def preview(): dbConn = DatabaseConn() db = dbConn.databaseConnect() cursor = db.cursor() hostname = dbConn.getHostname() rHandler = ReagentHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) prop_Alias_ID_Map = propMapper.mapPropAliasID() form = cgi.FieldStorage(keep_blank_values="True") #print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!! #print # DITTO #print `form` propVal = "" if form.has_key("PV"): pvVal = form.getvalue("PV") pvID = rHandler.convertReagentToDatabaseID(pvVal) if form.has_key("propAlias"): propAlias = form.getvalue("propAlias") if prop_Alias_ID_Map.has_key(propAlias): propID = prop_Alias_ID_Map[propAlias] propVal = rHandler.findSimplePropertyValue(pvID, propID) print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!! print # DITTO print propVal
def update(): dbConn = DatabaseConn() db = dbConn.databaseConnect() cursor = db.cursor() hostname = dbConn.getHostname() form = cgi.FieldStorage(keep_blank_values="True") print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!! print # DITTO #print `form` # Aug 29/07 uHandler = UserHandler(db, cursor) if form.has_key("curr_username"): # store the user ID for use throughout the session; add to other views in addition to create in PHP currUname = form.getvalue("curr_username") currUser = uHandler.getUserByDescription(currUname) Session.setUser(currUser) #else: # debug #currUname = 'Administrator' #currUser = uHandler.getUserByDescription(currUname) #Session.setUser(currUser) if form.has_key("cloning_method"): cloning_method = form.getvalue("cloning_method") #else: # debug #cloning_method = '1' # Handlers and mappers rHandler = ReagentHandler(db, cursor) #sHandler = SystemSetHandler(db, cursor) pHandler = ReagentPropertyHandler(db, cursor) raHandler = ReagentAssociationHandler(db, cursor) aHandler = AssociationHandler(db, cursor) dnaHandler = DNAHandler(db, cursor) commHandler = CommentHandler(db, cursor) protHandler = ProteinHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) assocMapper = ReagentAssociationMapper(db, cursor) # August 29/07: Restrict creation by user and project access packetHandler = ProjectDatabaseHandler(db, cursor) ######################################################## # Various maps ######################################################## prop_Alias_ID_Map = propMapper.mapPropAliasID() # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property prop_Name_Alias_Map = propMapper.mapPropNameAlias() # (propName, propAlias) prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id) # Restriction sites fpcs_prop_id = pHandler.findPropID("5' cloning site") tpcs_prop_id = pHandler.findPropID("3' cloning site") newFivePrime = form.getvalue("fpcs") newThreePrime = form.getvalue("tpcs") gatewaySites = ['attb', 'attl', 'attp', 'attr'] # nov. 16/07 # resulting sequence newSeq = "" # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects) currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader') currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer') publicProj = packetHandler.findAllProjects(isPrivate="FALSE") # list of Packet OBJECTS currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj) uPackets = [] for p in currUserWriteProjects: uPackets.append(p.getNumber()) # Get project IDs of parents packetPropID = pHandler.findPropID("packet id") # August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed newSeq = "" # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects) currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader') currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer') publicProj = packetHandler.findAllProjects(isPrivate="FALSE") # list of Packet OBJECTS currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj) uPackets = [] for p in currUserWriteProjects: uPackets.append(p.getNumber()) # Get project IDs of parents packetPropID = pHandler.findPropID("packet id") if form.has_key("PV"): pvVal = form.getvalue("PV") if len(pvVal) > 0: pvID = rHandler.convertReagentToDatabaseID(pvVal) try: pvProjectID = int(rHandler.findSimplePropertyValue(pvID, packetPropID)) pvSeqID = rHandler.findDNASequenceKey(pvID) # get sequence for reconstitution later except TypeError: #pvProjectID = 0 e = PVProjectAccessException("You are not authorized to use this Parent Vector, since you do not have Read access to its project.") print `e.err_code()` else: e = UnknownPVIDException("Unknown Parent Vector value") print `e.err_code()` return # else don't do anything, maybe want to delete parents!!! #else: #e = MissingPVException("No Parent Vector provided") #print `e.err_code()` if pvProjectID > 0 and currUser.getCategory() != 'Admin' and pvProjectID not in uPackets: e = PVProjectAccessException("Not authorized to access parent") print `e.err_code()` return if cloning_method == '1': # Non-recombination vector - Get the Insert if form.has_key("I"): insertVal = form.getvalue("I") if len(insertVal) > 0: insertID = rHandler.convertReagentToDatabaseID(insertVal) insertSeqID = rHandler.findDNASequenceKey(insertID) # fetch Insert sequence for reconstitution later try: insertProjectID = int(rHandler.findSimplePropertyValue(insertID, packetPropID)) except TypeError: #insertProjectID = 0 e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.") print `e.err_code()` else: #insertID = -1 #insertProjectID = 0 #print "Invalid Insert value" e = UnknownInsertIDException("Unknown Insert value") print `e.err_code()` return #else: # NO!!!!!!!! #e = MissingInsertException("No Insert provided") #print `e.err_code()` if insertProjectID > 0 and currUser.getCategory() != 'Admin' and insertProjectID not in uPackets: e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.") print `e.err_code()` return if pvID > 0 and insertID > 0 : # try to reconstruct sequence and issue warning if unable if pvSeqID > 0 and insertSeqID > 0: # fetch insert cloning sites insertCloningSites = [] fpcs_prop_id = pHandler.findPropID("5' cloning site") tpcs_prop_id = pHandler.findPropID("3' cloning site") fp_insert_cs = rHandler.findSimplePropertyValue(insertID, fpcs_prop_id) tp_insert_cs = rHandler.findSimplePropertyValue(insertID, tpcs_prop_id) # Determine if this is a Gateway clone from sites gwSites = False; if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower() == 'attl' and tp_insert_cs.lower() == 'attl': gwSites = True elif not fp_insert_cs or not tp_insert_cs: gwSites = True # nov. 16/07: added this for check elif fp_insert_cs.lower() in gatewaySites or tp_insert_cs.lower() in gatewaySites: gwSites = True else: gwSites = False; if gwSites: # this is a gateway clone # if sites were changed to something other than gateway, clear sequence if newFivePrime.lower() != 'attl' or newThreePrime.lower() != 'attl': e = InsertSitesNotFoundOnParentSequenceException() print `e.err_code()` return else: pvSeqKey = rHandler.findDNASequenceKey(pvID) # For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert insertLinkers = [] # Find Sense and Antisense Oligos for this Insert # (not using antisense just yet - verify with Karen) iHandler = InsertHandler(db, cursor) senseOligoID = iHandler.findSenseOligoID(insertID) #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id) # Find Oligo sequences seqPropID = pHandler.findPropID("sequence") senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID) senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID) # Fetch Insert sequence and find linkers from Oligo and Insert sequences insertSequence = dnaHandler.findSequenceByID(insertSeqID) attB_const = "ggggacaactttgtacaaaaaagttggc" fwd_primer_seq = senseOligoSequence[len(attB_const):] # First, find linkers from Oligos fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq) #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq) rev_linker = "" # Now see if the Insert had its own linkers stored and append them to the Oligo linker fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID) if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker tp_insert_linker = rev_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) try: newSeq = dnaHandler.entryVectorSequence(pvSeqKey, insertSeqID, insertLinkers) print newSeq except MultipleSiteOccurrenceException: e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence") print `e.err_code()` except FivePrimeAfterThreePrimeException: e = FivePrimeAfterThreePrimeException("5' after 3'") print `e.err_code()` except InsertSitesNotFoundOnParentSequenceException: e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence") print `e.err_code()` else: # Non-Gateway non-recombination Vector fp_insert_cs = newFivePrime tp_insert_cs = newThreePrime if fp_insert_cs: insertCloningSites.append(fp_insert_cs) else: insertCloningSites.append("") if tp_insert_cs: insertCloningSites.append(tp_insert_cs) else: insertCloningSites.append("") # get linkers if there are any insertLinkers = [] fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID) # sept. 3/07 fwd_linker = "" if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) try: newSeq = dnaHandler.constructNonRecombSequence(pvSeqID, insertSeqID, insertCloningSites, insertLinkers) print newSeq except (InsertSitesException): e = InsertSitesException("Could not reconstitute sequence: Unknown sites on Insert.") print e.err_code() except (InsertSitesNotFoundOnParentSequenceException): e = InsertSitesNotFoundOnParentSequenceException("Could not reconstitute sequence: Parent vector sequence does not contain restriction sites.") print e.err_code() except (MultipleSiteOccurrenceException): e = MultipleSiteOccurrenceException("Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence") print e.err_code() except (HybridizationException): e = HybridizationException("Could not reconstitute sequence: Restriction sites cannot be hybridized.") print e.err_code() except (FivePrimeAfterThreePrimeException): e = FivePrimeAfterThreePrimeException("Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence.") print e.err_code() else: e = InvalidSequenceException("Invalid parent sequence") print `e.err_code()` else: e = UnknownPVIDException("Unknown PV ID") print `e.err_code()` elif cloning_method == '2': # Recombination vector - check IPV ipvVal = form.getvalue("IPV") if len(ipvVal) > 0: ipvID = rHandler.convertReagentToDatabaseID(ipvVal) ipvProjectID = int(rHandler.findSimplePropertyValue(ipvID, packetPropID)) else: e = UnknownIPVIDException("Unknown IPV ID") print `e.err_code()` if ipvProjectID > 0 and currUser.getCategory() != 'Admin' and ipvProjectID not in uPackets: e = IPVProjectAccessException("Not authorized to view IPV") print `e.err_code()` if ipvID > 0 and pvID > 0: # If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence if not (newFivePrime == newThreePrime and (newFivePrime.lower() == 'loxp' and newThreePrime.lower() == 'loxp') or (newFivePrime.lower() == 'attb' and newThreePrime.lower() == 'attb')): e = InsertSitesNotFoundOnParentSequenceException("Invalid restriction sites for Non-Recombination Clone - must be LoxP only") print `e.err_code()` else: # get internal db IDs pv_db_id = rHandler.convertReagentToDatabaseID(pvVal) ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal) # Get the Insert that belongs to the donor vector ipvInsertAssocID = raHandler.findReagentAssociationID(ipv_db_id) insertAssocPropID = aHandler.findAssocPropID("insert id") insert_db_id = aHandler.findAssocPropValue(ipvInsertAssocID, insertAssocPropID) # Construct a sequence for the new vector from the sequences of its parents pvSeqKey = rHandler.findDNASequenceKey(pv_db_id) #print "pv seq " + `pvSeqKey` ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id) #print "ipv seq " + `ipvSeqKey` insertSeqKey = rHandler.findDNASequenceKey(insert_db_id) #print "i seq " + `insertSeqKey` if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0: # See if there are linkers, although there most likely aren't any insertLinkers = [] fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID) # sept. 3/07 fwd_linker = "" if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) # Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector if newFivePrime == 'LoxP' and newThreePrime == 'LoxP': # recombination try: newSeq = dnaHandler.constructRecombSequence(pvSeqKey, ipvSeqKey, insertSeqKey, insertLinkers) newSeqID = dnaHandler.matchSequence(newSeq) print newSeq except InsertSitesNotFoundOnParentSequenceException: e = InsertSitesNotFoundOnParentSequenceException("LOXP sites not found on parent vector sequence") print `e.err_code()` except MultipleSiteOccurrenceException: e = MultipleSiteOccurrenceException("LOXP found more than once on parent vector sequence") print `e.err_code()` elif newFivePrime == 'attB' and newThreePrime == 'attB': # Gateway Expression iHandler = InsertHandler(db, cursor) senseOligoID = iHandler.findSenseOligoID(insert_db_id) #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id) # Find Oligo sequences seqPropID = pHandler.findPropID("sequence") senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID) senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID) # Fetch Insert sequence and find linkers from Oligo and Insert sequences insertSequence = dnaHandler.findSequenceByID(insertSeqKey) attB_const = "ggggacaactttgtacaaaaaagttggc" fwd_primer_seq = senseOligoSequence[len(attB_const):] # First, find linkers from Oligos fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq) #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq) rev_linker = "" # Now see if the Insert had its own linkers stored and append them to the Oligo linker fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID) if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker tp_insert_linker = rev_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) try: newSeq = dnaHandler.expressionVectorSequence(pvSeqKey, insertSeqKey, insertLinkers) print newSeq except MultipleSiteOccurrenceException: e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence") print `e.err_code()` except FivePrimeAfterThreePrimeException: e = FivePrimeAfterThreePrimeException("5' after 3'") print `e.err_code()` except InsertSitesNotFoundOnParentSequenceException: e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence") print `e.err_code()` else: e = InvalidSequenceException("Invalid parent sequence") print `e.err_code()` else: e = ReagentDoesNotExistException("Unknown parent values") print `e.err_code()`
def update(): dbConn = DatabaseConn() db = dbConn.databaseConnect() cursor = db.cursor() hostname = dbConn.getHostname() form = cgi.FieldStorage(keep_blank_values="True") print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!! print # DITTO #print `form` # Aug 29/07 uHandler = UserHandler(db, cursor) if form.has_key("curr_username"): # store the user ID for use throughout the session; add to other views in addition to create in PHP currUname = form.getvalue("curr_username") currUser = uHandler.getUserByDescription(currUname) Session.setUser(currUser) #else: # debug #currUname = 'Administrator' #currUser = uHandler.getUserByDescription(currUname) #Session.setUser(currUser) if form.has_key("cloning_method"): cloning_method = form.getvalue("cloning_method") #else: # debug #cloning_method = '1' # Handlers and mappers rHandler = ReagentHandler(db, cursor) #sHandler = SystemSetHandler(db, cursor) pHandler = ReagentPropertyHandler(db, cursor) raHandler = ReagentAssociationHandler(db, cursor) aHandler = AssociationHandler(db, cursor) dnaHandler = DNAHandler(db, cursor) commHandler = CommentHandler(db, cursor) protHandler = ProteinHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) assocMapper = ReagentAssociationMapper(db, cursor) # August 29/07: Restrict creation by user and project access packetHandler = ProjectDatabaseHandler(db, cursor) ######################################################## # Various maps ######################################################## prop_Alias_ID_Map = propMapper.mapPropAliasID( ) # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property prop_Name_Alias_Map = propMapper.mapPropNameAlias( ) # (propName, propAlias) prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id) # Restriction sites fpcs_prop_id = pHandler.findPropID("5' cloning site") tpcs_prop_id = pHandler.findPropID("3' cloning site") newFivePrime = form.getvalue("fpcs") newThreePrime = form.getvalue("tpcs") gatewaySites = ['attb', 'attl', 'attp', 'attr'] # nov. 16/07 # resulting sequence newSeq = "" # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects) currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader') currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer') publicProj = packetHandler.findAllProjects(isPrivate="FALSE") # list of Packet OBJECTS currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj) uPackets = [] for p in currUserWriteProjects: uPackets.append(p.getNumber()) # Get project IDs of parents packetPropID = pHandler.findPropID("packet id") # August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed newSeq = "" # Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects) currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader') currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer') publicProj = packetHandler.findAllProjects(isPrivate="FALSE") # list of Packet OBJECTS currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj) uPackets = [] for p in currUserWriteProjects: uPackets.append(p.getNumber()) # Get project IDs of parents packetPropID = pHandler.findPropID("packet id") if form.has_key("PV"): pvVal = form.getvalue("PV") if len(pvVal) > 0: pvID = rHandler.convertReagentToDatabaseID(pvVal) try: pvProjectID = int( rHandler.findSimplePropertyValue(pvID, packetPropID)) pvSeqID = rHandler.findDNASequenceKey( pvID) # get sequence for reconstitution later except TypeError: #pvProjectID = 0 e = PVProjectAccessException( "You are not authorized to use this Parent Vector, since you do not have Read access to its project." ) print ` e.err_code() ` else: e = UnknownPVIDException("Unknown Parent Vector value") print ` e.err_code() ` return # else don't do anything, maybe want to delete parents!!! #else: #e = MissingPVException("No Parent Vector provided") #print `e.err_code()` if pvProjectID > 0 and currUser.getCategory( ) != 'Admin' and pvProjectID not in uPackets: e = PVProjectAccessException("Not authorized to access parent") print ` e.err_code() ` return if cloning_method == '1': # Non-recombination vector - Get the Insert if form.has_key("I"): insertVal = form.getvalue("I") if len(insertVal) > 0: insertID = rHandler.convertReagentToDatabaseID(insertVal) insertSeqID = rHandler.findDNASequenceKey( insertID) # fetch Insert sequence for reconstitution later try: insertProjectID = int( rHandler.findSimplePropertyValue( insertID, packetPropID)) except TypeError: #insertProjectID = 0 e = InsertProjectAccessException( "You are not authorized to use this Insert, since you do not have Read access to its project." ) print ` e.err_code() ` else: #insertID = -1 #insertProjectID = 0 #print "Invalid Insert value" e = UnknownInsertIDException("Unknown Insert value") print ` e.err_code() ` return #else: # NO!!!!!!!! #e = MissingInsertException("No Insert provided") #print `e.err_code()` if insertProjectID > 0 and currUser.getCategory( ) != 'Admin' and insertProjectID not in uPackets: e = InsertProjectAccessException( "You are not authorized to use this Insert, since you do not have Read access to its project." ) print ` e.err_code() ` return if pvID > 0 and insertID > 0: # try to reconstruct sequence and issue warning if unable if pvSeqID > 0 and insertSeqID > 0: # fetch insert cloning sites insertCloningSites = [] fpcs_prop_id = pHandler.findPropID("5' cloning site") tpcs_prop_id = pHandler.findPropID("3' cloning site") fp_insert_cs = rHandler.findSimplePropertyValue( insertID, fpcs_prop_id) tp_insert_cs = rHandler.findSimplePropertyValue( insertID, tpcs_prop_id) # Determine if this is a Gateway clone from sites gwSites = False if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower( ) == 'attl' and tp_insert_cs.lower() == 'attl': gwSites = True elif not fp_insert_cs or not tp_insert_cs: gwSites = True # nov. 16/07: added this for check elif fp_insert_cs.lower( ) in gatewaySites or tp_insert_cs.lower() in gatewaySites: gwSites = True else: gwSites = False if gwSites: # this is a gateway clone # if sites were changed to something other than gateway, clear sequence if newFivePrime.lower() != 'attl' or newThreePrime.lower( ) != 'attl': e = InsertSitesNotFoundOnParentSequenceException() print ` e.err_code() ` return else: pvSeqKey = rHandler.findDNASequenceKey(pvID) # For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert insertLinkers = [] # Find Sense and Antisense Oligos for this Insert # (not using antisense just yet - verify with Karen) iHandler = InsertHandler(db, cursor) senseOligoID = iHandler.findSenseOligoID(insertID) #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id) # Find Oligo sequences seqPropID = pHandler.findPropID("sequence") senseOligoSeqID = rHandler.findIndexPropertyValue( senseOligoID, seqPropID) senseOligoSequence = dnaHandler.findSequenceByID( senseOligoSeqID) # Fetch Insert sequence and find linkers from Oligo and Insert sequences insertSequence = dnaHandler.findSequenceByID( insertSeqID) attB_const = "ggggacaactttgtacaaaaaagttggc" fwd_primer_seq = senseOligoSequence[len(attB_const):] # First, find linkers from Oligos fwd_linker = dnaHandler.linker_from_oligo( insertSequence, fwd_primer_seq) #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq) rev_linker = "" # Now see if the Insert had its own linkers stored and append them to the Oligo linker fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue( insertID, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue( insertID, tpLinkerPropID) if fp_insert_linker and len( fp_insert_linker ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker tp_insert_linker = rev_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) try: newSeq = dnaHandler.entryVectorSequence( pvSeqKey, insertSeqID, insertLinkers) print newSeq except MultipleSiteOccurrenceException: e = MultipleSiteOccurrenceException( "Sites found more than once on parent vector sequence" ) print ` e.err_code() ` except FivePrimeAfterThreePrimeException: e = FivePrimeAfterThreePrimeException( "5' after 3'") print ` e.err_code() ` except InsertSitesNotFoundOnParentSequenceException: e = InsertSitesNotFoundOnParentSequenceException( "Gateway sites not found on parent vector sequence" ) print ` e.err_code() ` else: # Non-Gateway non-recombination Vector fp_insert_cs = newFivePrime tp_insert_cs = newThreePrime if fp_insert_cs: insertCloningSites.append(fp_insert_cs) else: insertCloningSites.append("") if tp_insert_cs: insertCloningSites.append(tp_insert_cs) else: insertCloningSites.append("") # get linkers if there are any insertLinkers = [] fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue( insertID, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue( insertID, tpLinkerPropID) # sept. 3/07 fwd_linker = "" if fp_insert_linker and len( fp_insert_linker ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) try: newSeq = dnaHandler.constructNonRecombSequence( pvSeqID, insertSeqID, insertCloningSites, insertLinkers) print newSeq except (InsertSitesException): e = InsertSitesException( "Could not reconstitute sequence: Unknown sites on Insert." ) print e.err_code() except (InsertSitesNotFoundOnParentSequenceException): e = InsertSitesNotFoundOnParentSequenceException( "Could not reconstitute sequence: Parent vector sequence does not contain restriction sites." ) print e.err_code() except (MultipleSiteOccurrenceException): e = MultipleSiteOccurrenceException( "Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence" ) print e.err_code() except (HybridizationException): e = HybridizationException( "Could not reconstitute sequence: Restriction sites cannot be hybridized." ) print e.err_code() except (FivePrimeAfterThreePrimeException): e = FivePrimeAfterThreePrimeException( "Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence." ) print e.err_code() else: e = InvalidSequenceException("Invalid parent sequence") print ` e.err_code() ` else: e = UnknownPVIDException("Unknown PV ID") print ` e.err_code() ` elif cloning_method == '2': # Recombination vector - check IPV ipvVal = form.getvalue("IPV") if len(ipvVal) > 0: ipvID = rHandler.convertReagentToDatabaseID(ipvVal) ipvProjectID = int( rHandler.findSimplePropertyValue(ipvID, packetPropID)) else: e = UnknownIPVIDException("Unknown IPV ID") print ` e.err_code() ` if ipvProjectID > 0 and currUser.getCategory( ) != 'Admin' and ipvProjectID not in uPackets: e = IPVProjectAccessException("Not authorized to view IPV") print ` e.err_code() ` if ipvID > 0 and pvID > 0: # If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence if not (newFivePrime == newThreePrime and (newFivePrime.lower() == 'loxp' and newThreePrime.lower() == 'loxp') or (newFivePrime.lower() == 'attb' and newThreePrime.lower() == 'attb')): e = InsertSitesNotFoundOnParentSequenceException( "Invalid restriction sites for Non-Recombination Clone - must be LoxP only" ) print ` e.err_code() ` else: # get internal db IDs pv_db_id = rHandler.convertReagentToDatabaseID(pvVal) ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal) # Get the Insert that belongs to the donor vector ipvInsertAssocID = raHandler.findReagentAssociationID( ipv_db_id) insertAssocPropID = aHandler.findAssocPropID("insert id") insert_db_id = aHandler.findAssocPropValue( ipvInsertAssocID, insertAssocPropID) # Construct a sequence for the new vector from the sequences of its parents pvSeqKey = rHandler.findDNASequenceKey(pv_db_id) #print "pv seq " + `pvSeqKey` ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id) #print "ipv seq " + `ipvSeqKey` insertSeqKey = rHandler.findDNASequenceKey(insert_db_id) #print "i seq " + `insertSeqKey` if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0: # See if there are linkers, although there most likely aren't any insertLinkers = [] fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue( insert_db_id, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue( insert_db_id, tpLinkerPropID) # sept. 3/07 fwd_linker = "" if fp_insert_linker and len( fp_insert_linker ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) # Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector if newFivePrime == 'LoxP' and newThreePrime == 'LoxP': # recombination try: newSeq = dnaHandler.constructRecombSequence( pvSeqKey, ipvSeqKey, insertSeqKey, insertLinkers) newSeqID = dnaHandler.matchSequence(newSeq) print newSeq except InsertSitesNotFoundOnParentSequenceException: e = InsertSitesNotFoundOnParentSequenceException( "LOXP sites not found on parent vector sequence" ) print ` e.err_code() ` except MultipleSiteOccurrenceException: e = MultipleSiteOccurrenceException( "LOXP found more than once on parent vector sequence" ) print ` e.err_code() ` elif newFivePrime == 'attB' and newThreePrime == 'attB': # Gateway Expression iHandler = InsertHandler(db, cursor) senseOligoID = iHandler.findSenseOligoID(insert_db_id) #antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id) # Find Oligo sequences seqPropID = pHandler.findPropID("sequence") senseOligoSeqID = rHandler.findIndexPropertyValue( senseOligoID, seqPropID) senseOligoSequence = dnaHandler.findSequenceByID( senseOligoSeqID) # Fetch Insert sequence and find linkers from Oligo and Insert sequences insertSequence = dnaHandler.findSequenceByID( insertSeqKey) attB_const = "ggggacaactttgtacaaaaaagttggc" fwd_primer_seq = senseOligoSequence[len(attB_const):] # First, find linkers from Oligos fwd_linker = dnaHandler.linker_from_oligo( insertSequence, fwd_primer_seq) #rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq) rev_linker = "" # Now see if the Insert had its own linkers stored and append them to the Oligo linker fpLinkerPropID = pHandler.findPropID("5' linker") tpLinkerPropID = pHandler.findPropID("3' linker") fp_insert_linker = rHandler.findSimplePropertyValue( insert_db_id, fpLinkerPropID) tp_insert_linker = rHandler.findSimplePropertyValue( insert_db_id, tpLinkerPropID) if fp_insert_linker and len( fp_insert_linker ) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0': fp_insert_linker = fwd_linker + fp_insert_linker else: fp_insert_linker = fwd_linker tp_insert_linker = rev_linker insertLinkers.append(fp_insert_linker) insertLinkers.append(tp_insert_linker) try: newSeq = dnaHandler.expressionVectorSequence( pvSeqKey, insertSeqKey, insertLinkers) print newSeq except MultipleSiteOccurrenceException: e = MultipleSiteOccurrenceException( "Sites found more than once on parent vector sequence" ) print ` e.err_code() ` except FivePrimeAfterThreePrimeException: e = FivePrimeAfterThreePrimeException( "5' after 3'") print ` e.err_code() ` except InsertSitesNotFoundOnParentSequenceException: e = InsertSitesNotFoundOnParentSequenceException( "Gateway sites not found on parent vector sequence" ) print ` e.err_code() ` else: e = InvalidSequenceException("Invalid parent sequence") print ` e.err_code() ` else: e = ReagentDoesNotExistException("Unknown parent values") print ` e.err_code() `