def test_score_no_trans_table(self): """score: should work when no translation table is present """ p = Profile(Data=array([[-1, 0, 1, 2], [-2, 2, 0, 0], [-3, 5, 1, 0]]), Alphabet=DNA, CharOrder="ATGC") # remove translation table del p.__dict__["_translation_table"] # then score the profile s1 = p.score(DNA.Sequence("ATTCAC"), offset=0) self.assertEqual(s1, [6, 2, -3, 0])
def test_score_no_trans_table(self): """score: should work when no translation table is present """ p = Profile(Data=array([[-1,0,1,2],[-2,2,0,0],[-3,5,1,0]]),\ Alphabet=DNA, CharOrder="ATGC") # remove translation table del p.__dict__['_translation_table'] # then score the profile s1 = p.score(DNA.Sequence("ATTCAC"),offset=0) self.assertEqual(s1, [6,2,-3,0])
class ProfileTests(TestCase): """Tests for Profile object""" def setUp(self): """setUp method for all Profile tests""" self.full = Profile(array([[2, 4], [3, 5], [4, 8]]), "AB") self.empty = Profile(array([[]]), "AB") self.empty_row = Profile(array([[1, 1], [0, 0]]), "AB") self.empty_col = Profile(array([[0, 1], [0, 1]]), "AB") self.consensus = Profile( array([[0.2, 0, 0.8, 0], [0, 0.1, 0.2, 0.7], [0, 0, 0, 1], [0.2, 0.3, 0.4, 0.1], [0.5, 0.5, 0, 0]]), Alphabet=DNA, CharOrder="TCAG", ) self.not_same_value = Profile( array([[0.3, 0.5, 0.1, 0.1], [0.4, 0.6, 0, 0.7], [0.3, 0.2, 0, 0], [0, 0, 4, 0]]), Alphabet=DNA, CharOrder="TCAG", ) self.zero_entry = Profile(array([[0.3, 0.2, 0, 0.5], [0, 0, 0.8, 0.2]]), Alphabet="UCAG") self.score1 = Profile(Data=array([[-1, 0, 1, 2], [-2, 2, 0, 0], [-3, 5, 1, 0]]), Alphabet=DNA, CharOrder="ATGC") self.score2 = Profile(array([[0.2, 0.4, 0.4, 0], [0.1, 0, 0.9, 0], [0.1, 0.2, 0.3, 0.4]]), Alphabet="TCAG") self.oned = Profile(array([0.25, 0.25, 0.25, 0.25]), "ABCD") self.pp = Profile(array([[1, 2, 3, 4], [5, 6, 7, 8], [9, 10, 11, 12]]), "ABCD") def test_init(self): """__init__: should set all attributed correctly""" self.assertRaises(TypeError, Profile) self.assertRaises(TypeError, Profile, array([[2, 3]])) # only alphabet p = Profile(array([[0.2, 0.8], [0.7, 0.3]]), "AB") self.assertEqual(p.Data, [[0.2, 0.8], [0.7, 0.3]]) self.assertEqual(p.Alphabet, "AB") self.assertEqual(p.CharOrder, list("AB")) self.assertEqual(translate("ABBA", p._translation_table), "\x00\x01\x01\x00") # alphabet and char order p = Profile(array([[0.1, 0.2], [0.4, 0.3]]), Alphabet=DNA, CharOrder="AG") self.assertEqual(p.CharOrder, "AG") assert p.Alphabet is DNA # non-character alphabet p = Profile(array([[0.1, 0.2], [0.4, 0.3]]), Alphabet=[7, 3], CharOrder=[3, 7]) self.assertEqual(p.CharOrder, [3, 7]) self.assertEqual(p.Alphabet, [7, 3]) self.assertEqual(p.Data, [[0.1, 0.2], [0.4, 0.3]]) def test_str(self): """__str__: should return string representation of data in profile """ self.assertEqual(str(self.empty_row), str(array([[1, 1], [0, 0]]))) def test_make_translation_table(self): """_make_translation_table: should return correct table from char order """ p = Profile(array([[0.2, 0.8], [0.7, 0.3]]), "ABCDE", "AB") self.assertEqual(translate("ABBA", p._translation_table), "\x00\x01\x01\x00") def test_hasValidData(self): """hasValidData: should work on full and empty profiles""" full = self.full.copy() full.normalizePositions() self.assertEqual(full.hasValidData(), True) self.assertEqual(self.empty_row.hasValidData(), False) self.assertEqual(self.empty.hasValidData(), False) def test_hasValidAttributes(self): """hasValidAttributes: should work for different alphabets/char orders """ p = Profile(array([[1, 2], [3, 4]]), Alphabet="ABCD", CharOrder="BAC") # self.Data doesn't match len(CharOrder) self.assertEqual(p.hasValidAttributes(), False) p = Profile(array([[1, 2], [3, 4]]), Alphabet="ABCD", CharOrder="AX") # not all chars in CharOrder in Alphabet self.assertEqual(p.hasValidAttributes(), False) p = Profile(array([[1, 2], [3, 4]]), Alphabet="ABCD", CharOrder="CB") # should be fine self.assertEqual(p.hasValidAttributes(), True) def test_isValid(self): """isValid: should work as expected""" # everything valid p1 = Profile(array([[0.3, 0.7], [0.8, 0.2]]), Alphabet="AB", CharOrder="AB") # invalid data, valid attributes p2 = Profile(array([[1, 2], [3, 4]]), Alphabet="ABCD", CharOrder="BA") # invalid attributes, valid data p3 = Profile(array([[0.3, 0.7], [0.8, 0.2]]), Alphabet="ABCD", CharOrder="AF") self.assertEqual(p1.isValid(), True) self.assertEqual(p2.isValid(), False) self.assertEqual(p3.isValid(), False) def test_dataAt(self): """dataAt: should work on valid position and character""" p = Profile(array([[0.2, 0.4, 0.4, 0], [0.1, 0, 0.9, 0], [0.1, 0.2, 0.3, 0.4]]), Alphabet="TCAG") self.assertEqual(p.dataAt(0, "C"), 0.4) self.assertEqual(p.dataAt(1, "T"), 0.1) self.assertRaises(ProfileError, p.dataAt, 1, "U") self.assertRaises(ProfileError, p.dataAt, -2, "T") self.assertRaises(ProfileError, p.dataAt, 5, "T") def test_copy(self): """copy: should act as expected while rebinding/modifying attributes """ p = Profile(array([[1, 1], [0.7, 0.3]]), {"A": "A", "G": "G", "R": "AG"}, "AG") p_copy = p.copy() assert p.Data is p_copy.Data assert p.Alphabet is p_copy.Alphabet assert p.CharOrder is p_copy.CharOrder # modifying p.Data modifies p_copy.Data p.Data[1, 1] = 100 assert p.Alphabet is p_copy.Alphabet # normalizing p.Data rebinds it, so p_copy.Data is unchanged p.normalizePositions() assert not p.Data is p_copy.Data # Adding something to the alphabet changes both p and p_copy p.Alphabet["Y"] = "TC" assert p.Alphabet is p_copy.Alphabet # Rebinding the CharOrder does only change the original p.CharOrder = "XX" assert not p.CharOrder is p_copy.CharOrder def test_normalizePositions(self): """normalizePositions: should normalize or raise appropriate error """ p = self.full.copy() p.normalizePositions() self.assertEqual(p.Data, array([[2 / 6, 4 / 6], [3 / 8, 5 / 8], [4 / 12, 8 / 12]])) self.assertEqual(sum(p.Data, 1), [1, 1, 1]) p = self.empty_col.copy() p.normalizePositions() self.assertEqual(p.Data, array([[0, 1], [0, 1]])) p = self.empty_row.copy() self.assertRaises(ProfileError, p.normalizePositions) p = Profile(array([[0.0, 0.0]]), "AB") self.assertRaises(ProfileError, p.normalizePositions) # negative numbers!!!!!! p1 = Profile(array([[3, -2], [4, -3]]), "AB") p1.normalizePositions() self.assertEqual(p1.Data, array([[3, -2], [4, -3]])) p2 = Profile(array([[3, -3], [4, -3]]), "AB") self.assertRaises(ProfileError, p2.normalizePositions) def test_normalizeSequences(self): """normalizeSequences: should normalize or raise appropriate error """ p = self.full.copy() p.normalizeSequences() self.assertEqual(p.Data, array([[2 / 9, 4 / 17], [3 / 9, 5 / 17], [4 / 9, 8 / 17]])) self.assertEqual(sum(p.Data, axis=0), [1, 1]) p = self.empty_row.copy() p.normalizeSequences() self.assertEqual(p.Data, array([[1, 1], [0, 0]])) p = self.empty_col.copy() self.assertRaises(ProfileError, p.normalizeSequences) p = Profile(array([[0.0], [0.0]]), "AB") self.assertRaises(ProfileError, p.normalizeSequences) # negative numbers!!!!!! p1 = Profile(array([[3, 4], [-2, -3]]), "AB") p1.normalizeSequences() self.assertEqual(p1.Data, array([[3, 4], [-2, -3]])) p2 = Profile(array([[3, 4], [-3, -3]]), "AB") self.assertRaises(ProfileError, p2.normalizeSequences) def test_prettyPrint_without_parameters(self): """prettyPrint: should work without parameters passed in""" p = self.full self.assertEqual(p.prettyPrint(), "2\t4\n3\t5\n4\t8") self.assertEqual(p.prettyPrint(include_header=True), "A\tB\n2\t4\n3\t5\n4\t8") self.assertEqual(p.prettyPrint(transpose_data=True), "2\t3\t4\n4\t5\t8") self.assertEqual(p.prettyPrint(include_header=True, transpose_data=True), "A\t2\t3\t4\nB\t4\t5\t8") # empty self.assertEqual(self.empty.prettyPrint(), "") self.assertEqual(self.empty.prettyPrint(transpose_data=True), "") # it will still print with invalid data (e.g if len(CharOrder) # doesn't match the data p = self.full.copy() p.CharOrder = "ABC" self.assertEqual(p.prettyPrint(include_header=True), "A\tB\tC\n2\t4\t \n3\t5\t \n4\t8\t ") # it will truncate the CharOrder if data is transposed # and CharOrder is longer then the number of rows in the # transposed data self.assertEqual(p.prettyPrint(include_header=True, transpose_data=True), "A\t2\t3\t4\nB\t4\t5\t8") def test_prettyPrint_four_cases(self): """prettyPrint: with/without header/transpose/limit""" p = self.full p = self.pp self.assertEqual(p.prettyPrint(), "1\t 2\t 3\t 4\n5\t 6\t 7\t 8\n9\t10\t11\t12") self.assertEqual(p.prettyPrint(column_limit=3), "1\t 2\t 3\n5\t 6\t 7\n9\t10\t11") self.assertEqual( p.prettyPrint(column_limit=3, include_header=True), "A\t B\t C\n1\t 2\t 3\n5\t 6\t 7\n9\t10\t11" ) self.assertEqual( p.prettyPrint(column_limit=3, include_header=False, transpose_data=True), "1\t5\t 9\n2\t6\t10\n3\t7\t11\n4\t8\t12", ) self.assertEqual( p.prettyPrint(column_limit=2, include_header=False, transpose_data=True), "1\t5\n2\t6\n3\t7\n4\t8" ) self.assertEqual( p.prettyPrint(column_limit=3, include_header=True, transpose_data=True), "A\t1\t5\nB\t2\t6\nC\t3\t7\nD\t4\t8", ) def test_reduce_wrong_size(self): """reduce: should fail when profiles have different sizes""" p1 = Profile(array([[1, 0], [0, 1]]), Alphabet="AB") p2 = Profile(array([[1, 0, 0], [1, 0, 0]]), Alphabet="ABC") self.assertRaises(ProfileError, p1.reduce, p2) def test_reduce_normalization_error(self): """reduce: fails when input or output can't be normalized""" # Will raise errors when input data can't be normalized self.assertRaises(ProfileError, self.empty.reduce, self.empty, add) self.assertRaises(ProfileError, self.full.reduce, self.empty_row, add) # don't normalize input, but do normalize output # fails when one row adds up to zero p1 = Profile(array([[3, 3], [4, 4]]), "AB") p2 = Profile(array([[3, 3], [-4, -4]]), "AB") self.assertRaises(ProfileError, p1.reduce, p2, add, False, True) def test_reduce_operators(self): """reduce: should work fine with different operators """ # different operators, normalize input, don't normalize output p1 = Profile(array([[1, 0, 0], [0, 1, 0]]), Alphabet="ABC") p2 = Profile(array([[1, 0, 0], [0, 0, 1]]), Alphabet="ABC") self.assertEqual(p1.reduce(p2).Data, array([[1, 0, 0], [0, 0.5, 0.5]])) self.assertEqual( p1.reduce(p2, add, normalize_input=True, normalize_output=False).Data, array([[2, 0, 0], [0, 1, 1]]) ) self.assertEqual( p1.reduce(p2, subtract, normalize_input=True, normalize_output=False).Data, array([[0, 0, 0], [0, 1, -1]]) ) self.assertEqual( p1.reduce(p2, multiply, normalize_input=True, normalize_output=False).Data, array([[1, 0, 0], [0, 0, 0]]) ) self.assertRaises(ProfileError, p1.reduce, p2, divide, normalize_input=True, normalize_output=False) # don't normalize and normalize only input p3 = Profile(array([[1, 2], [3, 4]]), Alphabet="AB") p4 = Profile(array([[4, 3], [2, 1]]), Alphabet="AB") self.assertEqual( p3.reduce(p4, add, normalize_input=False, normalize_output=False).Data, array([[5, 5], [5, 5]]) ) self.assertFloatEqual( p3.reduce(p4, add, normalize_input=True, normalize_output=False).Data, array([[19 / 21, 23 / 21], [23 / 21, 19 / 21]]), ) # normalize input and output p5 = Profile(array([[1, 1, 0, 0], [1, 1, 1, 1]]), Alphabet="ABCD") p6 = Profile(array([[1, 0, 0, 0], [1, 0, 0, 1]]), Alphabet="ABCD") self.assertEqual( p5.reduce(p6, add, normalize_input=True, normalize_output=True).Data, array([[0.75, 0.25, 0, 0], [0.375, 0.125, 0.125, 0.375]]), ) # it can collapse empty profiles when normalizing is turned off self.assertEqual( self.empty.reduce(self.empty, normalize_input=False, normalize_output=False).Data.tolist(), [[]] ) # more specific tests of the operators will be in the # separate functions def test__add_(self): """__add__: should not normalize input or output, just add""" p1 = Profile(array([[0.3, 0.4, 0.1, 0], [0.1, 0.1, 0.1, 0.7]]), Alphabet="ABCD") p2 = Profile(array([[1, 0, 0, 0], [1, 0, 0, 1]]), Alphabet="ABCD") self.assertEqual((p1 + p2).Data, array([[1.3, 0.4, 0.1, 0], [1.1, 0.1, 0.1, 1.7]])) self.assertRaises(ProfileError, self.empty.__add__, p1) self.assertEqual((self.empty + self.empty).Data.tolist(), [[]]) def test__sub_(self): """__sub__: should subtract two profiles, no normalization""" p1 = Profile(array([[0.3, 0.4, 0.1, 0], [0.1, 0.1, 0.1, 0.7]]), Alphabet="ABCD") p2 = Profile(array([[1, 0, 0, 0], [1, 0, 0, 1]]), Alphabet="ABCD") self.assertFloatEqual((p1 - p2).Data, array([[-0.7, 0.4, 0.1, 0], [-0.9, 0.1, 0.1, -0.3]])) def test__mul_(self): """__mul__: should multiply two profiles, no normalization""" p1 = Profile(array([[1, -2, 3, 0], [1, 1, 1, 0.5]]), Alphabet="ABCD") p2 = Profile(array([[1, 0, 0, 0], [1, 0, 3, 2]]), Alphabet="ABCD") self.assertEqual((p1 * p2).Data, array([[1, 0, 0, 0], [1, 0, 3, 1]])) def test__div_(self): """__div__ and __truediv__: always true division b/c __future__.division """ p1 = Profile(array([[2, 3], [4, 5]]), "AB") p2 = Profile(array([[1, 0], [4, 5]]), "AB") # Int 0 p3 = Profile(array([[1, 0.0], [4, 5]]), "AB") # Float 0.0 p4 = Profile(array([[1, 2], [8.0, 5]]), "AB") # Float 0.0 self.assertRaises(ProfileError, p1.__truediv__, p2) # infinity in result data self.assertRaises(ProfileError, p1.__div__, p3) self.assertFloatEqual((p1.__div__(p4)).Data, array([[2, 1.5], [0.5, 1]])) def test_distance(self): """distance: should return correct distance between the profiles """ p1 = Profile(array([[2, 4], [3, 1]]), "AB") p2 = Profile(array([[4, 6], [5, 3]]), "AB") p3 = Profile(array([[4, 6], [5, 3], [1, 1]]), "AB") p4 = Profile(array([2, 2]), "AB") p5 = Profile(array([2, 2, 2]), "AB") p6 = Profile(array([[]]), "AB") self.assertEqual(p1.distance(p2), 4) self.assertEqual(p2.distance(p1), 4) self.assertEqual(p1.distance(p4), sqrt(6)) self.assertEqual(p6.distance(p6), 0) # Raises error when frames are not aligned self.assertRaises(ProfileError, p1.distance, p3) self.assertRaises(ProfileError, p1.distance, p5) def test_toOddsMatrix(self): """toOddsMatrix: should work on valid data or raise an error """ p = Profile( array( [ [0.1, 0.3, 0.5, 0.1], [0.25, 0.25, 0.25, 0.25], [0.05, 0.8, 0.05, 0.1], [0.7, 0.1, 0.1, 0.1], [0.6, 0.15, 0.05, 0.2], ] ), Alphabet="ACTG", ) p_exp = Profile( array([[0.4, 1.2, 2, 0.4], [1, 1, 1, 1], [0.2, 3.2, 0.2, 0.4], [2.8, 0.4, 0.4, 0.4], [2.4, 0.6, 0.2, 0.8]]), Alphabet="ACTG", ) self.assertEqual(p.toOddsMatrix().Data, p_exp.Data) assert p.Alphabet is p.toOddsMatrix().Alphabet self.assertEqual(p.toOddsMatrix([0.25, 0.25, 0.25, 0.25]).Data, p_exp.Data) # fails if symbol_freqs has wrong size self.assertRaises(ProfileError, p.toOddsMatrix, [0.25, 0.25, 0.25, 0.25, 0.25, 0.25]) self.assertRaises(ProfileError, self.zero_entry.toOddsMatrix, [0.1, 0.2, 0.3]) # works on empty profile self.assertEqual(self.empty.toOddsMatrix().Data.tolist(), [[]]) # works with different input self.assertEqual(self.zero_entry.toOddsMatrix().Data, array([[1.2, 0.8, 0, 2], [0, 0, 3.2, 0.8]])) self.assertFloatEqual( self.zero_entry.toOddsMatrix([0.1, 0.2, 0.3, 0.4]).Data, array([[3, 1, 0, 1.25], [0, 0, 2.667, 0.5]]), 1e-3 ) # fails when one of the background frequencies is 0 self.assertRaises(ProfileError, self.zero_entry.toOddsMatrix, [0.1, 0.2, 0.3, 0]) def test_toLogOddsMatrix(self): """toLogOddsMatrix: should work as expected""" # This test can be short, because it mainly depends on toOddsMatrix # for which everything has been tested p = Profile( array( [ [0.1, 0.3, 0.5, 0.1], [0.25, 0.25, 0.25, 0.25], [0.05, 0.8, 0.05, 0.1], [0.7, 0.1, 0.1, 0.1], [0.6, 0.15, 0.05, 0.2], ] ), Alphabet="ACTG", ) p_exp = Profile( array( [ [-1.322, 0.263, 1.0, -1.322], [0.0, 0.0, 0.0, 0.0], [-2.322, 1.678, -2.322, -1.322], [1.485, -1.322, -1.322, -1.322], [1.263, -0.737, -2.322, -0.322], ] ), Alphabet="ACTG", ) self.assertFloatEqual(p.toLogOddsMatrix().Data, p_exp.Data, eps=1e-3) # works on empty matrix self.assertEqual(self.empty.toLogOddsMatrix().Data.tolist(), [[]]) def test__score_indices(self): """_score_indices: should work on valid input""" self.assertEqual(self.score1._score_indices(array([0, 1, 1, 3, 0, 3]), offset=0), [6, 2, -3, 0]) self.assertFloatEqual( self.score2._score_indices(array([3, 1, 2, 0, 2, 2, 3]), offset=0), [0.3, 1.4, 0.8, 1.4, 1.7] ) self.assertFloatEqual(self.score2._score_indices(array([3, 1, 2, 0, 2, 2, 3]), offset=3), [1.4, 1.7]) # Errors will be raised on invalid input. Errors are not handled # in this method. Validation of the input is done elsewhere self.assertRaises(IndexError, self.score2._score_indices, array([3, 1, 63, 0, 4, 2, 3]), offset=3) def test__score_profile(self): """_score_profile: should work on valid input""" p1 = Profile( array([[1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0.5, 0.5], [0, 0, 0, 1], [0.25, 0.25, 0.25, 0.25]]), "TCAG" ) p2 = Profile( array( [[0, 1, 0, 0], [0.2, 0, 0.8, 0], [0, 0, 0.5, 0.5], [1 / 3, 1 / 3, 0, 1 / 3], [0.25, 0.25, 0.25, 0.25]] ), "TCAG", ) self.assertFloatEqual(self.score2._score_profile(p1, offset=0), [0.55, 1.25, 0.45]) self.assertFloatEqual(self.score2._score_profile(p1, offset=2), [0.45]) self.assertFloatEqual(self.score2._score_profile(p2, offset=0), [1.49, 1.043, 0.483], 1e-3) # Errors will be raised on invalid input. Errors are not handled # in this method. Validation of the input is done elsewhere # In this case you don't get an error, but for sure an unexpected # result self.assertFloatEqual(self.score2._score_profile(p1, offset=3).tolist(), []) def test_score_sequence(self): """score: should work correctly for Sequence as input """ # works on normal valid data s1 = self.score1.score("ATTCAC", offset=0) self.assertEqual(s1, [6, 2, -3, 0]) self.assertFloatEqual(self.score2.score("TCAAGT", offset=0), [0.5, 1.6, 1.7, 0.5]) # works with different offset self.assertFloatEqual(self.score2.score("TCAAGT", offset=2), [1.7, 0.5]) self.assertFloatEqual(self.score2.score("TCAAGT", offset=3), [0.5]) # raises error on invalid offset self.assertRaises(ProfileError, self.score2.score, "TCAAGT", offset=4) # works on seq of minimal length self.assertFloatEqual(self.score2.score("AGT", offset=0), [0.5]) # raises error when sequence is too short self.assertRaises(ProfileError, self.score2.score, "", offset=0) # raises error on empty profile self.assertRaises(ProfileError, self.empty.score, "ACGT") # raises error when sequence contains characters that # are not in the characterorder self.assertRaises(ProfileError, self.score2.score, "ACBRT") def test_score_sequence_object(self): """score: should work correctly on Sequence object as input """ # DnaSequence object ds = self.score1.score(DNA.Sequence("ATTCAC"), offset=0) self.assertEqual(ds, [6, 2, -3, 0]) # ModelSequence object ms = self.score1.score(ModelSequence("ATTCAC", Alphabet=DNA.Alphabet), offset=0) self.assertEqual(ms, [6, 2, -3, 0]) def test_score_no_trans_table(self): """score: should work when no translation table is present """ p = Profile(Data=array([[-1, 0, 1, 2], [-2, 2, 0, 0], [-3, 5, 1, 0]]), Alphabet=DNA, CharOrder="ATGC") # remove translation table del p.__dict__["_translation_table"] # then score the profile s1 = p.score(DNA.Sequence("ATTCAC"), offset=0) self.assertEqual(s1, [6, 2, -3, 0]) def test_score_profile(self): """score: should work correctly for Profile as input """ p1 = Profile( array([[1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0.5, 0.5], [0, 0, 0, 1], [0.25, 0.25, 0.25, 0.25]]), "TCAG" ) p2 = Profile( array( [[0, 1, 0, 0], [0.2, 0, 0.8, 0], [0, 0, 0.5, 0.5], [1 / 3, 1 / 3, 0, 1 / 3], [0.25, 0.25, 0.25, 0.25]] ), "TCAG", ) p3 = Profile(array([[1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1]]), "TCAG") p4 = Profile(array([[1, 0, 0, 0], [0, 1, 0, 0]]), "TCAG") p5 = Profile(array([[1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1]]), "AGTC") # works on normal valid data self.assertFloatEqual(self.score2.score(p1, offset=0), [0.55, 1.25, 0.45]) self.assertFloatEqual(self.score2.score(p2, offset=0), [1.49, 1.043, 0.483], 1e-3) # works with different offset self.assertFloatEqual(self.score2.score(p1, offset=1), [1.25, 0.45]) self.assertFloatEqual(self.score2.score(p1, offset=2), [0.45]) # raises error on invalid offset self.assertRaises(ProfileError, self.score2.score, p1, offset=3) # works on profile of minimal length self.assertFloatEqual(self.score2.score(p3, offset=0), [0.6]) # raises error when profile is too short self.assertRaises(ProfileError, self.score2.score, p4, offset=0) # raises error on empty profile self.assertRaises(ProfileError, self.empty.score, p1) # raises error when character order doesn't match self.assertRaises(ProfileError, self.score2.score, p5) def test_rowUncertainty(self): """rowUncertainty: should handle full and empty profiles """ p = Profile(array([[0.25, 0.25, 0.25, 0.25], [0.5, 0.5, 0, 0]]), "ABCD") self.assertEqual(p.rowUncertainty(), [2, 1]) # for empty rows 0 is returned as the uncertainty self.assertEqual(self.empty.rowUncertainty().tolist(), []) p = Profile(array([[], [], []]), "") self.assertEqual(p.rowUncertainty().tolist(), []) # doesn't work on 1D array self.assertRaises(ProfileError, self.oned.rowUncertainty) def test_columnUncertainty(self): """columnUncertainty: should handle full and empty profiles """ p = Profile(array([[0.25, 0.5], [0.25, 0.5], [0.25, 0], [0.25, 0]]), "AB") self.assertEqual(p.columnUncertainty(), [2, 1]) # for empty cols nothing is returned as the uncertainty self.assertEqual(self.empty.columnUncertainty().tolist(), []) p = Profile(array([[], [], []]), "") self.assertEqual(p.columnUncertainty().tolist(), []) # doesn't work on 1D array self.assertRaises(ProfileError, self.oned.columnUncertainty) def test_rowDegeneracy(self): """rowDegneracy: should work as expected""" p1 = self.consensus p2 = self.not_same_value self.assertEqual(p1.rowDegeneracy(), [1, 1, 1, 2, 1]) self.assertEqual(p1.rowDegeneracy(cutoff=0.5), [1, 1, 1, 2, 1]) self.assertEqual(p1.rowDegeneracy(cutoff=0.75), [1, 2, 1, 3, 2]) # when a row seems to add up to the cutoff value, it's not # always found because of floating point error. E.g. second row # in this example self.assertEqual(p1.rowDegeneracy(cutoff=1), [2, 4, 1, 4, 2]) # when the cutoff can't be found, the number of columns in the # profile is returned (for each row) self.assertEqual(p1.rowDegeneracy(cutoff=1.5), [4, 4, 4, 4, 4]) self.assertEqual(p2.rowDegeneracy(cutoff=0.95), [4, 2, 4, 1]) self.assertEqual(p2.rowDegeneracy(cutoff=1.4), [4, 3, 4, 1]) self.assertEqual(self.empty.rowDegeneracy(), []) def test_columnDegeneracy(self): """columnDegeneracy: shoudl work as expected""" p1 = self.consensus p1.Data = transpose(p1.Data) p2 = self.not_same_value p2.Data = transpose(p2.Data) p1d = p1.columnDegeneracy() self.assertEqual(p1d, [1, 1, 1, 2, 1]) self.assertEqual(p1.columnDegeneracy(cutoff=0.5), [1, 1, 1, 2, 1]) self.assertEqual(p1.columnDegeneracy(cutoff=0.75), [1, 2, 1, 3, 2]) # when a row seems to add up to the cutoff value, it's not # always found because of floating point error. E.g. second row # in this example self.assertEqual(p1.columnDegeneracy(cutoff=1), [2, 4, 1, 4, 2]) # when the cutoff can't be found, the number of rows in the # profile is returned (for each column) self.assertEqual(p1.columnDegeneracy(cutoff=1.5), [4, 4, 4, 4, 4]) self.assertEqual(p2.columnDegeneracy(cutoff=0.95), [4, 2, 4, 1]) self.assertEqual(p2.columnDegeneracy(cutoff=1.4), [4, 3, 4, 1]) self.assertEqual(self.empty.columnDegeneracy(), []) def test_rowMax(self): """rowMax should return max value in each row""" p1 = self.consensus obs = p1.rowMax() self.assertEqual(obs, array([0.8, 0.7, 1, 0.4, 0.5])) def test_toConsensus(self): """toConsensus: should work with all the different options """ p = self.consensus self.assertEqual(p.toConsensus(fully_degenerate=False), "AGGAT") self.assertEqual(p.toConsensus(fully_degenerate=True), "WVGNY") self.assertEqual(p.toConsensus(cutoff=0.75), "ARGHY") self.assertEqual(p.toConsensus(cutoff=0.95), "WVGNY") self.assertEqual(p.toConsensus(cutoff=2), "WVGNY") p = self.not_same_value self.assertEqual(p.toConsensus(fully_degenerate=False), "CGTA") self.assertEqual(p.toConsensus(fully_degenerate=True), "NBYA") self.assertEqual(p.toConsensus(cutoff=0.75), "YSYA") self.assertEqual(p.toConsensus(cutoff=2), "NBYA") self.assertEqual(p.toConsensus(cutoff=5), "NBYA") # when you specify both fully_generate and a cutoff value # the cutoff takes priority and is used in the calculation self.assertEqual(p.toConsensus(cutoff=0.75, fully_degenerate=True), "YSYA") # raises AttributeError when Alphabet doens't have Degenerates p = Profile(array([[0.2, 0.8], [0.7, 0.3]]), "AB") self.assertRaises(AttributeError, p.toConsensus, cutoff=0.5) def test_toConsensus_include_all(self): """toConsensus: Should include all possibilities when include_all=True """ p1 = Profile( array([[0.2, 0, 0.8, 0], [0, 0.1, 0.2, 0.7], [0, 0, 0, 1], [0.2, 0.3, 0.4, 0.1], [0.5, 0.5, 0, 0]]), Alphabet=DNA, CharOrder="TCAG", ) self.assertEqual(p1.toConsensus(cutoff=0.4, include_all=True), "AGGAY") p2 = Profile( array([[0.25, 0.25, 0.25, 0.25], [0.1, 0.1, 0.1, 0], [0.4, 0, 0.4, 0], [0, 0.2, 0.2, 0.3]]), Alphabet=DNA, CharOrder="TCAG", ) self.assertEqual(p2.toConsensus(cutoff=0.4, include_all=True), "NHWV") def test_randomIndices(self): """randomIndices: 99% of new frequencies should be within 3*SD """ r_num, c_num = 100, 20 num_elements = r_num * c_num r = random([r_num, c_num]) p = Profile(r, "A" * c_num) p.normalizePositions() d = p.Data n = 1000 # Test only works on normalized profile, b/c of 1-d below means = n * d three_stds = sqrt(d * (1 - d) * n) * 3 result = [p.randomIndices() for x in range(n)] a = Alignment(transpose(result)) def absoluteProfile(alignment, char_order): f = a.columnFreqs() res = zeros([len(f), len(char_order)]) for row, freq in enumerate(f): for i in freq: res[row, ord(i)] = freq[i] return res ap = absoluteProfile(a, p.CharOrder) failure = abs(ap - means) > three_stds assert sum(sum(failure)) / num_elements <= 0.01 def test_randomSequence(self): """randomSequence: 99% of new frequencies should be within 3*SD""" r_num, c_num = 100, 20 num_elements = r_num * c_num alpha = "ABCDEFGHIJKLMNOPQRSTUVWXYZ" r = random([r_num, c_num]) p = Profile(r, alpha[:c_num]) p.normalizePositions() d = p.Data n = 1000 # Test only works on normalized profile, b/c of 1-d below means = n * d three_stds = sqrt(d * (1 - d) * n) * 3 a = Alignment([p.randomSequence() for x in range(n)]) def absoluteProfile(alignment, char_order): f = a.columnFreqs() res = zeros([len(f), len(char_order)]) for row, freq in enumerate(f): for i in freq: col = char_order.index(i) res[row, col] = freq[i] return res ap = absoluteProfile(a, p.CharOrder) failure = abs(ap - means) > three_stds assert sum(sum(failure)) / num_elements <= 0.01
from cogent.core.profile import Profile from cogent import LoadSeqs, RNA aln = LoadSeqs("data/trna_profile.fasta", moltype=RNA) print len(aln.Seqs) print len(aln) pf = aln.getPosFreqs() print pf.prettyPrint(include_header=True, column_limit=6, col_sep=' ') pf.normalizePositions() print pf.prettyPrint(include_header=True, column_limit=6, col_sep=' ') print pf.isValid() print '\n'.join([ '%s: %.3f' % (c, f) for (c, f) in zip(pf.CharOrder, pf.dataAt(4)) if f != 0 ]) print pf.toConsensus(fully_degenerate=False) pf.Alphabet = RNA print "to consensus" print pf.toConsensus(fully_degenerate=True) print pf.toConsensus(cutoff=0.8) print pf.toConsensus(cutoff=0.6) loop_profile = Profile(pf.Data[54:60, :], Alphabet=RNA, CharOrder=pf.CharOrder) print loop_profile.prettyPrint(include_header=True, column_limit=6, col_sep=' ') yeast = RNA.Sequence( 'GCGGAUUUAGCUCAGUU-GGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA' ) scores = loop_profile.score(yeast) print scores print max(scores) print scores.argmax()
#!/usr/bin/env python # taken from http://pycogent.sourceforge.net/ from cogent.core.profile import Profile from cogent import LoadSeqs, RNA aln = LoadSeqs("data/trna_profile.fasta", moltype=RNA) print len(aln.Seqs) print len(aln) pf = aln.getPosFreqs() print pf.prettyPrint(include_header=True, column_limit=6, col_sep=' ') pf.normalizePositions() print pf.prettyPrint(include_header=True, column_limit=6, col_sep=' ') print pf.isValid() print '\n'.join(['%s: %.3f'%(c,f) for (c,f) in zip(pf.CharOrder, pf.dataAt(4)) if f!=0]) print pf.toConsensus(fully_degenerate=False) pf.Alphabet=RNA print "to consensus" print pf.toConsensus(fully_degenerate=True) print pf.toConsensus(cutoff=0.8) print pf.toConsensus(cutoff=0.6) loop_profile = Profile(pf.Data[54:60,:], Alphabet=RNA, CharOrder=pf.CharOrder) print loop_profile.prettyPrint(include_header=True, column_limit=6, col_sep=' ') yeast = RNA.Sequence('GCGGAUUUAGCUCAGUU-GGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA') scores = loop_profile.score(yeast) print scores print max(scores) print scores.argmax()
class ProfileTests(TestCase): """Tests for Profile object""" def setUp(self): """setUp method for all Profile tests""" self.full = Profile(array([[2,4],[3,5],[4,8]]),"AB") self.empty = Profile(array([[]]),"AB") self.empty_row = Profile(array([[1,1],[0,0]]), "AB") self.empty_col = Profile(array([[0,1],[0,1]]), "AB") self.consensus = Profile(array([[.2,0,.8,0],[0,.1,.2,.7],[0,0,0,1],\ [.2,.3,.4,.1],[.5,.5,0,0]]),\ Alphabet=DNA, CharOrder="TCAG") self.not_same_value = Profile(array([[.3,.5,.1,.1],[.4,.6,0,.7],\ [.3,.2,0,0],[0,0,4,0]]),Alphabet=DNA, CharOrder="TCAG") self.zero_entry = Profile(array([[.3,.2,0,.5],[0,0,.8,.2]]),\ Alphabet="UCAG") self.score1 = Profile(Data=array([[-1,0,1,2],[-2,2,0,0],[-3,5,1,0]]),\ Alphabet=DNA, CharOrder="ATGC") self.score2 = Profile(array([[.2,.4,.4,0],[.1,0,.9,0],[.1,.2,.3,.4]]),\ Alphabet="TCAG") self.oned = Profile(array([.25,.25,.25,.25]),"ABCD") self.pp = Profile(array([[1,2,3,4],[5,6,7,8],[9,10,11,12]]),"ABCD") def test_init(self): """__init__: should set all attributed correctly""" self.assertRaises(TypeError, Profile) self.assertRaises(TypeError, Profile, array([[2,3]])) #only alphabet p = Profile(array([[.2,.8],[.7,.3]]),"AB") self.assertEqual(p.Data, [[.2,.8],[.7,.3]]) self.assertEqual(p.Alphabet, "AB") self.assertEqual(p.CharOrder, list("AB")) self.assertEqual(translate("ABBA",p._translation_table), "\x00\x01\x01\x00") #alphabet and char order p = Profile(array([[.1,.2],[.4,.3]]),Alphabet=DNA, CharOrder="AG") self.assertEqual(p.CharOrder,"AG") assert p.Alphabet is DNA #non-character alphabet p = Profile(array([[.1,.2],[.4,.3]]),Alphabet=[7,3], CharOrder=[3,7]) self.assertEqual(p.CharOrder,[3,7]) self.assertEqual(p.Alphabet, [7,3]) self.assertEqual(p.Data, [[.1,.2],[.4,.3]]) def test_str(self): """__str__: should return string representation of data in profile """ self.assertEqual(str(self.empty_row),str(array([[1,1],[0,0]]))) def test_make_translation_table(self): """_make_translation_table: should return correct table from char order """ p = Profile(array([[.2,.8],[.7,.3]]),"ABCDE","AB") self.assertEqual(translate("ABBA",p._translation_table), "\x00\x01\x01\x00") def test_hasValidData(self): """hasValidData: should work on full and empty profiles""" full = self.full.copy() full.normalizePositions() self.assertEqual(full.hasValidData(),True) self.assertEqual(self.empty_row.hasValidData(),False) self.assertEqual(self.empty.hasValidData(),False) def test_hasValidAttributes(self): """hasValidAttributes: should work for different alphabets/char orders """ p = Profile(array([[1,2],[3,4]]),Alphabet="ABCD", CharOrder="BAC") #self.Data doesn't match len(CharOrder) self.assertEqual(p.hasValidAttributes(),False) p = Profile(array([[1,2],[3,4]]),Alphabet="ABCD", CharOrder="AX") #not all chars in CharOrder in Alphabet self.assertEqual(p.hasValidAttributes(),False) p = Profile(array([[1,2],[3,4]]),Alphabet="ABCD", CharOrder="CB") #should be fine self.assertEqual(p.hasValidAttributes(),True) def test_isValid(self): """isValid: should work as expected""" #everything valid p1 = Profile(array([[.3,.7],[.8,.2]]),Alphabet="AB",CharOrder="AB") #invalid data, valid attributes p2 = Profile(array([[1,2],[3,4]]),Alphabet="ABCD", CharOrder="BA") #invalid attributes, valid data p3 = Profile(array([[.3,.7],[.8,.2]]),Alphabet="ABCD",CharOrder="AF") self.assertEqual(p1.isValid(),True) self.assertEqual(p2.isValid(),False) self.assertEqual(p3.isValid(),False) def test_dataAt(self): """dataAt: should work on valid position and character""" p = Profile(array([[.2,.4,.4,0],[.1,0,.9,0],[.1,.2,.3,.4]]),\ Alphabet="TCAG") self.assertEqual(p.dataAt(0,'C'),.4) self.assertEqual(p.dataAt(1,'T'),.1) self.assertRaises(ProfileError, p.dataAt, 1, 'U') self.assertRaises(ProfileError, p.dataAt, -2, 'T') self.assertRaises(ProfileError, p.dataAt, 5, 'T') def test_copy(self): """copy: should act as expected while rebinding/modifying attributes """ p = Profile(array([[1,1],[.7,.3]]),{'A':'A','G':'G','R':'AG'},"AG") p_copy = p.copy() assert p.Data is p_copy.Data assert p.Alphabet is p_copy.Alphabet assert p.CharOrder is p_copy.CharOrder #modifying p.Data modifies p_copy.Data p.Data[1,1] = 100 assert p.Alphabet is p_copy.Alphabet #normalizing p.Data rebinds it, so p_copy.Data is unchanged p.normalizePositions() assert not p.Data is p_copy.Data #Adding something to the alphabet changes both p and p_copy p.Alphabet['Y']='TC' assert p.Alphabet is p_copy.Alphabet #Rebinding the CharOrder does only change the original p.CharOrder='XX' assert not p.CharOrder is p_copy.CharOrder def test_normalizePositions(self): """normalizePositions: should normalize or raise appropriate error """ p = self.full.copy() p.normalizePositions() self.assertEqual(p.Data,array([[2/6,4/6],[3/8,5/8],[4/12,8/12]])) self.assertEqual(sum(p.Data,1),[1,1,1]) p = self.empty_col.copy() p.normalizePositions() self.assertEqual(p.Data,array([[0,1],[0,1]])) p = self.empty_row.copy() self.assertRaises(ProfileError,p.normalizePositions) p = Profile(array([[0.0,0.0]]),"AB") self.assertRaises(ProfileError,p.normalizePositions) #negative numbers!!!!!! p1 = Profile(array([[3,-2],[4,-3]]),"AB") p1.normalizePositions() self.assertEqual(p1.Data,array([[3,-2],[4,-3]])) p2 = Profile(array([[3,-3],[4,-3]]),"AB") self.assertRaises(ProfileError,p2.normalizePositions) def test_normalizeSequences(self): """normalizeSequences: should normalize or raise appropriate error """ p = self.full.copy() p.normalizeSequences() self.assertEqual(p.Data,array([[2/9,4/17],[3/9,5/17],[4/9,8/17]])) self.assertEqual(sum(p.Data, axis=0),[1,1]) p = self.empty_row.copy() p.normalizeSequences() self.assertEqual(p.Data,array([[1,1],[0,0]])) p = self.empty_col.copy() self.assertRaises(ProfileError,p.normalizeSequences) p = Profile(array([[0.0],[0.0]]),"AB") self.assertRaises(ProfileError,p.normalizeSequences) #negative numbers!!!!!! p1 = Profile(array([[3,4],[-2,-3]]),"AB") p1.normalizeSequences() self.assertEqual(p1.Data,array([[3,4],[-2,-3]])) p2 = Profile(array([[3,4],[-3,-3]]),"AB") self.assertRaises(ProfileError,p2.normalizeSequences) def test_prettyPrint_without_parameters(self): """prettyPrint: should work without parameters passed in""" p = self.full self.assertEqual(p.prettyPrint(),"2\t4\n3\t5\n4\t8") self.assertEqual(p.prettyPrint(include_header=True),\ "A\tB\n2\t4\n3\t5\n4\t8") self.assertEqual(p.prettyPrint(transpose_data=True),\ "2\t3\t4\n4\t5\t8") self.assertEqual(p.prettyPrint(include_header=True,\ transpose_data=True),"A\t2\t3\t4\nB\t4\t5\t8") #empty self.assertEqual(self.empty.prettyPrint(),"") self.assertEqual(self.empty.prettyPrint(transpose_data=True),"") #it will still print with invalid data (e.g if len(CharOrder) #doesn't match the data p = self.full.copy() p.CharOrder="ABC" self.assertEqual(p.prettyPrint(include_header=True),\ "A\tB\tC\n2\t4\t \n3\t5\t \n4\t8\t ") #it will truncate the CharOrder if data is transposed #and CharOrder is longer then the number of rows in the #transposed data self.assertEqual(p.prettyPrint(include_header=True,\ transpose_data=True),"A\t2\t3\t4\nB\t4\t5\t8") def test_prettyPrint_four_cases(self): """prettyPrint: with/without header/transpose/limit""" p = self.full p = self.pp self.assertEqual(p.prettyPrint(),\ "1\t 2\t 3\t 4\n5\t 6\t 7\t 8\n9\t10\t11\t12") self.assertEqual(p.prettyPrint(column_limit=3),\ "1\t 2\t 3\n5\t 6\t 7\n9\t10\t11") self.assertEqual(p.prettyPrint(column_limit=3, include_header=True),\ "A\t B\t C\n1\t 2\t 3\n5\t 6\t 7\n9\t10\t11") self.assertEqual(p.prettyPrint(column_limit=3, include_header=False,\ transpose_data=True),\ "1\t5\t 9\n2\t6\t10\n3\t7\t11\n4\t8\t12") self.assertEqual(p.prettyPrint(column_limit=2, include_header=False,\ transpose_data=True),\ "1\t5\n2\t6\n3\t7\n4\t8") self.assertEqual(p.prettyPrint(column_limit=3, include_header=True,\ transpose_data=True),\ "A\t1\t5\nB\t2\t6\nC\t3\t7\nD\t4\t8") def test_reduce_wrong_size(self): """reduce: should fail when profiles have different sizes""" p1 = Profile(array([[1,0],[0,1]]),Alphabet="AB") p2 = Profile(array([[1,0,0],[1,0,0]]),Alphabet="ABC") self.assertRaises(ProfileError,p1.reduce,p2) def test_reduce_normalization_error(self): """reduce: fails when input or output can't be normalized""" #Will raise errors when input data can't be normalized self.assertRaises(ProfileError,self.empty.reduce,self.empty,add) self.assertRaises(ProfileError,self.full.reduce,self.empty_row,add) #don't normalize input, but do normalize output #fails when one row adds up to zero p1 = Profile(array([[3,3],[4,4]]),"AB") p2 = Profile(array([[3,3],[-4,-4]]),"AB") self.assertRaises(ProfileError,p1.reduce,p2,add,False,True) def test_reduce_operators(self): """reduce: should work fine with different operators """ #different operators, normalize input, don't normalize output p1 = Profile(array([[1,0,0],[0,1,0]]),Alphabet="ABC") p2 = Profile(array([[1,0,0],[0,0,1]]),Alphabet="ABC") self.assertEqual(p1.reduce(p2).Data,array([[1,0,0],[0,.5,.5]])) self.assertEqual(p1.reduce(p2,add,normalize_input=True,\ normalize_output=False).Data,array([[2,0,0],[0,1,1]])) self.assertEqual(p1.reduce(p2,subtract,normalize_input=True,\ normalize_output=False).Data,array([[0,0,0],[0,1,-1]])) self.assertEqual(p1.reduce(p2,multiply,normalize_input=True,\ normalize_output=False).Data,array([[1,0,0],[0,0,0]])) self.assertRaises(ProfileError,p1.reduce,p2,divide,\ normalize_input=True,normalize_output=False) #don't normalize and normalize only input p3 = Profile(array([[1,2],[3,4]]),Alphabet="AB") p4 = Profile(array([[4,3],[2,1]]),Alphabet="AB") self.assertEqual(p3.reduce(p4,add,normalize_input=False,\ normalize_output=False).Data,array([[5,5],[5,5]])) self.assertFloatEqual(p3.reduce(p4,add,normalize_input=True,\ normalize_output=False).Data,array([[19/21,23/21],[23/21,19/21]])) #normalize input and output p5 = Profile(array([[1,1,0,0],[1,1,1,1]]),Alphabet="ABCD") p6 = Profile(array([[1,0,0,0],[1,0,0,1]]),Alphabet="ABCD") self.assertEqual(p5.reduce(p6,add,normalize_input=True,\ normalize_output=True).Data,array([[.75,.25,0,0],\ [.375,.125,.125,.375]])) #it can collapse empty profiles when normalizing is turned off self.assertEqual(self.empty.reduce(self.empty,\ normalize_input=False,normalize_output=False).Data.tolist(),[[]]) #more specific tests of the operators will be in the #separate functions def test__add_(self): """__add__: should not normalize input or output, just add""" p1 = Profile(array([[.3,.4,.1,0],[.1,.1,.1,.7]]),Alphabet="ABCD") p2 = Profile(array([[1,0,0,0],[1,0,0,1]]),Alphabet="ABCD") self.assertEqual((p1+p2).Data, array([[1.3,.4,.1,0],[1.1,.1,.1,1.7]])) self.assertRaises(ProfileError,self.empty.__add__, p1) self.assertEqual((self.empty + self.empty).Data.tolist(),[[]]) def test__sub_(self): """__sub__: should subtract two profiles, no normalization""" p1 = Profile(array([[.3,.4,.1,0],[.1,.1,.1,.7]]),Alphabet="ABCD") p2 = Profile(array([[1,0,0,0],[1,0,0,1]]),Alphabet="ABCD") self.assertFloatEqual((p1-p2).Data, array([[-.7,.4,.1,0],\ [-.9,.1,.1,-.3]])) def test__mul_(self): """__mul__: should multiply two profiles, no normalization""" p1 = Profile(array([[1,-2,3,0],[1,1,1,.5]]),Alphabet="ABCD") p2 = Profile(array([[1,0,0,0],[1,0,3,2]]),Alphabet="ABCD") self.assertEqual((p1*p2).Data, array([[1,0,0,0],\ [1,0,3,1]])) def test__div_(self): """__div__ and __truediv__: always true division b/c __future__.division """ p1 = Profile(array([[2,3],[4,5]]),"AB") p2 = Profile(array([[1,0],[4,5]]),"AB") #Int 0 p3 = Profile(array([[1,0.0],[4,5]]),"AB") #Float 0.0 p4 = Profile(array([[1,2],[8.0,5]]),"AB") #Float 0.0 self.assertRaises(ProfileError, p1.__truediv__,p2) #infinity in result data self.assertRaises(ProfileError, p1.__div__, p3) self.assertFloatEqual((p1.__div__(p4)).Data, array([[2,1.5],[0.5,1]])) def test_distance(self): """distance: should return correct distance between the profiles """ p1 = Profile(array([[2,4],[3,1]]), "AB") p2 = Profile(array([[4,6],[5,3]]), "AB") p3 = Profile(array([[4,6],[5,3],[1,1]]), "AB") p4 = Profile(array([2,2]),"AB") p5 = Profile(array([2,2,2]),"AB") p6 = Profile(array([[]]),"AB") self.assertEqual(p1.distance(p2),4) self.assertEqual(p2.distance(p1),4) self.assertEqual(p1.distance(p4),sqrt(6)) self.assertEqual(p6.distance(p6),0) #Raises error when frames are not aligned self.assertRaises(ProfileError, p1.distance,p3) self.assertRaises(ProfileError,p1.distance,p5) def test_toOddsMatrix(self): """toOddsMatrix: should work on valid data or raise an error """ p = Profile(array([[.1,.3,.5,.1],[.25,.25,.25,.25],\ [.05,.8,.05,.1],[.7,.1,.1,.1],[.6,.15,.05,.2]]),\ Alphabet="ACTG") p_exp = Profile(array([[.4, 1.2, 2, .4],[1,1,1,1],[.2,3.2,.2,.4],\ [2.8,.4,.4,.4],[2.4,.6,.2,.8]]),Alphabet="ACTG") self.assertEqual(p.toOddsMatrix().Data,p_exp.Data) assert p.Alphabet is p.toOddsMatrix().Alphabet self.assertEqual(p.toOddsMatrix([.25,.25,.25,.25]).Data,p_exp.Data) #fails if symbol_freqs has wrong size self.assertRaises(ProfileError, p.toOddsMatrix,\ [.25,.25,.25,.25,.25,.25]) self.assertRaises(ProfileError, self.zero_entry.toOddsMatrix,\ [.1,.2,.3]) #works on empty profile self.assertEqual(self.empty.toOddsMatrix().Data.tolist(),[[]]) #works with different input self.assertEqual(self.zero_entry.toOddsMatrix().Data,\ array([[1.2,.8,0,2],[0,0,3.2,.8]])) self.assertFloatEqual(self.zero_entry.toOddsMatrix([.1,.2,.3,.4]).Data,\ array([[3,1,0,1.25],[0,0,2.667,.5]]),1e-3) #fails when one of the background frequencies is 0 self.assertRaises(ProfileError, self.zero_entry.toOddsMatrix,\ [.1,.2,.3,0]) def test_toLogOddsMatrix(self): """toLogOddsMatrix: should work as expected""" #This test can be short, because it mainly depends on toOddsMatrix #for which everything has been tested p = Profile(array([[.1,.3,.5,.1],[.25,.25,.25,.25],\ [.05,.8,.05,.1],[.7,.1,.1,.1],[.6,.15,.05,.2]]),\ Alphabet="ACTG") p_exp = Profile(array(\ [[-1.322, 0.263, 1., -1.322],\ [ 0., 0., 0., 0.],\ [-2.322, 1.678, -2.322, -1.322],\ [ 1.485, -1.322, -1.322, -1.322],\ [ 1.263, -0.737, -2.322, -0.322]]),\ Alphabet="ACTG") self.assertFloatEqual(p.toLogOddsMatrix().Data,p_exp.Data,eps=1e-3) #works on empty matrix self.assertEqual(self.empty.toLogOddsMatrix().Data.tolist(),[[]]) def test__score_indices(self): """_score_indices: should work on valid input""" self.assertEqual(self.score1._score_indices(array([0,1,1,3,0,3]),\ offset=0),[6,2,-3,0]) self.assertFloatEqual(self.score2._score_indices(\ array([3,1,2,0,2,2,3]), offset=0),[.3,1.4,.8,1.4,1.7]) self.assertFloatEqual(self.score2._score_indices(\ array([3,1,2,0,2,2,3]), offset=3),[1.4,1.7]) #Errors will be raised on invalid input. Errors are not handled #in this method. Validation of the input is done elsewhere self.assertRaises(IndexError,self.score2._score_indices,\ array([3,1,63,0,4,2,3]), offset=3) def test__score_profile(self): """_score_profile: should work on valid input""" p1 = Profile(array([[1,0,0,0],[0,1,0,0],[0,0,.5,.5],[0,0,0,1],\ [.25,.25,.25,.25]]),"TCAG") p2 = Profile(array([[0,1,0,0],[.2,0,.8,0],[0,0,.5,.5],[1/3,1/3,0,1/3],\ [.25,.25,.25,.25]]),"TCAG") self.assertFloatEqual(self.score2._score_profile(p1,offset=0),\ [.55,1.25,.45]) self.assertFloatEqual(self.score2._score_profile(p1,offset=2),\ [.45]) self.assertFloatEqual(self.score2._score_profile(p2,offset=0),\ [1.49,1.043,.483],1e-3) #Errors will be raised on invalid input. Errors are not handled #in this method. Validation of the input is done elsewhere #In this case you don't get an error, but for sure an unexpected #result self.assertFloatEqual(self.score2._score_profile(p1,offset=3).tolist(),\ []) def test_score_sequence(self): """score: should work correctly for Sequence as input """ #works on normal valid data s1 = self.score1.score("ATTCAC",offset=0) self.assertEqual(s1,\ [6,2,-3,0]) self.assertFloatEqual(self.score2.score("TCAAGT",offset=0), [.5,1.6,1.7,0.5]) #works with different offset self.assertFloatEqual(self.score2.score("TCAAGT",offset=2), [1.7,0.5]) self.assertFloatEqual(self.score2.score("TCAAGT",offset=3), [0.5]) #raises error on invalid offset self.assertRaises(ProfileError,self.score2.score,\ "TCAAGT",offset=4) #works on seq of minimal length self.assertFloatEqual(self.score2.score("AGT",offset=0), [0.5]) #raises error when sequence is too short self.assertRaises(ProfileError, self.score2.score,"",offset=0) #raises error on empty profile self.assertRaises(ProfileError,self.empty.score,"ACGT") #raises error when sequence contains characters that #are not in the characterorder self.assertRaises(ProfileError,self.score2.score,"ACBRT") def test_score_sequence_object(self): """score: should work correctly on Sequence object as input """ # DnaSequence object ds = self.score1.score(DNA.Sequence("ATTCAC"),offset=0) self.assertEqual(ds, [6,2,-3,0]) # ModelSequence object ms = self.score1.score(ModelSequence("ATTCAC", Alphabet=DNA.Alphabet),\ offset=0) self.assertEqual(ms, [6,2,-3,0]) def test_score_no_trans_table(self): """score: should work when no translation table is present """ p = Profile(Data=array([[-1,0,1,2],[-2,2,0,0],[-3,5,1,0]]),\ Alphabet=DNA, CharOrder="ATGC") # remove translation table del p.__dict__['_translation_table'] # then score the profile s1 = p.score(DNA.Sequence("ATTCAC"),offset=0) self.assertEqual(s1, [6,2,-3,0]) def test_score_profile(self): """score: should work correctly for Profile as input """ p1 = Profile(array([[1,0,0,0],[0,1,0,0],[0,0,.5,.5],[0,0,0,1],\ [.25,.25,.25,.25]]),"TCAG") p2 = Profile(array([[0,1,0,0],[.2,0,.8,0],[0,0,.5,.5],[1/3,1/3,0,1/3],\ [.25,.25,.25,.25]]),"TCAG") p3 = Profile(array([[1,0,0,0],[0,1,0,0],[0,0,0,1]]),"TCAG") p4 = Profile(array([[1,0,0,0],[0,1,0,0]]),"TCAG") p5 = Profile(array([[1,0,0,0],[0,1,0,0],[0,0,0,1]]),"AGTC") #works on normal valid data self.assertFloatEqual(self.score2.score(p1,offset=0),\ [.55,1.25,.45]) self.assertFloatEqual(self.score2.score(p2,offset=0), [1.49,1.043,.483],1e-3) #works with different offset self.assertFloatEqual(self.score2.score(p1,offset=1), [1.25,0.45]) self.assertFloatEqual(self.score2.score(p1,offset=2), [0.45]) #raises error on invalid offset self.assertRaises(ProfileError,self.score2.score,\ p1,offset=3) #works on profile of minimal length self.assertFloatEqual(self.score2.score(p3,offset=0), [0.6]) #raises error when profile is too short self.assertRaises(ProfileError, self.score2.score,p4,offset=0) #raises error on empty profile self.assertRaises(ProfileError,self.empty.score,p1) #raises error when character order doesn't match self.assertRaises(ProfileError,self.score2.score,p5) def test_rowUncertainty(self): """rowUncertainty: should handle full and empty profiles """ p = Profile(array([[.25,.25,.25,.25],[.5,.5,0,0]]),"ABCD") self.assertEqual(p.rowUncertainty(),[2,1]) #for empty rows 0 is returned as the uncertainty self.assertEqual(self.empty.rowUncertainty().tolist(),[]) p = Profile(array([[],[],[]]),"") self.assertEqual(p.rowUncertainty().tolist(),[]) #doesn't work on 1D array self.assertRaises(ProfileError,self.oned.rowUncertainty) def test_columnUncertainty(self): """columnUncertainty: should handle full and empty profiles """ p = Profile(array([[.25,.5],[.25,.5],[.25,0],[.25,0]]),"AB") self.assertEqual(p.columnUncertainty(),[2,1]) #for empty cols nothing is returned as the uncertainty self.assertEqual(self.empty.columnUncertainty().tolist(),[]) p = Profile(array([[],[],[]]),"") self.assertEqual(p.columnUncertainty().tolist(),[]) #doesn't work on 1D array self.assertRaises(ProfileError,self.oned.columnUncertainty) def test_rowDegeneracy(self): """rowDegneracy: should work as expected""" p1 = self.consensus p2 = self.not_same_value self.assertEqual(p1.rowDegeneracy(),[1,1,1,2,1]) self.assertEqual(p1.rowDegeneracy(cutoff=.5),[1,1,1,2,1]) self.assertEqual(p1.rowDegeneracy(cutoff=.75),[1,2,1,3,2]) #when a row seems to add up to the cutoff value, it's not #always found because of floating point error. E.g. second row #in this example self.assertEqual(p1.rowDegeneracy(cutoff=1),[2,4,1,4,2]) #when the cutoff can't be found, the number of columns in the #profile is returned (for each row) self.assertEqual(p1.rowDegeneracy(cutoff=1.5),[4,4,4,4,4]) self.assertEqual(p2.rowDegeneracy(cutoff=.95),[4,2,4,1]) self.assertEqual(p2.rowDegeneracy(cutoff=1.4),[4,3,4,1]) self.assertEqual(self.empty.rowDegeneracy(),[]) def test_columnDegeneracy(self): """columnDegeneracy: shoudl work as expected""" p1 = self.consensus p1.Data = transpose(p1.Data) p2 = self.not_same_value p2.Data = transpose(p2.Data) p1d = p1.columnDegeneracy() self.assertEqual(p1d,[1,1,1,2,1]) self.assertEqual(p1.columnDegeneracy(cutoff=.5),[1,1,1,2,1]) self.assertEqual(p1.columnDegeneracy(cutoff=.75),[1,2,1,3,2]) #when a row seems to add up to the cutoff value, it's not #always found because of floating point error. E.g. second row #in this example self.assertEqual(p1.columnDegeneracy(cutoff=1),[2,4,1,4,2]) #when the cutoff can't be found, the number of rows in the #profile is returned (for each column) self.assertEqual(p1.columnDegeneracy(cutoff=1.5),[4,4,4,4,4]) self.assertEqual(p2.columnDegeneracy(cutoff=.95),[4,2,4,1]) self.assertEqual(p2.columnDegeneracy(cutoff=1.4),[4,3,4,1]) self.assertEqual(self.empty.columnDegeneracy(),[]) def test_rowMax(self): """rowMax should return max value in each row""" p1 = self.consensus obs = p1.rowMax() self.assertEqual(obs, array([.8, .7, 1, .4, .5])) def test_toConsensus(self): """toConsensus: should work with all the different options """ p = self.consensus self.assertEqual(p.toConsensus(fully_degenerate=False),"AGGAT") self.assertEqual(p.toConsensus(fully_degenerate=True),"WVGNY") self.assertEqual(p.toConsensus(cutoff=0.75),"ARGHY") self.assertEqual(p.toConsensus(cutoff=0.95),"WVGNY") self.assertEqual(p.toConsensus(cutoff=2),"WVGNY") p = self.not_same_value self.assertEqual(p.toConsensus(fully_degenerate=False),"CGTA") self.assertEqual(p.toConsensus(fully_degenerate=True),"NBYA") self.assertEqual(p.toConsensus(cutoff=0.75),"YSYA") self.assertEqual(p.toConsensus(cutoff=2),"NBYA") self.assertEqual(p.toConsensus(cutoff=5),"NBYA") #when you specify both fully_generate and a cutoff value #the cutoff takes priority and is used in the calculation self.assertEqual(p.toConsensus(cutoff=0.75,fully_degenerate=True),\ "YSYA") #raises AttributeError when Alphabet doens't have Degenerates p = Profile(array([[.2,.8],[.7,.3]]),"AB") self.assertRaises(AttributeError,p.toConsensus,cutoff=.5) def test_toConsensus_include_all(self): """toConsensus: Should include all possibilities when include_all=True """ p1 = Profile(array([[.2,0,.8,0],[0,.1,.2,.7],[0,0,0,1],\ [.2,.3,.4,.1],[.5,.5,0,0]]),\ Alphabet=DNA, CharOrder="TCAG") self.assertEqual(p1.toConsensus(cutoff=0.4, include_all=True),\ "AGGAY") p2 = Profile(array([[.25,0.25,.25,0.25],[0.1,.1,.1,0],\ [.4,0,.4,0],[0,.2,0.2,0.3]]),\ Alphabet=DNA, CharOrder="TCAG") self.assertEqual(p2.toConsensus(cutoff=0.4,\ include_all=True), "NHWV") def test_randomIndices(self): """randomIndices: 99% of new frequencies should be within 3*SD """ r_num, c_num = 100,20 num_elements = r_num*c_num r = random([r_num,c_num]) p = Profile(r,"A"*c_num) p.normalizePositions() d = p.Data n = 1000 #Test only works on normalized profile, b/c of 1-d below means = n*d three_stds = sqrt(d*(1-d)*n)*3 result = [p.randomIndices() for x in range(n)] a = Alignment(transpose(result)) def absoluteProfile(alignment,char_order): f = a.columnFreqs() res = zeros([len(f),len(char_order)]) for row, freq in enumerate(f): for i in freq: res[row, ord(i)] = freq[i] return res ap = absoluteProfile(a,p.CharOrder) failure = abs(ap-means) > three_stds assert sum(sum(failure))/num_elements <= 0.01 def test_randomSequence(self): """randomSequence: 99% of new frequencies should be within 3*SD""" r_num, c_num = 100,20 num_elements = r_num*c_num alpha = "ABCDEFGHIJKLMNOPQRSTUVWXYZ" r = random([r_num,c_num]) p = Profile(r,alpha[:c_num]) p.normalizePositions() d = p.Data n = 1000 #Test only works on normalized profile, b/c of 1-d below means = n*d three_stds = sqrt(d*(1-d)*n)*3 a = Alignment([p.randomSequence() for x in range(n)]) def absoluteProfile(alignment,char_order): f = a.columnFreqs() res = zeros([len(f),len(char_order)]) for row, freq in enumerate(f): for i in freq: col = char_order.index(i) res[row, col] = freq[i] return res ap = absoluteProfile(a,p.CharOrder) failure = abs(ap-means) > three_stds assert sum(sum(failure))/num_elements <= 0.01