def test_doesnt_give_a_flying_damn_about_spurious_filter_header(self): chrom = "22" variant = Variant(chrom, 11, "A", "C") schema = Schema() complex_filter_name = '.+-*\\/~@?!%^&><=\"\'(){}[]_|' schema.set_filter(complex_filter_name, 'unusual characters') gv_builder = VCFBuilder(join(self.work_dir, "genotype.vcf"), schema=schema) gv_builder.with_record_from_variant(variant, filters={complex_filter_name}) gv_builder.build().index() driver = SVCDriver(self) dodgy_sample = "bobs_your_uncle" driver.with_ref_sequence( "ACGCCCCCTGCAAAAAAAAAA", chrom=chrom, pos_from=0).with_read( "...........C.........", n_fwd=5, n_rev=5, chrom=chrom, sample_name=dodgy_sample).with_genotype_alleles( gv_builder.compressed_filename) expect = driver.call(expected_success=True) expect .with_output_vcf()\ .has_record_for_variant(variant)\ .with_sample(dodgy_sample)\ .has_genotype("1/1")
def test_should_write_filter_in_expected_format(self): mock_file = StringIO() schema = Schema() schema.set_filter('key', 'a filter') writer = VCFWriter(mock_file) writer.write_header(schema) expected_file = '##fileformat=VCFv4.2\n' \ '##FILTER=<ID=key,Description="a filter">\n' \ '#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\n' self.assertEqual(expected_file, mock_file.getvalue())
def test_should_parse_valid_filter_header_fields(self): lines = [ '##fileformat=VCFv4.2\n', '##FILTER=<ID=key,Description="description">\n', '#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\n', ] reader = VCFReader(iter(lines)) header = reader.read_header() expected = Schema() expected.set_filter('key', 'description') self.assertEqual(expected, header)
def wecall_schema(file_date=None, reference=None, contigs=None, add_ref_calls=True, format='4.2'): schema = Schema() if file_date is not None: schema.file_metadata['fileDate'] = file_date if reference is not None: schema.file_metadata['reference'] = reference app_name = 'weCall' version_number = '2.0.1' app = {'4.1': None, '4.2': app_name}[format] version = {'4.1': None, '4.2': version_number}[format] schema.file_metadata[ 'disclaimer'] = 'This software is in beta-testing. Results generated using the software are confidential and should only be used for research purposes in accordance with the legal agreement with Genomics plc.' # noqa schema.file_metadata['source'] = '{application!s} v{version!s}'.format( application=app_name, version=version_number) # noqa schema.set_info_data( 'ABPV', 'A', 'Float', 'Allele bias P-value; probability that fraction of reads supporting alt allele (VC) amongst read depth (DP) is ' 'more extreme than expected assuming a beta-binomial distribution.', app, version) # noqa schema.set_info_data( 'MQ', 'A', 'Float', 'Root mean square of mapping quality of reads supporting each alternative allele.', app, version) # noqa schema.set_info_data( 'PP', 'A', 'Integer', 'Posterior probability (phred scaled) that this variant does not segregate.', app, version) # noqa schema.set_info_data( 'SBPV', 'A', 'Float', 'Strand bias P-value; probability that the fraction of forward reads (VCF) amongst reads supporting alt allele ' '(VC) is more extreme than expected assuming a beta-binomial distribution.', app, version) # noqa schema.set_info_data('DP', '1', 'Integer', 'Total depth of read coverage at this locus.', app, version) schema.set_info_data( 'DPF', '1', 'Integer', 'Total probabilistic depth of forward read coverage at this locus (sum of probabilities of each read supporting ' 'the variant).', app, version) # noqa schema.set_info_data( 'DPR', '1', 'Integer', 'Total probabilistic depth of reverse read coverage at this locus (sum of probabilities of each read supporting ' 'the variant).', app, version) # noqa schema.set_info_data( 'VC', 'A', 'Integer', 'Total probabilistic number of reads supporting each alternative allele (sum of probabilities of each read ' 'supporting the allele).', app, version) # noqa schema.set_info_data( 'VCF', 'A', 'Integer', 'Total probabilistic number of forward reads supporting each alternative allele (sum of probabilities of ' 'each read supporting the allele).', app, version) # noqa schema.set_info_data( 'VCR', 'A', 'Integer', 'Total probabilistic number of reverse reads supporting each alternative allele (sum of probabilities of each ' 'read supporting the allele).', app, version) # noqa schema.set_info_data( 'QD', 'A', 'Float', 'Ratio of phred-scaled posterior probability (PP) to number of supporting reads for each allele (VC).', app, version) # noqa schema.set_info_data( 'BR', 'A', 'Float', 'The median of the per-read min base quality (within a interval of the locus) taken over reads supporting ' 'each allele.', app, version) # noqa schema.set_sample_data( 'GT', '1', 'String', 'Genotypes of reference and alternative alleles in order listed.') if add_ref_calls: schema.set_info_data('BEG', '1', 'Integer', 'Start position of reference call block.', app, version) schema.set_info_data( 'END', '1', 'Integer', 'End position of reference call block (inclusive).', app, version) schema.set_info_data('LEN', '1', 'Integer', 'Length of reference call block.', app, version) schema.set_sample_data( 'MIN_DP', '1', 'Integer', 'Minimum read coverage observed within the reference block.') schema.set_sample_data( 'GQ', '1', 'Integer', 'Phred-scaled genotype quality (i.e. posterior probability that the genotype call is incorrect).' ) # noqa schema.set_sample_data( 'PQ', '1', 'Integer', 'Phred-scaled phase quality (i.e. posterior probability that the phasing is incorrect).' ) # noqa schema.set_sample_data('PS', '1', 'String', 'Phase set id.') # noqa schema.set_sample_data( 'PL', 'G', 'Integer', "Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification." ) # noqa schema.set_sample_data( 'DP', '1', 'Integer', 'Number of reads overlapping the variant site (i.e. INFO::DP split out by sample). For reference calls the average depth (rounded to the nearest integer) over the region is reported.' ) # noqa schema.set_sample_data( 'AD', '.', 'Integer', 'Probabilistic allelic depths for the ref and alt alleles in the order listed (i.e. INFO::VC split out by sample).' ) # noqa schema.set_sample_data( 'VAF', 'A', 'Float', 'Probabilistic variant allelic frequencies for each alt allele (FORMAT::AD / FORMAT::DP).' ) # noqa schema.set_filter( 'AB', 'Allele Bias: Indicates lower number of reads supporting variant than expected (any of INFO::ABPV < 0.009).' ) # noqa schema.set_filter( 'SB', 'Strand Bias: Indicates imbalance between number of forward and reverse reads supporting variant (any of INFO::SBPV < 0.01).' ) # noqa schema.set_filter( 'AB+SB', 'Allele + Strand Bias: Indicates that both the AB and SB filters are close to being triggered (any of INFO::ABPV + INFO::SBPV < 0.07).' ) # noqa schema.set_filter( 'MQ', 'low Mapping Quality: Indicates presence of low mapping quality (any of INFO::MQ < 25).' ) # noqa schema.set_filter( 'QD', 'Quality over Depth: Indicates low quality relative to number of supporting reads (any of INFO::QD < 3.5 for Indels or INFO::QD < 8 otherwise).' ) # noqa schema.set_filter( 'BR', 'Bad Reads: Indicates low quality base pairs on reads in the vicinity of variant locus (any of INFO::BR < 0).' ) # noqa schema.set_filter( 'NC', 'Not called: Indicates a variant that was not positively genotyped in any sample.' ) # noqa schema.set_filter( 'LQ', 'Low Quality: Indicates a low variant quality (any of INFO::PP < 10).' ) # noqa if contigs is not None: for contig_name, contig_data in contigs.items(): schema.set_contig(contig_name, **contig_data) return schema