def printprobesandorderthem(probesfile, probesoutputfile):
import os
import simplejson
import Bio.Seq
import info
if probesoutputfile in os.listdir('./'):
print "WARNING: file exists"
file = open(probesfile)
probeslist = simplejson.load(file)
file.close()
cells = info.lineinfo().all
file = open(probesoutputfile,'w')
file.write('NAME'+','+ 'SEQUENCE' + '\n')
for pl in probeslist:
for i,p in enumerate(pl):
pr = Primer(p[0], p[1], cells.index(p[2]), p[3], p[4])
print pr.seqlig
(file.write(pr.line + str(i) + ','
+ Bio.Seq.reverse_complement(pr.seqlig) + pr.backbone
+ Bio.Seq.reverse_complement(pr.seqext) + '\n'))
file.close()
def __init__(self, chr, pos, snpline, ref, alt):
import info
self.ref = ref
self.alt = alt
lines = info.lineinfo()
cells = lines.individuals['CEU'] + lines.individuals['CHBJPT'] + lines.individuals['YRI']
self.chr = chr
self.pos = pos
self.lpos = self.ligpos()
self.epos = self.extpos()
self.seqlig = str(hg18['chr'+str(self.chr)][self.lpos[0]:self.lpos[1]])
self.seqext = str(hg18['chr'+str(self.chr)][self.epos[0]:self.epos[1]])
self.backbone = 'AGATCGGAAGAGCGTCGCATGTTATCGAGGTC'
self.line = cells[snpline]
def num_genotypes_trios(genotypes):
import info
num_genos = []
num_alleles = []
lineID = []
for geno in genotypes:
print geno
a = num_genotypes([geno])
num_genos.append(a[0])
num_alleles.append(a[1])
lineID.append(a[2])
if num_genos[0] == 2 and num_genos[1] == 2:
i = info.lineinfo()
snp1cells = map(lambda x: i.all[x], lineID[0])
snp2cells = map(lambda x: i.all[x], lineID[1])
if i.child['YRI'] in snp1cells and i.child['YRI'] in snp2cells:
if i.parents['YRI'][0] in snp1cells+snp2cells and i.parents['YRI'][1] in snp1cells+snp2cells:
return i.child['YRI']
sa = 0
for al in records[r].alignments:
if 'GRCh37.p2' in al.title:
for hsp in al.hsps:
if hsp.expect < EXPECT_THRESH:
sa = sa+1
if sa == 2:
goodprobes.append(r)
return goodprobes
if __name__ == "__main__":
import simplejson
import info
import os
lines = info.lineinfo()
cells = lines.all
file = open('./19.outputUniqueSNPs')
# file = open('./probes1')
candidateloci = simplejson.load(file)
file.close()
# take only num alleles == 2
#a = alleles(candidateloci, 2)
a = candidateloci
primersbeforeblastandtrio = runTests(a)
'''
file = open('./primersbeforeblastandtrio1026')
plist = simplejson.load(file)
file.close()
