def hmmer2pom(hmm): # set up environment from math import exp from pomegranate import DiscreteDistribution,HiddenMarkovModel,State tags = dict(); header = 0; alphabet = None; hmmlines = list() # parse HMMER file for line in hmm.splitlines(): l = line.strip() if len(l) == 0 or l[0] == '#': continue elif header == 0: if l.startswith('HMM') and l[3] != 'E': # beginning of actual HMM header = 1; alphabet = l.split()[1:] else: parts = l.strip().split() if parts[0] in tags: if not isinstance(tags[parts[0]], list): tags[parts[0]] = [tags[parts[0]]] tags[parts[0]].append(' '.join(parts[1:])) else: tags[parts[0]] = ' '.join(parts[1:]) elif header == 1: header = 2 else: if l.startswith('COMPO'): parts = l.strip().split(); tags[parts[0]] = ' '.join(parts[1:]) else: hmmlines.append(l) # create all states model = HiddenMarkovModel(tags['NAME']); tmpstates = list(); K = 0 i_emit = hmmlines[0].split(); tmpstates.append(State(DiscreteDistribution({alphabet[i] : exp(-1*float(i_emit[i])) for i in range(len(alphabet))}), name="I0")) # insertion state for l in range(2,len(hmmlines),3): m_emit,i_emit,state_trans = [hmmlines[l+i].split() for i in range(0,3)]; K = int(m_emit[0]) tmpstates.append(State(DiscreteDistribution({alphabet[i] : exp(-1*float(m_emit[i+1])) for i in range(len(alphabet))}), name="M%d" % K)) # match state tmpstates.append(State(DiscreteDistribution({alphabet[i] : exp(-1*float(i_emit[i])) for i in range(len(alphabet))}), name="I%d" % K)) # insertion state tmpstates.append(State(None, name="D%d" % K)) # deletion state assert K != 0, "No match states in profile HMM" model.add_states(tmpstates); name2state = {state.name:state for state in tmpstates}; name2state["M0"] = model.start; name2state["M%d"%(K+1)] = model.end # create all transitions for l in range(1,len(hmmlines),3): k = int(l/3); parts = hmmlines[l].split() model.add_transition(name2state["M%d"%k], name2state["M%d"%(k+1)], exp(-1*float(parts[0]))) # 0: M_k -> M_k+1 model.add_transition(name2state["M%d"%k], name2state["I%d"%k], exp(-1*float(parts[1]))) # 1: M_k -> I_k if parts[2] != '*': # no D_k+1 in last row model.add_transition(name2state["M%d"%k], name2state["D%d"%(k+1)], exp(-1*float(parts[2]))) # 2: M_k -> D_k+1 model.add_transition(name2state["I%d"%k], name2state["M%d"%(k+1)], exp(-1*float(parts[3]))) # 3: I_k -> M_k+1 model.add_transition(name2state["I%d"%k], name2state["I%d"%k], exp(-1*float(parts[4]))) # 4: I_k -> I_k if k != 0: # no D0 state model.add_transition(name2state["D%d"%k], name2state["M%d"%(k+1)], exp(-1*float(parts[5]))) # 5: D_k -> M_k+1 if parts[6] != '*': # no D0 state and no D_k+1 in last row model.add_transition(name2state["D%d"%k], name2state["D%d"%(k+1)], exp(-1*float(parts[6]))) # 6: D_k -> D_k+1 model.bake() return model.to_json()
coding_model.add_transition(coding_state2, ez_states_tag[0], 0.0000000230000) coding_model.add_transition(donor0_states[-1], in0, 1) coding_model.add_transition(donor1_states[-1], in1, 1) coding_model.add_transition(donor2_states[-1], in2, 1) coding_model.add_transition(in0_spacers[-1], acceptor0_states[0], 1) coding_model.add_transition(in1_spacers[-1], acceptor1_states[0], 1) coding_model.add_transition(in2_spacers[-1], acceptor2_states[0], 1) coding_model.add_transition(acceptor0_states[-1], coding_state0, 1.0) coding_model.add_transition(acceptor1_states[-1], coding_state0, 1.0) coding_model.add_transition(acceptor2_states[-1], coding_state0, 1.0) coding_model.add_transition(ze_states[-1], coding_state0, 1.0) coding_model.add_transition(ez_states_taa[-1], exon3_state, 1.0) coding_model.add_transition(ez_states_tga[-1], exon3_state, 1.0) coding_model.add_transition(ez_states_tag[-1], exon3_state, 1.0) coding_model.add_transition(exon3_state, exon3_state, 0.9) coding_model.add_transition(exon3_state, poly_a_states[0], 0.1) coding_model.add_transition(poly_a_states[-1], post_poly_spacer[0], 1.0) coding_model.add_transition(post_poly_spacer[-1], back, 1.0) coding_model.bake() with open('coding_model_base_poly.json', 'w', encoding='utf-8') as out: out.write(coding_model.to_json())
converted_total = [converter_to(x, 2) for x in total] #print(converted_total) def test(model): with open('new_intron_acceptor.txt') as test_file: cont_ok = 0 cont_not_ok = 0 for line in test_file: test_line = line.lower().replace('\n', '') logp, path = model.viterbi(converter_to(test_line, 2)) if (path[-40][1].name == 'acceptor015'): cont_ok += 1 else: cont_not_ok += 1 print(cont_ok / (cont_not_ok + cont_ok)) test(model) model.fit(converted_total, transition_pseudocount=1, emission_pseudocount=1, verbose=True) test(model) with open('partial_model_intron_acceptor_model.json', 'w') as out: out.write(model.to_json())
def train_and_test(): with open('../data extractors/exons_start_1.txt') as in_file: total = [] for line in in_file: no_p_line = line.replace('P', '').lower().replace('\n', '') total.append(no_p_line) converted_total = [converter_to(x, 2) for x in total] matrixDonor0 = numpy.array( matrix_from_exa('../data extractors/new_donor1.exa')) c0, c1, c2 = calculator.calculate_proba2('../data extractors/new_cuts.txt') print(c0.p, c1.p, c2.p) coding_state0 = State(DiscreteDistribution(c0.p), 'coding state 0') coding_state1 = State(DiscreteDistribution(c1.p), 'coding state 1') coding_state2 = State(DiscreteDistribution(c2.p), 'coding state 2') donor0_data = classify(matrixDonor0, 2) donor0_states = sequence_state_factory(donor0_data, 'donor0') post = State(DiscreteDistribution(equal_distribution), name='post') model = HiddenMarkovModel('coding to donor') model.add_state(coding_state0) model.add_state(coding_state1) model.add_state(coding_state2) add_sequence(model, donor0_states) model.add_state(post) model.add_transition(model.start, coding_state0, 1) model.add_transition(coding_state0, coding_state1, 0.6) model.add_transition(coding_state0, donor0_states[0], 0.4) model.add_transition(coding_state1, coding_state2, 0.6) model.add_transition(coding_state1, donor0_states[0], 0.4) model.add_transition(coding_state2, coding_state0, 0.6) model.add_transition(coding_state2, donor0_states[0], 0.4) model.add_transition(donor0_states[-1], post, 1) model.add_transition(post, post, 0.9) model.add_transition(post, model.end, 0.1) model.bake() test_model(model) model.fit(converted_total, transition_pseudocount=1, emission_pseudocount=1, verbose=True) test_model(model) with open('partial_model_coding_to_donor_model0.json', 'w') as out: out.write(model.to_json())
hmmodel.add_transition(hmmodel.start, back_state, 1) hmmodel.add_transition(back_state, back_state, 0.9) hmmodel.add_transition(back_state, fixed_state, 0.1) hmmodel.add_transition(fixed_state, fixed_state, 0.9) hmmodel.add_transition(fixed_state, back_state, 0.1) hmmodel.bake() seq = list('acgtacgtaaaaccccaaa') lopg, path = hmmodel.viterbi(seq) print([x[1].name for x in path]) print(hmmodel.to_json()) to_fit1 = list('acgtacacacacacacac') to_fit2 = list('acgtacgtacgtacgtacgtacgtacgtcgt') to_fit3 = list('aaaaacccccaaacc') to_fit4 = list('aaaaaccgcccaaaccacgtacgtacgtacgtactacgggggg') lopg, path = hmmodel.viterbi(to_fit4) print([x[1].name for x in path]) hmmodel.fit([to_fit1, to_fit2, to_fit3, to_fit4]) lopg, path = hmmodel.viterbi(seq) print([x[1].name for x in path])
# TATA promoter_utr_model.add_transition(tata_states[-1], post_tata_var_spacers[0], 1) promoter_utr_model.add_transition(post_tata_spacers[-1], inr_states[0], 0.31) promoter_utr_model.add_transition(post_tata_spacers[-1], no_inr_states[0], 0.69) promoter_utr_model.add_transition(inr_states[-1], promoter_utr_model.end, 1) promoter_utr_model.add_transition(no_inr_states[-1], promoter_utr_model.end, 1) promoter_utr_model.bake() with open('promoter_utr_model_base.json', 'w', encoding='utf-8') as out: out.write(promoter_utr_model.to_json()) """ string = ""CATTCCCAGTTCTTTACATTCATCCCTTGTTTCCAGAAAGGGCAGAGGAAGCGAGGAAAA AGTGCGTGGCCTGAAGTGACGCCTGGCGTTGCCCGAAGCCCGCCCAGCGCTGCCAGGTGA CGCCACTGCGACACAAAGGCGGGGATTGCGTAGGGAAAGGCCCTAGGCCATAAACGGGGG # TGGGGCCTCCCCGGAGGCCAGTGCG"" string = string.lower().replace('\n', '') print(len(string)) lists = list(string) two = converter_to(lists, 2) print(two) seq = numpy.array(two, numpy.unicode_) logp, path = promoter_utr_model.viterbi(seq) path_names = [p[1].name for p in path]
class RealTimeHMM(): def __init__(self, n_trials=3, leave_one_out=1): """Variable initialization""" self.patient = rospy.get_param("gait_phase_det/patient") self.verbose = rospy.get_param("gait_phase_det/verbose") self.n_trials = n_trials self.n_features = 2 # Raw data and 1st-derivative self.leave_one_out = leave_one_out self.rec_data = 0.0 # Number of recorded IMU data self.proc_data = 0.0 # Number of extracted features self.win_size = 3 self.raw_win = [None] * self.win_size # self.fder_win = [0] * self.win_size self.ff = [[] for x in range(self.n_trials)] # Training and test dataset self.labels = [[] for x in range(self.n_trials)] # Reference labels from local data self.first_eval = True self.model_loaded = False algorithm = rospy.get_param("gait_phase_det/algorithm") rospy.loginfo('Decoding algorithm: {}'.format(algorithm)) if algorithm not in DECODER_ALGORITHMS: raise ValueError("Unknown decoder {!r}".format(algorithm)) self.decode = { "fov": self._run_fov, "bvsw": self._run_bvsw }[algorithm] self.imu_callback = { "fov": self._fov_callback, "bvsw": self._bvsw_callback }[algorithm] """HMM variables""" ''' State list: s1: Heel Strike (HS) s2: Flat Foot (FF) s3: Heel Off (HO) s4: Swing Phase (SP)''' self.model_name = "Gait" self.has_model = False self.must_train = False self.states = ['s1', 's2', 's3', 's4'] self.n_states = len(self.states) self.state2phase = {"s1": "hs", "s2": "ff", "s3": "ho", "s4": "sp"} self.train_data = [] self.mgds = {} self.dis_means = [[] for x in range(self.n_states)] self.dis_covars = [[] for x in range(self.n_states)] self.start_prob = [1.0/self.n_states]*self.n_states self.trans_mat = np.array([(0.9, 0.1, 0, 0), (0, 0.9, 0.1, 0), (0, 0, 0.9, 0.1), (0.1, 0, 0, 0.9)]) # Left-right model # self.trans_mat = np.array([0.8, 0.1, 0, 0.1], [0.1, 0.8, 0.1, 0], [0, 0.1, 0.8, 0.1], [0.1, 0, 0.1, 0.8]) # Left-right-left model self.log_startprob = [] self.log_transmat = np.empty((self.n_states, self.n_states)) self.max_win_len = 11 # ms (120 ms: mean IC duration for healthy subjects walking at comfortable speed) self.viterbi_path = np.empty((self.max_win_len+1, self.n_states)) self.backtrack = [[None for x in range(self.n_states)] for y in range(self.max_win_len+1)] self.global_path = [] self.work_buffer = np.empty(self.n_states) self.boundary = 1 self.buff_len = 0 self.states_pos = {} for i in range(len(self.states)): self.states_pos[self.states[i]] = i self.last_state = -1 self.curr_state = -1 self.conv_point = 0 self.conv_found = False self.smp_freq = 100.0 # Hz self.fp_thresh = 1/self.smp_freq*4 # Threshold corresponds to 8 samples self.time_passed = 0.0 self.obs = [[None for x in range(self.n_features)] for y in range(self.max_win_len)] self.model = HMM(name=self.model_name) """ROS init""" rospy.init_node('real_time_HMM', anonymous=True) rospack = rospkg.RosPack() self.packpath = rospack.get_path('hmm_gait_phase_classifier') self.init_subs() self.init_pubs() """HMM-training (if no model exists)""" try: '''HMM-model loading''' with open(self.packpath+'/log/HMM_models/'+self.patient+'.txt') as infile: json_model = json.load(infile) self.model = HMM.from_json(json_model) rospy.logwarn(self.patient + "'s HMM model was loaded.") self.has_model = True except IOError: if os.path.isfile(self.packpath + "/log/mat_files/" + self.patient + "_proc_data1.mat"): """Training with data collected with FSR-based reference system""" self.data_ext = 'mat' self.must_train = True elif os.path.isfile(self.packpath + "/log/IMU_data/" + self.patient + "_labels.csv"): """Training with data collected with offline threshold-based gait phase detection method""" self.data_ext = 'csv' self.must_train = True else: rospy.logerr("Please collect data for training ({})!".format(self.patient)) if self.must_train: rospy.logwarn("HMM model not trained yet for {}!".format(self.patient)) rospy.logwarn("Training HMM with local data...") self.load_data() self.init_hmm() self.train_hmm() self.has_model = True if self.has_model: try: '''MGDs loading if model exists''' for st in self.states: with open(self.packpath+'/log/HMM_models/'+self.patient+'_'+self.state2phase[st]+'.txt') as infile: yaml_dis = yaml.safe_load(infile) dis = MGD.from_yaml(yaml_dis) self.mgds[st] = dis rospy.logwarn(self.patient +"'s " + self.state2phase[st] + " MGC was loaded.") '''Loading means and covariance matrix''' self.dis_means[self.states_pos[st]] = self.mgds[st].parameters[0] self.dis_covars[self.states_pos[st]] = self.mgds[st].parameters[1] except yaml.YAMLError as exc: rospy.logwarn("Not able to load distributions: " + exc) """Transition and initial (log) probabilities matrices upon training""" trans_mat = self.model.dense_transition_matrix()[:self.n_states,:self.n_states] if self.verbose: print '**TRANSITION MATRIX (post-training)**\n'+ str(trans_mat) for i in range(self.n_states): self.log_startprob.append(ln(self.start_prob[i])) for j in range(self.n_states): self.log_transmat[i,j] = ln(trans_mat[i][j]) self.model_loaded = True """Init ROS publishers""" def init_pubs(self): self.phase_pub = rospy.Publisher('/gait_phase', Int8, queue_size=100) """Init ROS subcribers""" def init_subs(self): rospy.Subscriber('/imu_data', Imu, self.imu_callback) """Callback function upon arrival of IMU data for forward-only decoding""" def _fov_callback(self, data): self.rec_data += 1.0 self.raw_win.append(data.angular_velocity.y) self.raw_win.pop(0) # Drop first element if self.rec_data >= self.win_size and self.model_loaded: # At least one previous and one subsequent data should have been received """Extract feature and append it to test dataset""" fder = (self.raw_win[self.win_size/2 + 1] - self.raw_win[self.win_size/2 - 1])/2 # peak_detector = self.raw_win[self.win_size/2]/max(self.raw_win) # self.fder_win.append(fder) # self.fder_win.pop(0) # sder = (self.fder_win[2] - self.fder_win[0])/2 # test_set = [self.raw_win[self.win_size/2], self.raw_win[self.win_size/2 - 2], self.raw_win[self.win_size/2 - 1], self.raw_win[self.win_size/2 + 1], self.raw_win[self.win_size/2 + 2]] # Temporally proximal features test_set = [self.raw_win[self.win_size/2], fder] # Temporally proximal features '''Forward-only decoding approach''' state = self.decode(test_set) # rospy.loginfo("Decoded phase: {}".format(state)) self.time_passed += 1/self.smp_freq if self.last_state == state: if (self.time_passed >= self.fp_thresh) and (self.curr_state == 3 and state == 0) or (state == self.curr_state + 1): self.curr_state = state self.phase_pub.publish(state) else: # rospy.loginfo("Current phase: {}".format(self.state2phase[self.states[self.curr_state]])) # self.phase_pub.publish((self.curr_state-1)%4) self.phase_pub.publish(self.curr_state) else: self.last_state = state self.time_passed = 1/self.smp_freq # rospy.logwarn("Detected phase: {}".format(self.state2phase[self.states[self.last_state]])) """Callback function upon arrival of IMU data for BVSW""" def _bvsw_callback(self, data): self.rec_data += 1.0 self.raw_win.append(data.angular_velocity.y) self.raw_win.pop(0) # Drop first element if self.rec_data >= 3 and self.model_loaded: # At least one previous and one subsequent data should have been received """Extract feature and append it to test dataset""" test_set = [self.raw_win[1], (self.raw_win[0]+self.raw_win[2])/2] # First-derivate of angular velocity '''Bounded sliding window decoding approach''' self.obs.append(test_set) self.obs.pop(0) # This way, -1 element corresponds to last received features states = self.decode(test_set) if len(states) != 0: for st in states: self.phase_pub.publish(st) if self.curr_state != st: rospy.logwarn("Detected phase: {}".format(self.state2phase[self.states[st]])) self.curr_state = st self.proc_data += 1.0 # One gyro data has been processed """Local data loading from mat file and feature extraction""" def load_data(self): """Data loading""" '''Load mat file (Data processed offline in Matlab)''' if self.data_ext == 'mat': rospy.logwarn("Initializing parameters via FSR-based reference system") # subs = ['daniel', 'erika', 'felipe', 'jonathan', 'luis', 'nathalia', 'paula', 'pedro', 'tatiana'] # Healthy subjects # subs = ['carmen', 'carolina', 'catalina', 'claudia', 'emmanuel', 'fabian', 'gustavo'] # Pathological subjects # subs = ['daniel'] # Single subject datapath = self.packpath + "/log/mat_files/" gyro_y = [[] for x in range(self.n_trials)] time_array = [[] for x in range(self.n_trials)] # for patient in subs: for i in range(self.n_trials): data = scio.loadmat(datapath + self.patient + "_proc_data" + str(i+1) + ".mat") # data = scio.loadmat(datapath + patient + "_proc_data" + str(i+1) + ".mat") gyro_y[i] = data["gyro_y"][0] # gyro_y[i] += list(data["gyro_y"][0]) time_array[i] = data["time"][0] # time_array[i] += list(data["time"][0]) self.labels[i] = data["labels"][0] # self.labels[i] += list(data["labels"][0]) """Feature extraction""" '''First derivative''' fder_gyro_y = [] for i in range(self.n_trials): der = [] der.append(gyro_y[i][0]) for j in range(1,len(gyro_y[i])-1): der.append((gyro_y[i][j+1]-gyro_y[i][j-1])/2) der.append(gyro_y[i][-1]) fder_gyro_y.append(der) '''Second derivative''' # sder_gyro_y = [] # for i in range(self.n_trials): # der = [] # der.append(fder_gyro_y[i][0]) # for j in range(1,len(fder_gyro_y[i])-1): # der.append((fder_gyro_y[i][j+1]-fder_gyro_y[i][j-1])/2) # der.append(fder_gyro_y[i][-1]) # sder_gyro_y.append(der) '''Peak detector''' # peak_detector = [] # for i in range(self.n_trials): # win = [] # for j in range(len(gyro_y[i])): # if (j - self.win_size/2) < 0: # win.append(gyro_y[i][j] / self._max(gyro_y[i][0:j + self.win_size/2])) # elif (j + self.win_size/2) > (len(gyro_y[i])-1): # win.append(gyro_y[i][j] / self._max(gyro_y[i][j - self.win_size/2:len(gyro_y[i])-1])) # else: # win.append(gyro_y[i][j] / self._max(gyro_y[i][j - self.win_size/2:j + self.win_size/2])) # peak_detector.append(win) """Create training data""" for j in range(self.n_trials): # for k in range(self.win_size/2,len(gyro_y[j])-1-self.win_size/2): for k in range(len(gyro_y[j])): f_ = [] f_.append(gyro_y[j][k]) '''Approximate differentials''' f_.append(fder_gyro_y[j][k]) # f_.append(sder_gyro_y[j][k]) '''Temporally proximal feature''' # f_.append(gyro_y[j][k-1]) # f_.append(gyro_y[j][k-2]) # f_.append(gyro_y[j][k+1]) # f_.append(gyro_y[j][k+2]) '''Peak detector''' # f_.append(peak_detector[j][k]) self.ff[j].append(f_) self.ff = np.array(self.ff) self.n_features = len(self.ff[0][0]) for i in range(len(self.ff[self.leave_one_out-1])): self.train_data.append(self.ff[self.leave_one_out-1][i]) for i in range(len(self.ff[(self.leave_one_out+1) % self.n_trials])): self.train_data.append(self.ff[(self.leave_one_out+1) % self.n_trials][i]) self.train_data = [self.train_data] # Keep this line or training won't work """Parameter initialization""" '''Kmeans clustering''' # n_components = 4 # No. components of MGD # init = 'kmeans++' # "kmeans||", "first-k", "random" # n_init = 1 # weights = None # max_kmeans_iterations = 1 # batch_size = None # batches_per_epoch = None # # X_concat = x_train # # # X_concat = numpy.concatenate(x_train) # # if X_concat.ndim == 1: # # X_concat = X_concat.reshape(X_concat.shape[0], 1) # # n, d = X_concat.shape # # rospy.logwarn("K-means clustering...") # clf = Kmeans(n_components, init=init, n_init=n_init) # clf.fit(X_concat, weights, max_iterations=max_kmeans_iterations, # batch_size=batch_size, batches_per_epoch=batches_per_epoch) # y = clf.predict(X_concat) # # rospy.logwarn("Creating distributions...") # class_data = [[] for x in range(self.n_states)] # for i in range(len(x_train)): # class_data[y[i]].append(x_train[i]) # if self.verbose: # sum = 0 # print "Kmeans clusters:" # for i in range(self.n_states): # temp = len(class_data[i]) # sum += temp # print temp # print sum, len(x_train) """Offline threshold-based classification""" if self.data_ext == 'csv': rospy.logwarn("Initializing parameters via threshold-based gait phase detection method") self.leave_one_out = 0 gyro_y = [] datapath = self.packpath + '/log/IMU_data/' with open(datapath+'{}.csv'.format(self.patient), 'r') as imu_file: reader = csv.DictReader(imu_file) for row in reader: gyro_y.append(float(dict(row)['gyro_y'])) '''Feature extraction: 1st derivative''' for i in range(1, len(gyro_y)-1): feature_vect = [gyro_y[i], (gyro_y[i+1]-gyro_y[i-1])/2] self.train_data.append(feature_vect) self.ff[self.leave_one_out].append(feature_vect) '''Reference labels''' with open(datapath+'{}_labels.csv'.format(self.patient), 'r') as labels_file: reader = csv.reader(labels_file) for row in reader: self.labels[self.leave_one_out].append(int(row[0])) self.train_data = [self.train_data] """Init HMM if no previous training""" def init_hmm(self): if self.data_ext == 'mat': rospy.logwarn("-------Leaving trial {} out-------".format(self.leave_one_out+1)) """Transition matrix (A)""" '''Transition matrix from reference labels''' # prev = -1 # for i in range(len(self.labels[self.leave_one_out])): # if prev == -1: # prev = self.labels[self.leave_one_out][i] # self.trans_mat[prev][self.labels[self.leave_one_out][i]] += 1.0 # prev = self.labels[self.leave_one_out][i] # self.trans_mat = normalize(self.trans_mat, axis=1, norm='l1') if self.verbose: rospy.logwarn("**TRANSITION MATRIX (pre-training)**\n" + str(self.trans_mat) + '\nMatrix type: {}'.format(type(self.trans_mat))) class_data = [[] for x in range(self.n_states)] for i in range(len(self.ff[self.leave_one_out])): class_data[self.labels[self.leave_one_out][i]].append(self.ff[self.leave_one_out][i]) """Multivariate Gaussian Distributions for each hidden state""" class_means = [[[] for x in range(self.n_features)] for i in range(self.n_states)] # class_vars = [[[] for x in range(self.n_features)] for i in range(self.n_states)] # class_std = [[[] for x in range(self.n_features)] for i in range(self.n_states)] class_cov = [] for i in range(self.n_states): cov = np.ma.cov(np.array(class_data[i]), rowvar=False) class_cov.append(cov) for j in range(self.n_features): class_means[i][j] = np.array(class_data[i][:])[:, [j]].mean(axis=0) # class_vars[i][j] = np.array(class_data[i][:])[:, [j]].var(axis=0) # class_std[i][j] = np.array(class_data[i][:])[:, [j]].std(axis=0) """Classifier initialization""" distros = [] hmm_states = [] for i in range(self.n_states): dis = MGD(np.array(class_means[i]).flatten(), np.array(class_cov[i])) st = State(dis, name=self.states[i]) distros.append(dis) hmm_states.append(st) self.model.add_states(hmm_states) '''Initial transitions''' for i in range(self.n_states): self.model.add_transition(self.model.start, hmm_states[i], self.start_prob[i]) '''Left-right model''' for i in range(self.n_states): for j in range(self.n_states): self.model.add_transition(hmm_states[i], hmm_states[j], self.trans_mat[i][j]) '''Finish model setup''' self.model.bake() """Train initialized model""" def train_hmm(self): rospy.logwarn("Training initialized model...") self.model.fit(self.train_data, algorithm='baum-welch', verbose=self.verbose) self.model.freeze_distributions() # Freeze all model distributions, preventing update from ocurring if self.verbose: print "**HMM model:\n{}**".format(self.model) """Save Multivariate Gaussian Distributions into yaml file""" for st in self.model.states: if st.name != self.model_name+"-start" and st.name != self.model_name+"-end": dis = st.distribution dis_yaml = dis.to_yaml() try: with open(self.packpath+'/log/HMM_models/'+self.patient+'_'+self.state2phase[st.name]+'.txt', 'w') as outfile: yaml.dump(dis_yaml, outfile, default_flow_style=False) rospy.logwarn(self.patient+"'s "+self.state2phase[st.name]+" distribution was saved.") except IOError: rospy.logwarn('It was not possible to write GMM distribution.') """Save model (json script) into txt file""" model_json = self.model.to_json() try: with open(self.packpath+'/log/HMM_models/'+self.patient+'.txt', 'w') as outfile: json.dump(model_json, outfile) rospy.logwarn(self.patient+"'s HMM model was saved.") except IOError: rospy.logwarn('It was not possible to write HMM model.') """Compute the log probability under a multivariate Gaussian distribution. Parameters ---------- X : array_like, shape (n_samples, n_features) List of n_features-dimensional data points. Each row corresponds to a single data point. means : array_like, shape (n_components, n_features) List of n_features-dimensional mean vectors for n_components Gaussians. Each row corresponds to a single mean vector. covars : array_like List of n_components covariance parameters for each Gaussian. The shape is (n_components, n_features, n_features) if 'full' Returns ---------- lpr : array_like, shape (n_samples, n_components) Array containing the log probabilities of each data point in X under each of the n_components multivariate Gaussian distributions.""" def log_multivariate_normal_density(self, X, min_covar=1.e-7): """Log probability for full covariance matrices.""" n_samples, n_dim = X.shape nmix = len(self.dis_means) log_prob = np.empty((n_samples, nmix)) for c, (mu, cv) in enumerate(zip(self.dis_means, self.dis_covars)): try: cv_chol = linalg.cholesky(cv, lower=True) except linalg.LinAlgError: # The model is most probably stuck in a component with too # few observations, we need to reinitialize this components try: cv_chol = linalg.cholesky(cv + min_covar * np.eye(n_dim), lower=True) except linalg.LinAlgError: raise ValueError("'covars' must be symmetric, " "positive-definite") cv_log_det = 2 * np.sum(np.log(np.diagonal(cv_chol))) cv_sol = linalg.solve_triangular(cv_chol, (X - mu).T, lower=True).T log_prob[:, c] = - .5 * (np.sum(cv_sol ** 2, axis=1) + n_dim * np.log(2 * np.pi) + cv_log_det) return log_prob """Find argument (pos) that has the maximum value in array-like object""" def _argmax(self, X): X_max = float("-inf") pos = 0 for i in range(X.shape[0]): if X[i] > X_max: X_max = X[i] pos = i return pos """Find max value in array-like object""" def _max(self, X): return X[self._argmax(X)] """Backtracking process to decode most-likely state sequence""" def _optim_backtrack(self, k): opt = [] self.last_state = where_from = self._argmax(self.viterbi_path[k]) opt.append(where_from) for lp in range(k-1, -1, -1): opt.insert(0, self.backtrack[lp + 1][where_from]) where_from = self.backtrack[lp + 1][where_from] self.global_path.extend(opt) return opt '''Forward-only decoding approach''' def _run_fov(self, test_set): # Probability distribution of state given observation framelogprob = self.log_multivariate_normal_density(np.array([test_set])) if self.first_eval: for i in range(self.n_states): self.viterbi_path[0, i] = self.log_startprob[i] + framelogprob[0, i] self.first_eval = False return self._argmax(self.viterbi_path[0]) else: # Recursion for i in range(self.n_states): for j in range(self.n_states): self.work_buffer[j] = (self.log_transmat[j, i] + self.viterbi_path[0, j]) self.viterbi_path[1, i] = self._max(self.work_buffer) + framelogprob[0, i] self.viterbi_path[0] = self.viterbi_path[1] # Prepare for next feature vector return self._argmax(self.viterbi_path[1]) '''Bounded sliding variable window approach''' def _run_bvsw(self, test_set): framelogprob = self.log_multivariate_normal_density(np.array([test_set])) if self.first_eval: for i in range(self.n_states): self.viterbi_path[0,i] = self.log_startprob[i] + framelogprob[0,i] self.backtrack[0][i] = None self.first_eval = False return [] else: '''Find likelihood probability and backpointer''' for j in range(self.n_states): for i in range(self.n_states): self.work_buffer[i] = self.viterbi_path[self.boundary - 1][i] + self.log_transmat[i, j] self.viterbi_path[self.boundary][j] = self._max(self.work_buffer) + framelogprob[0][j] self.backtrack[self.boundary][j] = self._argmax(self.work_buffer) '''Backtracking local paths''' local_paths = [[] for x in range(self.n_states)] for j in range(self.n_states): where_from = j for smp in range(self.boundary-1, -1, -1): local_paths[j].insert(0, self.backtrack[smp+1][where_from]) where_from = self.backtrack[smp+1][where_from] # if self.verbose: # print "\n{}, {}".format(t, b) # for path in local_paths: # print path '''Given all local paths, find fusion point''' tmp = [None] * self.n_states for k in range(len(local_paths[0])-1, 0, -1): for st in range(self.n_states): tmp[st] = local_paths[st][k] if tmp.count(tmp[0]) == len(tmp): # All local paths point to only one state? self.conv_found = True self.conv_point = k # if self.verbose: print "Found, {}".format(k) break '''Find local path if fusion point was found''' if self.boundary < self.max_win_len and self.conv_found: self.buff_len += self.conv_point opt = self._optim_backtrack(self.conv_point) self.conv_found = False # if self.verbose: print "\nOpt1: " + str(opt) + ", {}".format(len(self.global_path)) '''Reinitialize local variables''' for i in range(self.n_states): if i == self.last_state: self.log_startprob[i] = ln(1.0) else: self.log_startprob[i] = ln(0.0) self.viterbi_path[0][i] = self.log_startprob[i] + framelogprob[0][i] self.backtrack[0][i] = None for smp in range(1, self.boundary-self.conv_point+1): for j in range(self.n_states): for i in range(self.n_states): self.work_buffer[i] = self.viterbi_path[smp - 1][i] + self.log_transmat[i, j] self.viterbi_path[smp][j] = self._max(self.work_buffer) + self.log_multivariate_normal_density(np.array([self.obs[self.conv_point-self.boundary+smp-1]]))[0,j] self.backtrack[smp][j] = self._argmax(self.work_buffer) self.boundary -= self.conv_point-1 return opt elif self.boundary >= self.max_win_len: '''Bounding threshold was exceeded''' self.buff_len += self.max_win_len opt = self._optim_backtrack(self.boundary-1) # if self.verbose: print "\nOpt2: " + str(opt) + ", {}".format(len(self.global_path)) '''Reinitialize local variables''' self.boundary = 1 for i in range(self.n_states): if i == self.last_state: self.log_startprob[i] = ln(1.0) else: self.log_startprob[i] = ln(0.0) self.viterbi_path[0][i] = self.log_startprob[i] + framelogprob[0][i] self.backtrack[0][i] = None return opt else: self.boundary += 1 return []
utr_model.add_state(exon_state) utr_model.add_state(intron_state) add_sequence(utr_model, donor_states) add_sequence(utr_model, acceptor_states) add_sequence(utr_model, intron_spacer_states) utr_model.add_transition(utr_model.start, get_state(promoter_model, 'back'), 1) utr_model.add_transition(get_state(promoter_model, 'inr7'), exon_state, 1) utr_model.add_transition(get_state(promoter_model, 'no inr7'), exon_state, 1) utr_model.add_transition(exon_state, exon_state, 0.7) utr_model.add_transition(exon_state, donor_states[0], 0.2) utr_model.add_transition(exon_state, utr_model.end, 0.1) utr_model.add_transition(donor_states[-1], intron_state, 1) utr_model.add_transition(intron_state, intron_state, 0.5) utr_model.add_transition(intron_state, intron_spacer_states[0], 0.5) utr_model.add_transition(intron_spacer_states[-1], acceptor_states[0], 1) utr_model.add_transition(acceptor_states[-1], exon_state, 1) utr_model.bake() # print(utr_model.states) with open('utr_model_base.json', 'w', encoding='utf-8') as out: out.write(utr_model.to_json())