def test_unequal_log_likelihood(self):
"""Assert that the log likelihood function gives greater log likelihood to the more likely choice."""
# define a sequence pair with many more transitions than transversions
sequence_pair = ('AAAAAAAAAACCCCCCCCCC', 'ATGGGGGGGGCGTTTTTTTT')
uniform_nt_dist = (0.25, 0.25, 0.25, 0.25)
more_likely_model = F84.create_rate_matrix(1.0, uniform_nt_dist)
less_likely_model = F84.create_rate_matrix(0.0, uniform_nt_dist)
greater_log_likelihood = get_log_likelihood(1.0, sequence_pair, more_likely_model)
smaller_log_likelihood = get_log_likelihood(1.0, sequence_pair, less_likely_model)
self.failUnless(greater_log_likelihood > smaller_log_likelihood)
def test_unequal_log_likelihood(self):
"""Assert that the log likelihood function gives greater log likelihood to the more likely choice."""
# define a sequence pair with many more transitions than transversions
sequence_pair = ('AAAAAAAAAACCCCCCCCCC', 'ATGGGGGGGGCGTTTTTTTT')
uniform_nt_dist = (0.25, 0.25, 0.25, 0.25)
more_likely_model = F84.create_rate_matrix(1.0, uniform_nt_dist)
less_likely_model = F84.create_rate_matrix(0.0, uniform_nt_dist)
greater_log_likelihood = get_log_likelihood(1.0, sequence_pair,
more_likely_model)
smaller_log_likelihood = get_log_likelihood(1.0, sequence_pair,
less_likely_model)
self.failUnless(greater_log_likelihood > smaller_log_likelihood)
def get_response_content(fs):
# read the nucleotide weights
nt_weights = [fs.A, fs.C, fs.G, fs.T]
# convert the nucleotide weights to probabilities
nt_probs = [x / float(sum(nt_weights)) for x in nt_weights]
# Assert that the kappa value and the nucleotide
# probabilities are compatible.
A, C, G, T = nt_probs
R = float(A + G)
Y = float(C + T)
if R <= 0:
raise HandlingError("the frequency of a purine must be positive")
if Y <= 0:
raise HandlingError("the frequency of a pyrimidine must be positive")
if fs.kappa <= max(-Y, -R):
msg_a = "kappa must be greater than max(-R, -Y) "
msg_b = "where R and Y are the purine and pyrimidine frequencies"
raise HandlingError(msg_a + msg_b)
# Create the rate matrix object
# which is automatically scaled to a rate of 1.0.
model = F84.create_rate_matrix(fs.kappa, nt_probs)
# simulate a pair of sequences
sequence_pair = PairLikelihood.simulate_sequence_pair(fs.distance, model, fs.length)
# convert the pair of sequences to an alignment object
aln = StringIO()
print >> aln, ">first"
print >> aln, "".join(sequence_pair[0])
print >> aln, ">second"
print >> aln, "".join(sequence_pair[1])
return Fasta.Alignment(StringIO(aln.getvalue())).to_fasta_string() + "\n"
def get_response_content(fs):
# read the nucleotide weights
nt_weights = [fs.A, fs.C, fs.G, fs.T]
# convert the nucleotide weights to probabilities
nt_probs = [x / float(sum(nt_weights)) for x in nt_weights]
# Assert that the kappa value and the nucleotide
# probabilities are compatible.
A, C, G, T = nt_probs
R = float(A + G)
Y = float(C + T)
if R <= 0:
raise HandlingError('the frequency of a purine must be positive')
if Y <= 0:
raise HandlingError('the frequency of a pyrimidine must be positive')
if fs.kappa <= max(-Y, -R):
msg_a = 'kappa must be greater than max(-R, -Y) '
msg_b = 'where R and Y are the purine and pyrimidine frequencies'
raise HandlingError(msg_a + msg_b)
# Create the rate matrix object
# which is automatically scaled to a rate of 1.0.
model = F84.create_rate_matrix(fs.kappa, nt_probs)
# simulate a pair of sequences
sequence_pair = PairLikelihood.simulate_sequence_pair(
fs.distance, model, fs.length)
# convert the pair of sequences to an alignment object
aln = StringIO()
print >> aln, '>first'
print >> aln, ''.join(sequence_pair[0])
print >> aln, '>second'
print >> aln, ''.join(sequence_pair[1])
return Fasta.Alignment(StringIO(aln.getvalue())).to_fasta_string() + '\n'
def test_basic_log_likelihood(self):
"""Assert that the log likelihood function does not give an error for simple input."""
kappa = 0.5
nt_dist = (0.25, 0.25, 0.25, 0.25)
model = F84.create_rate_matrix(kappa, nt_dist)
sequence_pair = ('AAAA', 'ACGT')
t = 2.0
result = get_log_likelihood(t, sequence_pair, model)
def test_basic_log_likelihood(self):
"""Assert that the log likelihood function does not give an error for simple input."""
kappa = 0.5
nt_dist = (0.25, 0.25, 0.25, 0.25)
model = F84.create_rate_matrix(kappa, nt_dist)
sequence_pair = ('AAAA', 'ACGT')
t = 2.0
result = get_log_likelihood(t, sequence_pair, model)
def get_response_content(fs):
# get the alignment object
try:
alignment = Fasta.Alignment(StringIO(fs.fasta))
except Fasta.AlignmentError as e:
raise HandlingError('alignment error: ' + str(e))
# assert that the alignment is of exactly two sequences
if len(alignment.sequences) != 2:
raise HandlingError('expected a pair of sequences')
# assert that the alignment is a gapless unambiguous nucleotide alignment
old_column_count = alignment.get_column_count()
try:
alignment.force_nucleotide()
except Fasta.AlignmentError as e:
raise HandlingError('nucleotide alignment error: ' + str(e))
new_column_count = alignment.get_column_count()
if old_column_count != new_column_count:
msg = 'expected a gapless unambiguous nucleotide alignment'
raise HandlingError(msg)
# get the maximum likelihood estimates according to a numeric optimizer.
f = F84.Objective(alignment.sequences)
values = list(f.get_initial_parameters())
result = scipy.optimize.fmin(f, values, ftol=1e-10, disp=0)
distance, kappa, wC, wG, wT = result
nt_distribution = F84.parameters_to_distribution((wC, wG, wT))
A, C, G, T = nt_distribution
model = F84.create_rate_matrix(kappa, nt_distribution)
log_likelihood = PairLikelihood.get_log_likelihood(distance,
alignment.sequences,
model)
# begin the response
out = StringIO()
print >> out, 'ML distance:', distance
print >> out, 'ML kappa:', kappa
print >> out, 'ML A frequency:', A
print >> out, 'ML C frequency:', C
print >> out, 'ML G frequency:', G
print >> out, 'ML T frequency:', T
print >> out, 'log likelihood:', log_likelihood
# write the response
return out.getvalue()
def get_response_content(fs):
# get the alignment object
try:
alignment = Fasta.Alignment(StringIO(fs.fasta))
except Fasta.AlignmentError as e:
raise HandlingError('alignment error: ' + str(e))
# assert that the alignment is of exactly two sequences
if len(alignment.sequences) != 2:
raise HandlingError('expected a pair of sequences')
# assert that the alignment is a gapless unambiguous nucleotide alignment
old_column_count = alignment.get_column_count()
try:
alignment.force_nucleotide()
except Fasta.AlignmentError as e:
raise HandlingError('nucleotide alignment error: ' + str(e))
new_column_count = alignment.get_column_count()
if old_column_count != new_column_count:
msg = 'expected a gapless unambiguous nucleotide alignment'
raise HandlingError(msg)
# get the maximum likelihood estimates according to a numeric optimizer.
f = F84.Objective(alignment.sequences)
values = list(f.get_initial_parameters())
result = scipy.optimize.fmin(f, values, ftol=1e-10, disp=0)
distance, kappa, wC, wG, wT= result
nt_distribution = F84.parameters_to_distribution((wC, wG, wT))
A, C, G, T = nt_distribution
model = F84.create_rate_matrix(kappa, nt_distribution)
log_likelihood = PairLikelihood.get_log_likelihood(
distance, alignment.sequences, model)
# begin the response
out = StringIO()
print >> out, 'ML distance:', distance
print >> out, 'ML kappa:', kappa
print >> out, 'ML A frequency:', A
print >> out, 'ML C frequency:', C
print >> out, 'ML G frequency:', G
print >> out, 'ML T frequency:', T
print >> out, 'log likelihood:', log_likelihood
# write the response
return out.getvalue()
def get_response_content(fs):
# get the alignment object
try:
alignment = Fasta.Alignment(fs.fasta.splitlines())
except Fasta.AlignmentError as e:
raise HandlingError('alignment error: ' + str(e))
# assert that the alignment is of exactly two sequences
if len(alignment.sequences) != 2:
raise HandlingError('expected a pair of sequences')
# assert that the alignment is a gapless unambiguous nucleotide alignment
old_column_count = alignment.get_column_count()
try:
alignment.force_nucleotide()
except Fasta.AlignmentError as e:
raise HandlingError('nucleotide alignment error: ' + str(e))
new_column_count = alignment.get_column_count()
if old_column_count != new_column_count:
msg = 'expected a gapless unambiguous nucleotide alignment'
raise HandlingError(msg)
# get the maximum likelihood estimates
sequence_pair = alignment.sequences
distance, kappa, A, C, G, T = F84.get_closed_form_estimates(sequence_pair)
# get the log likelihood
nt_distribution = (A, C, G, T)
rate_matrix_object = F84.create_rate_matrix(kappa, nt_distribution)
log_likelihood = PairLikelihood.get_log_likelihood(distance,
alignment.sequences,
rate_matrix_object)
# begin the response
out = StringIO()
print >> out, 'distance:', distance
print >> out, 'kappa:', kappa
print >> out, 'A frequency:', A
print >> out, 'C frequency:', C
print >> out, 'G frequency:', G
print >> out, 'T frequency:', T
print >> out, 'log likelihood:', log_likelihood
# return the response
return out.getvalue()
def test_basic_simulation(self):
"""Assert that the sequence pair simulation does not give an error for simple input."""
kappa = 0.5
nt_dist = (0.25, 0.25, 0.25, 0.25)
model = F84.create_rate_matrix(kappa, nt_dist)
t = 2.0
n_sites = 100
result = simulate_sequence_pair(t, model, n_sites)
self.assertEqual(len(result), 2)
self.assertEqual(len(result[0]), 100)
self.assertEqual(len(result[1]), 100)
result_state_set = set(result[0]+result[1])
self.failUnless(result_state_set <= set('ACGT'))
def test_basic_simulation(self):
"""Assert that the sequence pair simulation does not give an error for simple input."""
kappa = 0.5
nt_dist = (0.25, 0.25, 0.25, 0.25)
model = F84.create_rate_matrix(kappa, nt_dist)
t = 2.0
n_sites = 100
result = simulate_sequence_pair(t, model, n_sites)
self.assertEqual(len(result), 2)
self.assertEqual(len(result[0]), 100)
self.assertEqual(len(result[1]), 100)
result_state_set = set(result[0] + result[1])
self.failUnless(result_state_set <= set('ACGT'))
def get_response_content(fs):
# get the alignment object
try:
alignment = Fasta.Alignment(fs.fasta.splitlines())
except Fasta.AlignmentError as e:
raise HandlingError('alignment error: ' + str(e))
# assert that the alignment is of exactly two sequences
if len(alignment.sequences) != 2:
raise HandlingError('expected a pair of sequences')
# assert that the alignment is a gapless unambiguous nucleotide alignment
old_column_count = alignment.get_column_count()
try:
alignment.force_nucleotide()
except Fasta.AlignmentError as e:
raise HandlingError('nucleotide alignment error: ' + str(e))
new_column_count = alignment.get_column_count()
if old_column_count != new_column_count:
msg = 'expected a gapless unambiguous nucleotide alignment'
raise HandlingError(msg)
# get the maximum likelihood estimates
sequence_pair = alignment.sequences
distance, kappa, A, C, G, T = F84.get_closed_form_estimates(sequence_pair)
# get the log likelihood
nt_distribution = (A, C, G, T)
rate_matrix_object = F84.create_rate_matrix(kappa, nt_distribution)
log_likelihood = PairLikelihood.get_log_likelihood(
distance, alignment.sequences, rate_matrix_object)
# begin the response
out = StringIO()
print >> out, 'distance:', distance
print >> out, 'kappa:', kappa
print >> out, 'A frequency:', A
print >> out, 'C frequency:', C
print >> out, 'G frequency:', G
print >> out, 'T frequency:', T
print >> out, 'log likelihood:', log_likelihood
# return the response
return out.getvalue()
