutput('hasTranscriptInfo',
0, False),
'transcriptCoding' : output.getIndexedOutput('transcriptCoding', 0,
False),
'exonInfo' : output.getOutput('exonInfo'),
'cdsStart_g' : output.getIndexedOutput('cdsStart_g', 0),
'cdsStart_c' : output.getIndexedOutput('cdsStart_c', 0),
'cdsStop_g' : output.getIndexedOutput('cdsStop_g', 0),
'cdsStop_c' : output.getIndexedOutput('cdsStop_c', 0),
'restrictionSites' : output.getOutput('restrictionSites'),
'legends' : output.getOutput('legends'),
'reference_filename' : reference_filename, # Todo: Download link is not shown...
'browserLink' : browser_link,
'extractedDescription': extracted,
'standalone' : bool(request.args.get('standalone'))
}
output.addMessage(__file__, -1, 'INFO',
'Finished variant %s' % description)
return render_template('name-checker.html', **arguments)
def check_name(description):
"""
Run the name checker.
"""
O = output.Output(__file__)
O.addMessage(__file__, -1, "INFO", "Received variant " + description)
RD = variantchecker.check_variant(description, O)
O.addMessage(__file__, -1, "INFO", "Finished processing variant " + description)
### OUTPUT BLOCK ###
gn = O.getOutput("genename")
if gn :
print "Gene Name: " + gn[0]
tv = O.getOutput("transcriptvariant")
if tv :
print "Transcript variant: " + tv[0]
print
#if
for i in O.getMessages() :
print i
errors, warnings, summary = O.Summary()
print summary
print
if not errors:
print "Overview of the raw variants:"
for i in O.getOutput("visualisation"):
for j in range(len(i)):
print i[j]
print
#for
print "Genomic description:"
print O.getIndexedOutput('genomicDescription', 0, '')
print "\nChromosomal description:"
print O.getOutput("genomicChromDescription")
print "\nAffected transcripts:"
for i in O.getOutput('descriptions'):
print i
print "\nAffected proteins:"
for i in O.getOutput('protDescriptions'):
print i
print "\nOld protein:"
for i in O.getOutput("oldProteinFancyText"):
print i
print "\nNew protein:"
for i in O.getOutput("newProteinFancyText"):
print i
print "\nAlternative protein:"
for i in O.getOutput("altProteinFancyText"):
print i
print "\nExon information:"
for i in O.getOutput("exonInfo") :
print i
print "\nCDS information:"
print O.getOutput("cdsStart_c"), O.getOutput("cdsStop_c")
print O.getOutput("cdsStart_g"), O.getOutput("cdsStop_g")
print "\nEffect on Restriction sites:"
for i in O.getOutput("restrictionSites") :
print i
print "\nLegend:"
for i in O.getOutput("legends") :
print i
reference_sequence = O.getIndexedOutput("original", 0)
sample_sequence = O.getIndexedOutput("mutated", 0)
described_allele = extractor.describe_dna(reference_sequence,
sample_sequence)
#described_protein_allele = describe.describe(
# O.getIndexedOutput("oldprotein", 0),
# O.getIndexedOutput("newprotein", 0, default=""),
# DNA=False)
described_protein_allele = ""
described = described_protein = '(skipped)'
if described_allele:
described = described_allele
if described_protein_allele:
described_protein = described_protein_allele
print "\nExperimental services:"
print described
print described_protein
#print "+++ %s" % O.getOutput("myTranscriptDescription")
print json.dumps({
#"reference_sequence": reference_sequence,
#"sample_sequence": sample_sequence,
"allele_description": described_allele}, cls=AlleleEncoder)
def description_extractor_submit():
"""
The Variant Description Extractor (experimental service).
There multiple ways for the user to provide two sequences, corresponding to
the values for the `reference_method` and `sample_method` fields, each
requiring some additional fields to be defined:
`raw_method`
The reference and sample sequences are pasted into the form fields.
- `reference_sequence`: The reference sequence.
- `sample_sequence`: The sample sequence.
`file_method`
The reference and sample sequences are uploaded.
- `reference_file`: The reference file.
- `sample_file`: The sample file.
`refseq_method`
The reference and sample sequences are given by RefSeq accession numbers.
- `reference_accession_number`: RefSeq accession number for the reference
sequence.
- `sample_accession_number`: RefSeq accession number for the sample
sequence.
"""
output = Output(__file__)
output.addMessage(__file__, -1, 'INFO',
'Received Description Extract request from %s'
% request.remote_addr)
stats.increment_counter('description-extractor/website')
r = s = ''
reference_method = request.form.get('reference_method')
sample_method = request.form.get('sample_method')
reference_sequence = request.form.get('reference_sequence')
sample_sequence = request.form.get('sample_sequence')
reference_file = request.files.get('reference_file')
sample_file = request.files.get('sample_file')
reference_filename = ''
sample_filename = ''
reference_accession_number = request.form.get('reference_accession_number')
sample_accession_number = request.form.get('sample_accession_number')
if reference_method == 'refseq_method':
if reference_accession_number:
retriever = Retriever.GenBankRetriever(output)
genbank_record = retriever.loadrecord(reference_accession_number)
if genbank_record:
r = unicode(genbank_record.seq)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Reference accession number input fields is empty.')
elif reference_method == 'file_method':
if reference_file:
reference_filename = reference_file.filename
r = util.read_dna(reference_file)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'No reference file provided.')
else: # raw_method
if reference_sequence:
r = util.read_dna(StringIO.StringIO(reference_sequence))
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Reference sequence number input fields is empty.')
if sample_method == 'refseq_method':
if sample_accession_number:
retriever = Retriever.GenBankRetriever(output)
genbank_record = retriever.loadrecord(sample_accession_number)
if genbank_record:
s = unicode(genbank_record.seq)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Sample accession number input fields is empty.')
elif sample_method == 'file_method':
if sample_file:
sample_filename = sample_file.filename
s = util.read_dna(sample_file)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'No sample file provided.')
else: # raw_method
if sample_sequence:
s = util.read_dna(StringIO.StringIO(sample_sequence))
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Sample sequence number input fields is empty.')
# Todo: Move this to the describe module.
if not r or not util.is_dna(r):
output.addMessage(__file__, 3, 'ENODNA',
'Reference sequence is not DNA.')
if not s or not util.is_dna(s):
output.addMessage(__file__, 3, 'ENODNA',
'Sample sequence is not DNA.')
raw_vars = None
if r and s:
if (len(r) > settings.EXTRACTOR_MAX_INPUT_LENGTH or
len(s) > settings.EXTRACTOR_MAX_INPUT_LENGTH):
output.addMessage(__file__, 3, 'EMAXSIZE',
'Input sequences are restricted to {:,} bp.'
.format(settings.EXTRACTOR_MAX_INPUT_LENGTH))
else:
raw_vars = extractor.describe_dna(r, s)
errors, warnings, summary = output.Summary()
messages = map(util.message_info, output.getMessages())
output.addMessage(__file__, -1, 'INFO',
'Finished Description Extract request')
return render_template('description-extractor.html',
extractor_max_input_length=settings.EXTRACTOR_MAX_INPUT_LENGTH,
reference_sequence=reference_sequence or '',
sample_sequence=sample_sequence or '',
reference_accession_number=reference_accession_number or '',
sample_accession_number=sample_accession_number or '',
reference_filename=reference_filename or '',
sample_filename=sample_filename or '',
raw_vars=raw_vars, errors=errors, summary=summary, messages=messages,
reference_method=reference_method, sample_method=sample_method)
def name_checker():
"""
Name checker.
"""
# For backwards compatibility with older LOVD versions, we support the
# `mutationName` argument. If present, we redirect and add `standalone=1`.
#
# Also for backwards compatibility, we support the `name` argument as an
# alias for `description`.
if 'name' in request.args:
return redirect(url_for('.name_checker',
description=request.args['name'],
standalone=request.args.get('standalone')),
code=301)
if 'mutationName' in request.args:
return redirect(url_for('.name_checker',
description=request.args['mutationName'],
standalone=1),
code=301)
description = request.args.get('description')
if not description:
return render_template('name-checker.html')
output = Output(__file__)
output.addMessage(__file__, -1, 'INFO', 'Received variant %s from %s'
% (description, request.remote_addr))
stats.increment_counter('name-checker/website')
variantchecker.check_variant(description, output)
errors, warnings, summary = output.Summary()
parse_error = output.getOutput('parseError')
record_type = output.getIndexedOutput('recordType', 0, '')
reference = output.getIndexedOutput('reference', 0, '')
if reference:
if record_type == 'LRG':
reference_filename = reference + '.xml'
else :
reference_filename = reference + '.gb'
else:
reference_filename = None
genomic_dna = output.getIndexedOutput('molType', 0) != 'n'
genomic_description = output.getIndexedOutput('genomicDescription', 0, '')
# Create a link to the UCSC Genome Browser.
browser_link = None
raw_variants = output.getIndexedOutput('rawVariantsChromosomal', 0)
if raw_variants:
positions = [pos
for descr, (first, last) in raw_variants[2]
for pos in (first, last)]
bed_url = url_for('.bed', description=description, _external=True)
browser_link = ('http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&'
'position={chromosome}:{start}-{stop}&hgt.customText='
'{bed_file}'.format(chromosome=raw_variants[0],
start=min(positions) - 10,
stop=max(positions) + 10,
bed_file=urllib.quote(bed_url)))
# Experimental description extractor.
if (output.getIndexedOutput('original', 0) and
output.getIndexedOutput('mutated', 0)):
allele = extractor.describe_dna(output.getIndexedOutput('original', 0),
output.getIndexedOutput('mutated', 0))
extracted = '(skipped)'
if allele:
extracted = unicode(allele)
else:
extracted = ''
# Todo: Generate the fancy HTML views for the proteins here instead of in
# `mutalyzer.variantchecker`.
arguments = {
'description' : description,
'messages' : map(util.message_info, output.getMessages()),
'summary' : summary,
'parse_error' : parse_error,
'errors' : errors,
'genomicDescription' : genomic_description,
'chromDescription' : output.getIndexedOutput(
'genomicChromDescription', 0),
'genomicDNA' : genomic_dna,
'visualisation' : output.getOutput('visualisation'),
'descriptions' : output.getOutput('descriptions'),
'protDescriptions' : output.getOutput('protDescriptions'),
'oldProtein' : output.getOutput('oldProteinFancy'),
'altStart' : output.getIndexedOutput('altStart', 0),
'altProtein' : output.getOutput('altProteinFancy'),
'newProtein' : output.getOutput('newProteinFancy'),
'transcriptInfo' : output.getIndexedOutput('hasTranscriptInfo',
0, False),
'transcriptCoding' : output.getIndexedOutput('transcriptCoding', 0,
False),
'exonInfo' : output.getOutput('exonInfo'),
'cdsStart_g' : output.getIndexedOutput('cdsStart_g', 0),
'cdsStart_c' : output.getIndexedOutput('cdsStart_c', 0),
'cdsStop_g' : output.getIndexedOutput('cdsStop_g', 0),
'cdsStop_c' : output.getIndexedOutput('cdsStop_c', 0),
'restrictionSites' : output.getOutput('restrictionSites'),
'legends' : output.getOutput('legends'),
'reference_filename' : reference_filename, # Todo: Download link is not shown...
'browserLink' : browser_link,
'extractedDescription': extracted,
'standalone' : bool(request.args.get('standalone'))
}
output.addMessage(__file__, -1, 'INFO',
'Finished variant %s' % description)
return render_template('name-checker.html', **arguments)
def check_name(description):
"""
Run the name checker.
"""
O = output.Output(__file__)
O.addMessage(__file__, -1, "INFO", "Received variant " + description)
RD = variantchecker.check_variant(description, O)
O.addMessage(__file__, -1, "INFO",
"Finished processing variant " + description)
### OUTPUT BLOCK ###
gn = O.getOutput("genename")
if gn:
print "Gene Name: " + gn[0]
tv = O.getOutput("transcriptvariant")
if tv:
print "Transcript variant: " + tv[0]
print
#if
for i in O.getMessages():
print i
errors, warnings, summary = O.Summary()
print summary
print
if not errors:
print "Overview of the raw variants:"
for i in O.getOutput("visualisation"):
for j in range(len(i)):
print i[j]
print
#for
print "Genomic description:"
print O.getIndexedOutput('genomicDescription', 0, '')
print "\nChromosomal description:"
print O.getOutput("genomicChromDescription")
print "\nAffected transcripts:"
for i in O.getOutput('descriptions'):
print i
print "\nAffected proteins:"
for i in O.getOutput('protDescriptions'):
print i
print "\nOld protein:"
for i in O.getOutput("oldProteinFancyText"):
print i
print "\nNew protein:"
for i in O.getOutput("newProteinFancyText"):
print i
print "\nAlternative protein:"
for i in O.getOutput("altProteinFancyText"):
print i
print "\nExon information:"
for i in O.getOutput("exonInfo"):
print i
print "\nCDS information:"
print O.getOutput("cdsStart_c"), O.getOutput("cdsStop_c")
print O.getOutput("cdsStart_g"), O.getOutput("cdsStop_g")
print "\nEffect on Restriction sites:"
for i in O.getOutput("restrictionSites"):
print i
print "\nLegend:"
for i in O.getOutput("legends"):
print i
reference_sequence = O.getIndexedOutput("original", 0)
sample_sequence = O.getIndexedOutput("mutated", 0)
described_allele = extractor.describe_dna(reference_sequence,
sample_sequence)
#described_protein_allele = describe.describe(
# O.getIndexedOutput("oldProtein", 0),
# O.getIndexedOutput("newProtein", 0, default=""),
# DNA=False)
described_protein_allele = ""
described = described_protein = '(skipped)'
if described_allele:
described = described_allele
if described_protein_allele:
described_protein = described_protein_allele
print "\nExperimental services:"
print described
print described_protein
#print "+++ %s" % O.getOutput("myTranscriptDescription")
print json.dumps(
{
#"reference_sequence": reference_sequence,
#"sample_sequence": sample_sequence,
"allele_description": described_allele
},
cls=AlleleEncoder)
def rsid_search(tile_index, variant, suppress_output=True):
results_dict = {}
tile = application.Tile(tile_index)
varval = int(variant)
# retrieve tile information using getTileVariants script
info_tile = getTileVariants.tile_iteration(tile,
suppress_output=True,
all_functionality=True)
# break up output into common variant (.000) and specifically chosen
# variant
tile_variant = info_tile.variants.split('\n')[varval]
common_variant = info_tile.variants.split('\n')[0]
if tile_variant == common_variant:
print("No difference between tiles. Exiting...")
sys.exit()
# retrieve sequence, ignoring hash + id
tile_seq = tile_variant.split(',')[2]
common_seq = common_variant.split(',')[2]
results_dict['tile_sequence'] = tile_variant
results_dict['common_sequence'] = common_variant
results_dict['variant'] = variant
results_dict['index'] = tile_index
results_dict['mutations'] = {}
if not suppress_output:
print("Common sequence: {}".format(common_seq))
print("Variant sequence: {}".format(tile_seq))
# delete spanning tile parts if necessary
if len(tile_seq) - len(common_seq) >= 24:
tile_seq = tile_seq[:len(common_seq)]
if not suppress_output:
print("Detected spanning tile. Deleting extra part...")
elif len(common_seq) - len(tile_seq) >= 24:
common_seq = common_seq[:len(tile_seq)]
if not suppress_output:
print("Detected spanning tile. Deleting extra part...")
# run mutalyzer description extractor for alignment data
allele = describe_dna(common_seq, tile_seq)
changes = str(allele)
# break up into list if needed
changes = changes.replace('[', '')
changes = changes.replace(']', '')
changes = changes.split(';')
mutations = map(lambda x: get_mutation(x, info_tile, common_seq), changes)
# offset all mutations
map(lambda x: x.offset(info_tile.to_dict()['position_start']), mutations)
# store all the queries
rsid_queries = map(lambda x: x.rsid_query(), mutations)
rsid_queries = list(filter(lambda x: x != '', rsid_queries))
mutations_lst = zip(mutations, rsid_queries)
# print results
for mutation, rsid_lst in mutations_lst:
if not suppress_output:
print('---')
print("Mutation: {}".format(mutation))
print("Representation: {}".format(repr(mutation)))
mutation_info = []
if len(rsid_lst) > 0 and rsid_lst[0] != '':
if not suppress_output:
print("Possible SNP RSIDS:")
for rsid_query in rsid_lst:
chrom, rsid, location, ref, alt = rsid_query.split(" ")
result_str = "RSID: {}; Location: {}, REF: {}, ALT: {}".format(
rsid, location, ref, alt)
if not suppress_output:
print(result_str)
mutation_info.append((rsid, location, ref, alt))
else:
if not suppress_output:
print("No possible SNPs found")
results_dict['mutations'][repr(mutation)] = mutation_info
return results_dict