from client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") #Parameters of the server to talk to IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) print('Response:', c.talk('Sending a message to the server...'))
from client0 import Client PRACTICE = 2 EXERCISE = 3 print("-----| Practice {PRACTICE} Exercise {EXERCISE} |-----") PORT = 6123 IP = "127.0.0.1" c = Client(IP, PORT) print("Response: ", c.talk("Hello"))
from client0 import Client from pathlib import Path import termcolor import colorama PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") #Parameters of the server to talk to IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) colorama.init(strip='False') print('Response:', c.talk('Sending the U5 gene to the server...')) print('From server:', c.talk(Path('U5.txt').read_text())) #Leer el contenido de un FASTA FILE
fragment1, fragment2, fragment3, fragment4, fragment5, fragment6, fragment7, fragment8, fragment9, fragment10 ] i = 0 f = 0 while f < len(fragments): sequence = str(s) fragments[f] += sequence[i] i += 1 if i % 10 == 0: f += 1 #connecting c1 = Client(IP, PORT1) c2 = Client(IP, PORT2) r = 0 while r < len(fragments): if r % 2 == 0 or r == 0: c1.talk(fragments[r]) else: c2.talk(fragments[r]) r += 1 #print print("Gene FRAT1:", s) for frag in fragments: print(frag)
from client0 import Client from pathlib import Path PRACTICE = 2 EXERCISE = 5 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.12" PORT = 12000 # -- Create a client object c = Client(IP, PORT) print(c.talk("Sending the U5 Gene to the server...")) print(c.talk(Path("U5.txt").read_text()))
from client0 import Client PRACTICE = 2 EXERCISE = 1 print(f"-----| Practice {2}, Exercise {3} |------") IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) print("Sending a message to the server...") response = c.talk("Yes, this is working yuhuuuuu!!!") print(response)
PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") #Parameters of the server to talk to IP = "127.0.0.1" PORT = 12000 c = Client(IP, PORT) s = Seq( ) #Crea una null sequence - objeto, dentro del objeto se guardan .strbases y lo que haya en el innit s.seq_read_fasta( '../Session-04/FRAT1.txt' ) #usa un method de esa class, y lo que hace es leer un archivo FASTA quitandole la primera línea count = 0 i = 0 while i < len(s.strbases) and count < 5: colorama.init(strip='False') fragment = s.strbases[i:i + 10] #cogemos 10 bases count += 1 i += 10 print('Fragment', count, ':', termcolor.colored(fragment, 'green')) #print en el client print( c.talk( termcolor.colored('Fragment ' + str(count) + ':' + fragment, 'green'))) #Para mandar los fragmentos al server #Dentro del loop que si no solo vamos a mandar el ult fragment
from client0 import Client PRACTICE = 2 EXERCISE = 3 print("-----| Practice {PRACTICE} Exercise {EXERCISE} |-----") PORT = 6123 IP = "127.0.0.1" c= Client(IP, PORT) print(c.talk("Sending the U5 Gene to the server...")) print(c.talk(Path("./P2/U5.txt").read_text())) #We dont have this U5 so no working :/ print(c.talk(Path("U5.txt").read_text()))
PRACTICE = 2 EXERCISE = 1 from client0 import Client PRACTICE = 2 EXERCISE = 3 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.12" PORT = 12000 # -- Create a client object c = Client(IP, PORT) print("Response;", c.talk("This is something random"))
EXT = ".txt" GENE = "FRAT1" c1 = Client(IP, PORT) c2 = Client(IP, PORT + 1) print(c1) print(c2) s = Seq().read_fasta(FOLDER + GENE + EXT) bases = str(s) print(f"Gene {GENE}: {bases}") LENGTH = 10 init_msg = f"Sending {GENE} Gene to the server, in fragments of {LENGTH} bases..." c1.talk(init_msg) c2.talk(init_msg) for i in range(10): frag = bases[i * LENGTH:(i + 1) * LENGTH] print(f"Fragment {i+1}: {frag}") msg = f"Fragment {i+1}: {frag}" if i % 2: c2.talk(msg) else: c1.talk(msg)
from client0 import Client print(f"-----| Practice 3, Exercise 7 |------") IP = "127.0.0.1" PORT = 8080 c = Client(IP, PORT) print(c) print("* Testing PING...") print(c.talk("PING")) print("* Testing GET...") for i in range(5): cmd = f"GET {i}" print(f"{cmd}: {c.talk(cmd)}", end="") seq = c.talk("GET 0") print() print("Testing INFO...") cmd = f"INFO {seq}" print(c.talk(cmd)) print("Testing COMP...") cmd = f"COMP {seq}" print(cmd, end="") print(c.talk(cmd)) print("Testing REV...") cmd = f"REV {seq}"
print("Practice 3, Exercise CLIENT SERVER") # Parameters for the server IP = "127.0.0.1" PORT = 8080 # Creating a client object c = Client(IP, PORT) sequence = "GATGGATGGAGAGGATAGATAGAGATAGATAGAGAG" print("Connection to SERVER at", IP, ", PORT: ", PORT) # TEST PING print("* Testing PING...") print(c.talk("PING")) # TEST GET print("* Testing GET...") print("GET 0:", c.talk("GET 0")) print("GET 1:", c.talk("GET 1")) print("GET 2:", c.talk("GET 2")) print("GET 3:", c.talk("GET 3")) print("GET 4:", c.talk("GET 4")) # TEST INFO print("* Testing INFO...") print(c.talk("INFO " + sequence)) # TEST COMP print("* Testing COMP...")
from client0 import Client from Seq1 import Seq PRACTICE = 2 EXERCISE = 6 print("-----| Practice ", PRACTICE, "Exercise ", EXERCISE, " |------") IP = "127.0.0.1" PORT = 8080 FOLDER = "../Session-04/" EXT = ".txt" GENE = "FRAT1" c = Client(IP, PORT) print(c) s = Seq().read_fasta(FOLDER + GENE + EXT) bases = str(s) print(f"Gene {GENE}: {bases}") LENGTH = 10 c.talk(f"Sending {GENE} Gene to the server, in fragments of {LENGTH} bases...") for i in range(5): frag = bases[i * LENGTH:(i + 1) * LENGTH] print(f"Fragment {i+1}: {frag}") c.talk(f"Fragment {i+1}: {frag}")
from client0 import Client from pathlib import Path from Seq02 import Seq PRACTICE = 2 EXERCISE = 6 print(f"-----| Practice {PRACTICE}, Exercise {EXERCISE} |------") # -- Parameters of the server to talk to IP = "192.168.1.12" PORT = 12000 # -- Create a client object c = Client(IP, PORT) s = Seq() s.read_fasta("FRAT1.txt") count = 0 for i in range(0, len(s.strbases), 10): fragment = s.strbases[i:i + 10] print(fragment) count = count + 1 if count == 5: break print("Fragment", count, ":", fragment) print(c.talk(fragment))
from client0 import Client print("Practice 2, Exercise 3") #Parameters of the server to talk to IP = "192.168.0.29" PORT = 8080 #Create a client object c = Client(IP, PORT) #Send a message to the server print("Sending a message to the server...") response = c.talk("Testing!") print(f"Response: {response}")
PORT = 8080 #El port no tiene que ser usado por ninguna aplicación más IP = "localhost" client = Client(IP, PORT) #Client creado correct = True while correct: msg = input('Enter here the command you want to test: ').replace( ' ', '').upper() if msg == 'EXIT': print('The process has finished correctly.') correct = False elif msg == 'PING': client.talk(msg) elif msg == 'GET': for i in range(0, 5): client.talk(msg + ' ' + str(i)) elif msg == 'INFO' or msg == 'COMP' or msg == 'REV': msg = msg + ' ' + str('AAACCCTTTT') #client.talk('GET 0') client.talk(msg) elif msg == 'GENE': list_gene_names = ['U5', 'ADA', 'FRAT1', 'FXN', 'RNU6_269P'] for i in list_gene_names: client.talk(msg + ' ' + str(i)) else:
from client0 import Client PRACTICE = 2 EXERCISE = 3 print("-----| Practice {PRACTICE} Exercise {EXERCISE} |-----") PORT = 6123 PORT2 = 12300 IP = "127.0.0.1" c = Client(IP, PORT) c_2 = Client(IP, PORT2) s = Seq() s.seq_read_fasta('../Session-04/FRAT!.txt') count = 0 i = 0 while i < len(s.strbases) and count < 5: fragment = s.strbases[i:i + 10] count += 1 i += 10 print("Fragment", count, ":", fragment) if count % 2 == 0: print(c_2.talk("Fragment", str(count), ":", fragment)) else: print(c.talk("Fragment", str(count), ":", fragment))
# Creating fragments of length 10 fragment1 = "Fragment 1: " fragment2 = "Fragment 2: " fragment3 = "Fragment 3: " fragment4 = "Fragment 4: " fragment5 = "Fragment 5: " fragments = [fragment1, fragment2, fragment3, fragment4, fragment5] i = 0 f = 0 while f < len(fragments): sequence = str(s) fragments[f] += sequence[i] i += 1 if i % 10 == 0: f += 1 #connect c = Client(IP, PORT) c.talk(fragments[0]) c.talk(fragments[1]) c.talk(fragments[2]) c.talk(fragments[3]) c.talk(fragments[4]) #Print print("Gene FRAT1:", s) for frag in fragments: print(frag)
from Seq1 import Seq from client0 import Client print("-----| Practice 3, Exercise 7 |------") PORT = 8989 IP = "127.0.0.1" c = Client(IP, PORT) print(c) print("* Testing PING...") print(c.talk("PING")) print("* Testing GET...") print(f"GET 0: {c.talk('GET 0')}") print(f"GET 1: {c.talk('GET 1')}") print(f"GET 2: {c.talk('GET 2')}") print(f"GET 3: {c.talk('GET 3')}") print(f"GET 4: {c.talk('GET 4')}") print("* Testing INFO...") print(c.talk('INFO ATTCGATGTGCTAGTCGATGCTGTGTACGTCAGTCAGTCGAT')) print("* Testing COMP...") print(c.talk('COMP ATTCGATGTGCTAGTCGATGCTGTGTACGTCAGTCAGTCGAT')) print("* Testing REV...") print(c.talk('REV ATTCGATGTGCTAGTCGATGCTGTGTACGTCAGTCAGTCGAT')) print("* Testing GENE...") print("GENE U5") print(c.talk("GENE U5")) print("GENE ADA") print(c.talk("GENE ADA"))