def updatePacket(self, projectID, ownerID, projectName, projectDescr, isPrivate, projectReaderIDs, projectWriterIDs):

		db = self.db
		cursor = self.cursor

		commHandler = CommentHandler(db, cursor)

		# simple: name and owner
		cursor.execute("UPDATE Packets_tbl SET ownerID=" + `ownerID` + " WHERE packetID=" + `projectID`)
		cursor.execute("UPDATE Packets_tbl SET packetName=" + `projectName` + " WHERE packetID=" + `projectID`)
		
		# private or public
		# again, convert Boolean values to text; otherwise they're not stored
		if isPrivate == False:
			isPrivate = 'FALSE'
		else:
			isPrivate = 'TRUE'
			
		cursor.execute("UPDATE Packets_tbl SET is_private=" + `isPrivate` + " WHERE packetID=" + `projectID`)

		# description
		packetCommLinkID = commHandler.findCommentLinkID('Packet')
		packetDescr = commHandler.findCommentID(projectDescr, packetCommLinkID)
		cursor.execute("UPDATE Packets_tbl SET packetDescription=" + `packetDescr` + " WHERE packetID=" + `projectID`)

		# members
		self.updateProjectMembers(projectID, projectReaderIDs, 'Reader')
		self.updateProjectMembers(projectID, projectWriterIDs, 'Writer')
	def findPacketDescription(self, packetID):
		db = self.db
		cursor = self.cursor
		
		commHandler = CommentHandler(db, cursor)
		
		descrCommID = self.findPacketDescriptionID(packetID)
		description = commHandler.findCommentByID(descrCommID)
		
		return description
예제 #3
0
def __initialize_threads():
    '''
    Initialize the stream handler threads to be used to concurrently parse comments and submission streams.
    '''

    global submission_handler, comment_handler

    submission_handler = SubmissionHandler(1, __THREADS[0], 1, reddit,
                                           settings, logger)
    logger.info("SubmissionHandler instantiated on thread [{}]...".format(
        __THREADS[0]))

    comment_handler = CommentHandler(2, __THREADS[1], 2, reddit, settings,
                                     logger)
    logger.info("SubmissionHandler instantiated on thread [{}]...".format(
        __THREADS[1]))
	def insertPacket(self, packet):
	
		db = self.db
		cursor = self.cursor
	
		# extract all attributes from 'packet'
		projectID = packet.getNumber()
		
		# Owner is a User instance.  Get his user ID
		owner = packet.getOwner()
		packetOwner = owner.getUserID()		
		
		packetName = packet.getName()
		packetDescription = packet.getDescription()	# may be empty
		
		packetReaders = packet.getReaders()		# list of User instances
		packetWriters = packet.getWriters()
		
		# Create a Comment table entry for Project description
		commHandler = CommentHandler(db, cursor)

		# select 'Packet' commentLinkID
		packetCommLinkID = commHandler.findCommentLinkID('Packet')
		descrCommID = commHandler.insertComment(packetCommLinkID, packetDescription)

		# Private or public
		#isPrivate = packet.isPrivate()
		
		# convert Boolean values to text, not stored otherwise
		if packet.isPrivate() == False:
			isPrivate = 'FALSE'
		else:
			isPrivate = 'TRUE'
			
		cursor.execute("INSERT INTO Packets_tbl(packetID, ownerID, packetName, packetDescription, is_private) VALUES(" + `projectID` + ", " + `packetOwner` + ", " + `packetName` + ", " + `descrCommID` + ", " + `isPrivate` + ")")
		packetID = int(db.insert_id())
		
		self.insertPacketReaders(packetID, packetReaders)
		self.insertPacketWriters(packetID, packetWriters)
		
		return packetID
	def deleteProject(self, pID):
		
		db = self.db
		cursor = self.cursor
		
		commHandler = CommentHandler(db, cursor)

		# CHECK THAT THERE ARE NO REAGENTS ASSOCIATED WITH THIS PROJECT!!!
		if self.isEmpty(pID):
		
			# update Packets, Comments and ProjectMembers tables
			cursor.execute("UPDATE Packets_tbl SET status='DEP' WHERE packetID=" + `pID` + " AND status='ACTIVE'")

			# find description
			descrID = self.findPacketDescriptionID(pID)
			commHandler.deleteComment(descrID)

			# delete members
			self.deleteAllProjectMembers(pID)
			return True
		else:
			return False
예제 #6
0
def update():

    dbConn = DatabaseConn()
    db = dbConn.databaseConnect()

    cursor = db.cursor()
    hostname = dbConn.getHostname()

    form = cgi.FieldStorage(keep_blank_values="True")

    print "Content-type:text/html"  # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
    print  # DITTO
    #print `form`

    # Aug 29/07
    uHandler = UserHandler(db, cursor)

    if form.has_key("curr_username"):
        # store the user ID for use throughout the session; add to other views in addition to create in PHP
        currUname = form.getvalue("curr_username")
        currUser = uHandler.getUserByDescription(currUname)

        Session.setUser(currUser)

    #else:	# debug
    #currUname = 'Administrator'
    #currUser = uHandler.getUserByDescription(currUname)

    #Session.setUser(currUser)

    if form.has_key("cloning_method"):
        cloning_method = form.getvalue("cloning_method")

    #else:	# debug
    #cloning_method = '1'

    # Handlers and mappers
    rHandler = ReagentHandler(db, cursor)
    #sHandler = SystemSetHandler(db, cursor)
    pHandler = ReagentPropertyHandler(db, cursor)
    raHandler = ReagentAssociationHandler(db, cursor)
    aHandler = AssociationHandler(db, cursor)

    dnaHandler = DNAHandler(db, cursor)
    commHandler = CommentHandler(db, cursor)
    protHandler = ProteinHandler(db, cursor)

    propMapper = ReagentPropertyMapper(db, cursor)
    assocMapper = ReagentAssociationMapper(db, cursor)

    # August 29/07: Restrict creation by user and project access
    packetHandler = ProjectDatabaseHandler(db, cursor)

    ########################################################
    # Various maps
    ########################################################

    prop_Alias_ID_Map = propMapper.mapPropAliasID(
    )  # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
    prop_Name_Alias_Map = propMapper.mapPropNameAlias(
    )  # (propName, propAlias)
    prop_Name_ID_Map = propMapper.mapPropNameID()  # (prop name, prop id)

    # Restriction sites
    fpcs_prop_id = pHandler.findPropID("5' cloning site")
    tpcs_prop_id = pHandler.findPropID("3' cloning site")

    newFivePrime = form.getvalue("fpcs")
    newThreePrime = form.getvalue("tpcs")

    gatewaySites = ['attb', 'attl', 'attp', 'attr']  # nov. 16/07

    # resulting sequence
    newSeq = ""

    # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
    currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                    'Reader')
    currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                     'Writer')
    publicProj = packetHandler.findAllProjects(isPrivate="FALSE")

    # list of Packet OBJECTS
    currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
                                         publicProj)

    uPackets = []

    for p in currUserWriteProjects:
        uPackets.append(p.getNumber())

    # Get project IDs of parents
    packetPropID = pHandler.findPropID("packet id")

    # August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
    newSeq = ""

    # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
    currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                    'Reader')
    currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
                                                     'Writer')
    publicProj = packetHandler.findAllProjects(isPrivate="FALSE")

    # list of Packet OBJECTS
    currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
                                         publicProj)

    uPackets = []

    for p in currUserWriteProjects:
        uPackets.append(p.getNumber())

    # Get project IDs of parents
    packetPropID = pHandler.findPropID("packet id")

    if form.has_key("PV"):
        pvVal = form.getvalue("PV")

        if len(pvVal) > 0:
            pvID = rHandler.convertReagentToDatabaseID(pvVal)

            try:
                pvProjectID = int(
                    rHandler.findSimplePropertyValue(pvID, packetPropID))
                pvSeqID = rHandler.findDNASequenceKey(
                    pvID)  # get sequence for reconstitution later
            except TypeError:
                #pvProjectID = 0
                e = PVProjectAccessException(
                    "You are not authorized to use this Parent Vector, since you do not have Read access to its project."
                )
                print ` e.err_code() `
        else:
            e = UnknownPVIDException("Unknown Parent Vector value")
            print ` e.err_code() `
            return

    # else don't do anything, maybe want to delete parents!!!
    #else:
    #e = MissingPVException("No Parent Vector provided")
    #print `e.err_code()`

    if pvProjectID > 0 and currUser.getCategory(
    ) != 'Admin' and pvProjectID not in uPackets:
        e = PVProjectAccessException("Not authorized to access parent")
        print ` e.err_code() `
        return

    if cloning_method == '1':

        # Non-recombination vector - Get the Insert
        if form.has_key("I"):
            insertVal = form.getvalue("I")

            if len(insertVal) > 0:
                insertID = rHandler.convertReagentToDatabaseID(insertVal)
                insertSeqID = rHandler.findDNASequenceKey(
                    insertID)  # fetch Insert sequence for reconstitution later

                try:
                    insertProjectID = int(
                        rHandler.findSimplePropertyValue(
                            insertID, packetPropID))

                except TypeError:
                    #insertProjectID = 0
                    e = InsertProjectAccessException(
                        "You are not authorized to use this Insert, since you do not have Read access to its project."
                    )
                    print ` e.err_code() `
            else:
                #insertID = -1
                #insertProjectID = 0
                #print "Invalid Insert value"
                e = UnknownInsertIDException("Unknown Insert value")
                print ` e.err_code() `
                return

        #else:	# NO!!!!!!!!
        #e = MissingInsertException("No Insert provided")
        #print `e.err_code()`

        if insertProjectID > 0 and currUser.getCategory(
        ) != 'Admin' and insertProjectID not in uPackets:
            e = InsertProjectAccessException(
                "You are not authorized to use this Insert, since you do not have Read access to its project."
            )
            print ` e.err_code() `
            return

        if pvID > 0 and insertID > 0:

            # try to reconstruct sequence and issue warning if unable
            if pvSeqID > 0 and insertSeqID > 0:

                # fetch insert cloning sites
                insertCloningSites = []

                fpcs_prop_id = pHandler.findPropID("5' cloning site")
                tpcs_prop_id = pHandler.findPropID("3' cloning site")

                fp_insert_cs = rHandler.findSimplePropertyValue(
                    insertID, fpcs_prop_id)
                tp_insert_cs = rHandler.findSimplePropertyValue(
                    insertID, tpcs_prop_id)

                # Determine if this is a Gateway clone from sites
                gwSites = False

                if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower(
                ) == 'attl' and tp_insert_cs.lower() == 'attl':
                    gwSites = True
                elif not fp_insert_cs or not tp_insert_cs:
                    gwSites = True
                # nov. 16/07: added this for check
                elif fp_insert_cs.lower(
                ) in gatewaySites or tp_insert_cs.lower() in gatewaySites:
                    gwSites = True
                else:
                    gwSites = False

                if gwSites:
                    # this is a gateway clone
                    # if sites were changed to something other than gateway, clear sequence
                    if newFivePrime.lower() != 'attl' or newThreePrime.lower(
                    ) != 'attl':
                        e = InsertSitesNotFoundOnParentSequenceException()
                        print ` e.err_code() `
                        return
                    else:
                        pvSeqKey = rHandler.findDNASequenceKey(pvID)

                        # For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
                        insertLinkers = []

                        # Find Sense and Antisense Oligos for this Insert
                        # (not using antisense just yet - verify with Karen)
                        iHandler = InsertHandler(db, cursor)

                        senseOligoID = iHandler.findSenseOligoID(insertID)
                        #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)

                        # Find Oligo sequences
                        seqPropID = pHandler.findPropID("sequence")
                        senseOligoSeqID = rHandler.findIndexPropertyValue(
                            senseOligoID, seqPropID)
                        senseOligoSequence = dnaHandler.findSequenceByID(
                            senseOligoSeqID)

                        # Fetch Insert sequence and find linkers from Oligo and Insert sequences
                        insertSequence = dnaHandler.findSequenceByID(
                            insertSeqID)

                        attB_const = "ggggacaactttgtacaaaaaagttggc"
                        fwd_primer_seq = senseOligoSequence[len(attB_const):]

                        # First, find linkers from Oligos
                        fwd_linker = dnaHandler.linker_from_oligo(
                            insertSequence, fwd_primer_seq)
                        #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
                        rev_linker = ""

                        # Now see if the Insert had its own linkers stored and append them to the Oligo linker
                        fpLinkerPropID = pHandler.findPropID("5' linker")
                        tpLinkerPropID = pHandler.findPropID("3' linker")

                        fp_insert_linker = rHandler.findSimplePropertyValue(
                            insertID, fpLinkerPropID)
                        tp_insert_linker = rHandler.findSimplePropertyValue(
                            insertID, tpLinkerPropID)

                        if fp_insert_linker and len(
                                fp_insert_linker
                        ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                            fp_insert_linker = fwd_linker + fp_insert_linker
                        else:
                            fp_insert_linker = fwd_linker

                        tp_insert_linker = rev_linker

                        insertLinkers.append(fp_insert_linker)
                        insertLinkers.append(tp_insert_linker)

                        try:
                            newSeq = dnaHandler.entryVectorSequence(
                                pvSeqKey, insertSeqID, insertLinkers)
                            print newSeq

                        except MultipleSiteOccurrenceException:
                            e = MultipleSiteOccurrenceException(
                                "Sites found more than once on parent vector sequence"
                            )
                            print ` e.err_code() `

                        except FivePrimeAfterThreePrimeException:
                            e = FivePrimeAfterThreePrimeException(
                                "5' after 3'")
                            print ` e.err_code() `

                        except InsertSitesNotFoundOnParentSequenceException:
                            e = InsertSitesNotFoundOnParentSequenceException(
                                "Gateway sites not found on parent vector sequence"
                            )
                            print ` e.err_code() `

                else:
                    # Non-Gateway non-recombination Vector
                    fp_insert_cs = newFivePrime
                    tp_insert_cs = newThreePrime

                    if fp_insert_cs:
                        insertCloningSites.append(fp_insert_cs)
                    else:
                        insertCloningSites.append("")

                    if tp_insert_cs:
                        insertCloningSites.append(tp_insert_cs)
                    else:
                        insertCloningSites.append("")

                    # get linkers if there are any
                    insertLinkers = []

                    fpLinkerPropID = pHandler.findPropID("5' linker")
                    tpLinkerPropID = pHandler.findPropID("3' linker")

                    fp_insert_linker = rHandler.findSimplePropertyValue(
                        insertID, fpLinkerPropID)
                    tp_insert_linker = rHandler.findSimplePropertyValue(
                        insertID, tpLinkerPropID)

                    # sept. 3/07
                    fwd_linker = ""

                    if fp_insert_linker and len(
                            fp_insert_linker
                    ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                        fp_insert_linker = fwd_linker + fp_insert_linker
                    else:
                        fp_insert_linker = fwd_linker

                    insertLinkers.append(fp_insert_linker)
                    insertLinkers.append(tp_insert_linker)

                    try:
                        newSeq = dnaHandler.constructNonRecombSequence(
                            pvSeqID, insertSeqID, insertCloningSites,
                            insertLinkers)
                        print newSeq

                    except (InsertSitesException):
                        e = InsertSitesException(
                            "Could not reconstitute sequence: Unknown sites on Insert."
                        )
                        print e.err_code()

                    except (InsertSitesNotFoundOnParentSequenceException):
                        e = InsertSitesNotFoundOnParentSequenceException(
                            "Could not reconstitute sequence: Parent vector sequence does not contain restriction sites."
                        )
                        print e.err_code()

                    except (MultipleSiteOccurrenceException):
                        e = MultipleSiteOccurrenceException(
                            "Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence"
                        )
                        print e.err_code()

                    except (HybridizationException):
                        e = HybridizationException(
                            "Could not reconstitute sequence: Restriction sites cannot be hybridized."
                        )
                        print e.err_code()

                    except (FivePrimeAfterThreePrimeException):
                        e = FivePrimeAfterThreePrimeException(
                            "Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence."
                        )
                        print e.err_code()
            else:
                e = InvalidSequenceException("Invalid parent sequence")
                print ` e.err_code() `
        else:
            e = UnknownPVIDException("Unknown PV ID")
            print ` e.err_code() `

    elif cloning_method == '2':

        # Recombination vector - check IPV
        ipvVal = form.getvalue("IPV")

        if len(ipvVal) > 0:
            ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
            ipvProjectID = int(
                rHandler.findSimplePropertyValue(ipvID, packetPropID))
        else:
            e = UnknownIPVIDException("Unknown IPV ID")
            print ` e.err_code() `

        if ipvProjectID > 0 and currUser.getCategory(
        ) != 'Admin' and ipvProjectID not in uPackets:
            e = IPVProjectAccessException("Not authorized to view IPV")
            print ` e.err_code() `

        if ipvID > 0 and pvID > 0:

            # If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
            if not (newFivePrime == newThreePrime and
                    (newFivePrime.lower() == 'loxp'
                     and newThreePrime.lower() == 'loxp') or
                    (newFivePrime.lower() == 'attb'
                     and newThreePrime.lower() == 'attb')):
                e = InsertSitesNotFoundOnParentSequenceException(
                    "Invalid restriction sites for Non-Recombination Clone - must be LoxP only"
                )
                print ` e.err_code() `
            else:
                # get internal db IDs
                pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
                ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)

                # Get the Insert that belongs to the donor vector
                ipvInsertAssocID = raHandler.findReagentAssociationID(
                    ipv_db_id)
                insertAssocPropID = aHandler.findAssocPropID("insert id")
                insert_db_id = aHandler.findAssocPropValue(
                    ipvInsertAssocID, insertAssocPropID)

                # Construct a sequence for the new vector from the sequences of its parents
                pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
                #print "pv seq " + `pvSeqKey`
                ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
                #print "ipv seq " + `ipvSeqKey`
                insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
                #print "i seq " + `insertSeqKey`

                if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:

                    # See if there are linkers, although there most likely aren't any
                    insertLinkers = []

                    fpLinkerPropID = pHandler.findPropID("5' linker")
                    tpLinkerPropID = pHandler.findPropID("3' linker")

                    fp_insert_linker = rHandler.findSimplePropertyValue(
                        insert_db_id, fpLinkerPropID)
                    tp_insert_linker = rHandler.findSimplePropertyValue(
                        insert_db_id, tpLinkerPropID)

                    # sept. 3/07
                    fwd_linker = ""

                    if fp_insert_linker and len(
                            fp_insert_linker
                    ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                        fp_insert_linker = fwd_linker + fp_insert_linker
                    else:
                        fp_insert_linker = fwd_linker

                    insertLinkers.append(fp_insert_linker)
                    insertLinkers.append(tp_insert_linker)

                    # Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
                    if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
                        # recombination
                        try:
                            newSeq = dnaHandler.constructRecombSequence(
                                pvSeqKey, ipvSeqKey, insertSeqKey,
                                insertLinkers)
                            newSeqID = dnaHandler.matchSequence(newSeq)
                            print newSeq

                        except InsertSitesNotFoundOnParentSequenceException:
                            e = InsertSitesNotFoundOnParentSequenceException(
                                "LOXP sites not found on parent vector sequence"
                            )
                            print ` e.err_code() `

                        except MultipleSiteOccurrenceException:

                            e = MultipleSiteOccurrenceException(
                                "LOXP found more than once on parent vector sequence"
                            )
                            print ` e.err_code() `

                    elif newFivePrime == 'attB' and newThreePrime == 'attB':

                        # Gateway Expression
                        iHandler = InsertHandler(db, cursor)

                        senseOligoID = iHandler.findSenseOligoID(insert_db_id)
                        #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)

                        # Find Oligo sequences
                        seqPropID = pHandler.findPropID("sequence")
                        senseOligoSeqID = rHandler.findIndexPropertyValue(
                            senseOligoID, seqPropID)
                        senseOligoSequence = dnaHandler.findSequenceByID(
                            senseOligoSeqID)

                        # Fetch Insert sequence and find linkers from Oligo and Insert sequences
                        insertSequence = dnaHandler.findSequenceByID(
                            insertSeqKey)

                        attB_const = "ggggacaactttgtacaaaaaagttggc"
                        fwd_primer_seq = senseOligoSequence[len(attB_const):]

                        # First, find linkers from Oligos
                        fwd_linker = dnaHandler.linker_from_oligo(
                            insertSequence, fwd_primer_seq)
                        #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
                        rev_linker = ""

                        # Now see if the Insert had its own linkers stored and append them to the Oligo linker
                        fpLinkerPropID = pHandler.findPropID("5' linker")
                        tpLinkerPropID = pHandler.findPropID("3' linker")

                        fp_insert_linker = rHandler.findSimplePropertyValue(
                            insert_db_id, fpLinkerPropID)
                        tp_insert_linker = rHandler.findSimplePropertyValue(
                            insert_db_id, tpLinkerPropID)

                        if fp_insert_linker and len(
                                fp_insert_linker
                        ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
                            fp_insert_linker = fwd_linker + fp_insert_linker
                        else:
                            fp_insert_linker = fwd_linker

                        tp_insert_linker = rev_linker

                        insertLinkers.append(fp_insert_linker)
                        insertLinkers.append(tp_insert_linker)

                        try:
                            newSeq = dnaHandler.expressionVectorSequence(
                                pvSeqKey, insertSeqKey, insertLinkers)
                            print newSeq

                        except MultipleSiteOccurrenceException:
                            e = MultipleSiteOccurrenceException(
                                "Sites found more than once on parent vector sequence"
                            )
                            print ` e.err_code() `

                        except FivePrimeAfterThreePrimeException:
                            e = FivePrimeAfterThreePrimeException(
                                "5' after 3'")
                            print ` e.err_code() `

                        except InsertSitesNotFoundOnParentSequenceException:
                            e = InsertSitesNotFoundOnParentSequenceException(
                                "Gateway sites not found on parent vector sequence"
                            )
                            print ` e.err_code() `

                else:
                    e = InvalidSequenceException("Invalid parent sequence")
                    print ` e.err_code() `
        else:
            e = ReagentDoesNotExistException("Unknown parent values")
            print ` e.err_code() `